INTERNATIONAL SR.SEC.

SCHOOL, NAMAKKAL

XII
BIOLOGY
(CBSE)

2024 - 2025
VOLUME - II
 INDEX
PAGE
CHAPTER CHAPTER NAME
NO.

BOTANY

1 MICROBES IN HUMAN WELFARE 1

BIOTECHNOLOGY PRINCIPLES AND

2 18
PROCESSES
BIOTECHNOLOGY AND ITS
3 47
APPLICATIONS

ZOOLOGY
1 HUMAN HEALTH AND DISEASES 65

2 ORGANISMS AND POPULATION 75

3 ECOSYSTEM 90

4 BIODIVERSITY AND CONSERVATION 104

 1

BOTANY
MICROBES IN HUMAN WELFARE

2 MARK QUESTIONS :
1. What is the use of statins? Name their source?
Statins are produced by the yeast Monascus purpureus that have been commercialised as blood
cholesterol lowering agents. It acts by competitively inhibiting the enzyme responsible for synthesis of
cholesterol.

2. Name the microbes that help in production of the following products commercially?
a) Cyclosporin - a b) Penicillin c) Swiss cheese d) Butyric acid
a) Trichoderma polysporum - Cyclosporin - A
b) Penicillium notatum - Penicillin
c) Propionibacterium sharmanii - Swiss cheese
d) Clostridium butylicum - Butyric acid

3. Bottled fruit juices are clearer as compared to those made at home. Explain?
Bottled fruit juices bought from the market are clearer as compared to those made at home. This is
because the bottled juices are clarified by the use of pectinases and proteases.

4. Explain the significant role of genus “Nucleopolyhedrovirus” in an ecological sensitive area”?

Nucleopolyhedroviruses are excellent candidates for species – specific, narrow spectrum insecticidal
applications. They have been shown to have no negative impacts on plants, mammals, birds, fish, or
even non- target insects. This is especially desirable when beneficial insects are being conserved to aid
in an overall integrated pest management (IPM) programme, or when an ecologically sensitive area is
being treated.

5. Explain different stages involved in primary sewage treatment?

Primary sewage treatment steps basically involved physical removal of particles – large and small –
from the sewage through filtration and sedimentation.
a) Filtration:- floating debris is removed by sequential filtration.
b) Sedimentation:- The grit (soil and small pebbles) are removed by sedimentation.

Hreen Qark, Okl Q & A [VOLUME - II]

 2

6. What is Mycorrhiza? How does it help as biofertilizer?

Mycorrhizae:- Fungi are also known to form symbiotic association with roots of higher plants called as
Mycorrhiza.
Many members of the genus Glomus form mycorrhiza
The fungal symbiont in these associations absorbs phosphorus from soil and passes it to the plant,
and plant also provide shelter and nutrients to the fungi. Plants having such associations show other
benefits also, such as resistance to root borne pathogens, tolerance to salinity and drought, and overall
increase in plant growth and development.

7. Expand LAB and what is its role.

LAB refers to : Lactic Acid Bacteria
Role :
i) Conversion of Milk into curd.
ii) To check disease – causing microbes in human stomach.
iii) Improves nutritional quality of curd by increasing vitamin B12.

8. Give examples for Fermented Beverages that are produced by distillation and with out distillation.
Wine and Beer are produced without distillation.
Whisky, Brandy and Rum are produced by distillation.

9. Differentiate primary and secondary sludge in Sewage treatment process.

Differentiate primary and secondary sludge in Sewage treatment process.
Primary sludge Secondary sludge
i) Sludge formed during primary sewage i) Sludge formed during second sewage
treatment treatment.
All solids that settle form primary ii) Flocs that settle form secondary sludge in
ii)
sludge in primary settling tank. settling tank.
iii) It contains soil and small pebbles iii) It contains aerobic bacteria and fungi.

10. What is a biocontrol agent? Give two examples.

Organisms which are used to control plant diseases and pests are defined biocontrol agents
Ex : Lady bird- controls aphids; Dragonflies – controls mosquitoes

Hreen Qark, Okl Q & A [VOLUME - II]

 3

11. Explain why Saccharomyces cerevisae, is called as Baker’s yeast and Brewer’s yeast.
The dough which is used for making bread is fermented and releases CO2 by presence of Saccharomyces
cerevisiae, so it is refered to as Baker’s yeast. The same microbe is also used for fermenting malted
cereals and fruit juices, to produce ethanol, so it is referred as Brewer’s yeast.

12. Biogas production is best in rural areas than in urban. Explain why?
Biogas is produced from excreta of cattle, commonly called Gobar. Cattle dung is available in large
quantities in rural areas. Where cattle are used for a variety of purposes. So Biogas plants are often built
in rural areas.

13. How are these enzymes useful for man kind? i) Proteases and Pectinases ii) Lipases
i) These are used for longer storage and clearing of bottled fruit Juices which are brought from the
market. It also used in fruit Juice industries for processing of fruits to improve the quality of Juice.
ii) Lipases are used in detergent formulations and are helpful in removing oily stains from clothes.

14. a) How does Streptokinase useful as bioactive molecule?

b) What is a Probiotic?
a) It derives from Streptococcus bacterium and used as a clotbuster for removing of clots from
blood vessels of patients, who suffered with myocardial infarction leading to heart attack.
b) Probiotics are live microorganisms, they provide health benefits when consumed. The use of friendly
bacteria for therapeutic purposes and for the betterment of human health has led to the concept of
probiotics.

15. During the production of curd, a small amount of curd is added as a starter to the fresh milk at a
suitable temperature. Explain the changes the milk undergoes when it sets into curd.
For the production of curd, a small amount of curd is added to fresh milk at suitable temperature. A little
amount of curd contains millions of lactic acid bacteria (LAB). These bacteria grow in milk and convert
the lactose sugar of milk into lactic acid. Lactic acid coagulates and partially digests milk protein
(casein.) This causes curdling of milk and it changes to curd, which also improves its nutritional quality
by increasing vitamin B12 content.

16. Name the metabolic pathway associated with the rising of dough in making bread. What makes
the dough rise?
When Saccharomyces cerevisiae (Baker’s yeast) is added to dough it causes its fermentation and
releases CO2 gas which is responsible for puffed up appearance of dough.

Hreen Qark, Okl Q & A [VOLUME - II]

 4

17. Why are some molecules called bioactive molecules? Give two examples of such molecules.
Bioactive compounds are those compounds that are produced by certain organism and have an effect on
other living organisms, tissues or cells, usually demonstrated by basic research in vitro (or) in vivo in the
laboratory. Bioactive compounds are found in both plant and animal products or can be synthetically
produced. Two examples of bioactive compounds are Cyclosporin A and Statins.

18. Explain the process of secondary treatment given to the primary effluent, upto the point it shows
significant change in the level of biological oxygen demand (BOD) in it:
During secondary treatment, the primary effluent is taken to aeration tanks. A large number of aerobic
heterotrophic microbes grow in the aeration tank. They form flocs which are masses of bacteria held
together by slime and fungal filaments to form mesh like structures. The microbes digest a lot of organic
matter, converting it into microbial biomass and releasing a lot of minerals. As a result the BOD of the
waste matter is reduced and it is passed into settling tank.

19. How do methanogens help in producing biogas?

Methanogenic bacteria or methanogens are the group of anaerobic microbes which digest organic matter
in the cattle dung as well as aerobic microbes of the sludge in the anaerobic sludge digester to produce a
mixture of gases containing methane, H2 / H2S and CO2 called biogas.

20. a) Write any two places where methanogens can be found.

b) State one reason for adding blue – green algae to the agricultural soil.
a) Methanogens are commonly found in the anaerobic sludge during sewage treatment and in the
rumen (a part of stomach) of cattle.
b) A number of free living and symbiotic blue green algae or cyanobacteria have the property of
nitrogen fixation and are photosynthetic. Therefore, they add organic matter as well as extra
nitrogen to the soil. Hence, blue green algae serve as biofertilisers and are added to agricultural
fields such as Maize, Jowar, Rice, etc.

21. a) Cattle excreta is important source for producing a domestic fuel. Name the fuel and write the
main components.
b) Write the biological process that is responsible for the production of this fuel.
a) The production of domestic fuel from cattle excreta is bio-gas. The main components of bio-gas
is CH4, CO2 and H2S.
b) For the production of bio-gas certain bacteria i.e methanogens which grow anaerobically on
cellulosic material and produce large amount of methane along with CO2 and H2.

Hreen Qark, Okl Q & A [VOLUME - II]

 5

3 MARK QUESTIONS
1. Explain the following : a) Roqueforti cheese b) Toddy c) Fermented dough
a) Roqueforti cheese: → It is ripened by growing specific fungi on it named Pencillium roqueforti It
gives particular flavour to this cheese.
b) Toddy: → It is a traditional drink of some parts of southern India. It is made by fermenting sap from
palm trees.
c) Fermented dough:→ Dough which is used for making foods such as dosa and idli is fermented by
bacteria. The puffed – up appearance of dough is due to the production of CO2 gas.

2. If BOD levels of 3 water samples are A = 400mg/l, B = 200mg/l C = 50mg/l. Which one is having
high organic matter and which has less organic matter and why?
Sample ‘A’ contain higher organic matter and sample ‘C’ contain less organic matter. Because BOD
refers to the amount of the oxygen that would be consumed if all the organic matter in one liter of water
were oxidised by bacteria. So, BOD is a measure of the organic matter present in the water. Due to
presence of higher amount of organic matter in sample ‘A’, it has higher BOD value.

3. How do biopesticide control pests? Explain with an example Bacillus thuringiensis?

Biopesticides are the organisms that are applied over the crop plants to destroy the pests. Biopesticide is
a biological method of controlling pests. A microbial biopesticide agent that can be introduced in order
to control butterfly caterpillars is the bacteria Bacillus thuringiensis. These are available in sachets as
dried spores which are mixed with water and sprayed onto vulnerable plants. When these are eaten by
the insect larvae, in the gut of the larvae this inactive toxin becomes active toxin and damages the gut of
the insect and kills it.

4. Antibiotic was discovered by chance. Explain how it was discovered by Fleming?

Alexander Fleming while working on Staphylococci bacteria, once observed a mould growing in one of
his unwashed culture plates around which Staphylococci could not grow. He found out that, it was due
to a chemical produced by the mould and he named it Penicillin and the mould is Pencillium notatum.

5. Identify a, b, c, d, e and f in the table given below.

Scientific name of the organism Product Use in human welfare

Streptokinase that was

Streptococcus a
later modified
b Cyclosporin A c
Monascus purpureus d e
Lactobacllius f Sets milk into curd

Hreen Qark, Okl Q & A [VOLUME - II]

 6
a) Helps in clearing blood clots inside the blood vessels
b) Trichoderma polysporum
c) Immunosuppressive agent - prevents rejection reactions in organ transplantation (and also
Antifungal, anti- inflammatory)
d) Statins
e) Help in lowering blood cholesterol level
f) Lactic acid

6. Given below is a list of six microorganisms. State their usefulness to humans.

a) Nucleopolyhedrovirus
b) Saccharomyces cerevisiae
c) Monascus purpureus
d) Trichoderma polysporum
e) Penicillium notatum
f) Propionibacterium sharmanii
a) Nuclepolyhedrovirus : It is a baculovirus which is an effective biocontrol agent as it is useful in
controlling many insects and other arthropods. It serves as species specific narrow spectrum
bioinsecticide.
b) Saccharomyces cerevisiae: It is used to ferment dough, in order to make bread. It is also used for the
preparation of ethanol.
c) Monascus purpureus : Its fermentation activity produces statins which inhibits cholesterol synthesis
and is therefore used in lowering blood cholesterol.
d) Trichoderma polysporum : It is a fungus that produces cyclosporin – A, which is used as
immunosuppressive agent in organ transplantation.
e) Pencillium notatum : It secretes the antibiotic, penicillin.
f) Propionibacterium sharmanii: It is used in processing of ‘Swiss Cheese.’ The large holes in Swiss
Cheese are due to production of a large amount of CO2 by this bacterium.

7. How does the activity of each one of the following help in organic farming?
a) Mycorrhiza
b) Cyanobacteria
c) Rhizobium
a) Mycorrhiza is a mutually beneficial or symbiotic association of a fungus with the root of a higher
plant. The most common fungal partners of Mycorrhiza are Glomus species. Mycorrhizal roots show
a sparse or dense wooly growth of fungal hyphae on their surface.

Hreen Qark, Okl Q & A [VOLUME - II]

 7
They perform several functions for the plant (i) Absorption of water, (ii) Solubilisation of organic
nutrients, absorption and their transfer to root. (iii) Direct absorption of minerals from the soil over a
large area and handing over the same to the root. (iv) The fungus secretes anti-microbial substances
which protect the young roots from attack of pathogens.
b) A number of free living and symbiotic blue green algae or cyanobacteria have the property of
nitrogen fixation and are photosynthetic. Therefore, they add organic matter as well as extra nitrogen
to the soil. Hence, blue green algae serve as biofertilisers and are added to agricultural fields such as
cotton, maize, jowar, rice, etc.
c) Rhizobium is a soil bacterium which either lives freely in soil or lives in symbiotic association with
roots of leguminous plants. The bacterium forms nodules in roots of leguminous plants where it lie
in groups. When it occurs freely in soil, it cannot fix nitrogen. Nitrogen fixing ability develops only
when it is present inside root nodules. Hence, Rhizobium is categorized as symbiotic bacterium. It
acts as a biofertiliser as it helps plants in obtaining their nitrogen nutrition.

8. a) Give two examples to prove that microbes release gases during metabolism. (2 Marks)
b) Name some traditional Indians foods made of wheat, rice and Bengal gram or their products
which involves use of microbes. (1 Mark)
a) Puffed appearance of dough which is used for making dosa, idli and bread is due to gas production.
Methanogens in the biogas plant produce methane and CO2
Large holes in the ‘Swiss cheese’ are due to the production of large amount of CO2 during its
production.
b) Dosa and idli (from rice), bread (from wheat) and dhokla (from Bengal gram) are the traditional
Indian food which involve use of microbes.

9. a) If you have to carry a sample from your home to your biology laboratory to demonstrate the
presence of microbes under a microscope, which sample would you carry and why? (1 Mark)
b) In which way have microbes played a major role in controlling diseases caused by harmful
bacteria? (1 Mark)
c) Name any two species of fungus, which are used in the production of the antibiotics. (1 Mark)
a) The most common household product that we would like to carry is curd which contains lactic acid
bacteria (Lactobacillus sps)
b) The major role of microbes in controlling the diseases is the ‘antibiotic production.’ Antibiotics have
been used against pathogenic bacteria.
Eg: Penicillin from Penicillium notatum
Streptomycin from Streptomyces griseus

Hreen Qark, Okl Q & A [VOLUME - II]

 8
c) Penicillium notatum - Penicillin
Penicillium griseofulvum - Penicillin, Griseofulvin
Cephalosporium acremonium - Cephalosporin
Aspergillus fumigatus - Fumagillin

10. a) Give an example of viral bio control agent.

b) Why are they considered to be desirable when an ecologically sensitive area is being treated.
a) Baculoviruses are pathogens that attack insects and other arthropods. The majority of baculoviruses
used as biological control agents.
b) The baculoviruses are excellent for species-specific, narrow spectrum insecticidal applications.
They do not show any negative impacts, on plants mammals, birds, fish or even on non-target
insects. This is especially desirable when beneficial insects are being conserved to aid when an
ecologically sensitive area is being treated.

4 MARK QUESTIONS
1. Carefully observe the image given below that illustrates secondary treatment of sewage water and
answer the questions.

a) Name the A and B labels in the image. (1M)

b) Why is air pumped through A? When is the effluent passed from A to B? (1M)
c) What is activated sludge and how is the surplus sludge further treated? (2M)
(or)
c) How this activated sludge is different from primary sludge? (2M)
Answer :
a) A is aeration tank and B is settling tank.
b) Aeration allows vigorous growth of useful aerobic microbes into flocs (masses of bacteria associated
with fungal filaments to form mesh like structures). Once the BOD of sewage water is reduced
significantly, the effluent is passed into a settling tank.

Hreen Qark, Okl Q & A [VOLUME - II]

 9
c) In a settling tank the bacterial ‘flocs’ are allowed to sediment. This sediment is called activated
sludge. Surplus sludge is pumped into large tanks called anaerobic sludge digesters for anaerobic
digestion of flocs.
(or)
Primary sludge Secondary sludge
i) Sludge formed during primary sewage i) Sludge formed during secondary sewage
treatment treatment.
ii) All solids that settle form primary ii) Flocs that settle form secondary sludge
sludge in settling tank.
iii) It contains soil and small pebbles iii) It contains aerobic bacteria and fungi.

2. The diagram given below represents a typical biogas plant.

a) What is the chemical nature of biogas? Name an organism which is involved in biogas
production? (2M)
b) What would happen if our intestine harbours microbial flora exactly similar to that found in
the rumen of the cattle? (1M)
c) Why are biogas plants mainly located in the rural areas? (1M)
(or)
c) How the biogas and spent slurry are useful? (1M)
Answer :
a) Biogas is a mixture of gases that predominantly contains methane (CH4) along with carbodioxide
(CO2 ) and Hydrogen (H2 ).
Methanobacterium is a type of methanogen, involved in biogas production.

Hreen Qark, Okl Q & A [VOLUME - II]

 10
b) Methanogens present in the rumen of the cattle help in the breakdown of cellulose and play an
important role in the nutrition of the cattle.
If similar microbes present in humans then humans will also be capable of digesting cellulose.
c) Because the cattle dung is available in plenty in the rural areas.
(or)
c) The spent slurry removed is used as fertilizer and the biogas product is used for cooking and
lighting.

3. Read the following and answer the questions given below:

Disposal of untreated sewage into the freshwater causes huge water pollution. Four water samples
from different sources (A, B, C, D) are collected and tested for BOD value in a lab to assess their
quality. The BOD values are presented in the given table. Water samples are collected from
primary effluent, secondary effluent, untreated sewage and fresh river water. Study the given
table and answer the following.
Sample BOD
A 20 mg/ L
B 5 mg/L
C 300 mg/ L
D 400 mg/ L
i) The source of sample ‘C’ is (1M)
a) river water b) primary effluent
c) secondary effluent d) untreated sewage water
ii) If sewage in untreated condition is disposed off in a fresh water body then (1M)
a) BOD and dissolved oxygen both will increase
b) BOD will increase and dissolved oxygen will decrease
c) BOD will decrease and dissolved oxygen will increase
d) BOD and dissolved oxygen both will increase
iii) A large number of pathogenic microbes can be present in water sample of (1M)
a) C b) A c) D d) both (a) and (c)
iv) High value of BOD in sample D is due to (1M)
a) high amount of organic wastes and aerobic microbes
b) high amount of inorganic wastes and anaerobic microbes
c) high amount of organic wastes and anaerobic microbes
d) high amount of inorganic wastes and aerobic microbes
(or)
Hreen Qark, Okl Q & A [VOLUME - II]
 11

v) River water is represented by the sample (1M)

a) A b) B c) c d) D
Answers:
i) b) primary effluent
A–secondary effluent, B – River water, C – Primary effluent, D – Untreated sewage water
ii) b) BOD will increase and dissolved oxygen will decrease
iii) d) both (a) and (c)
iv) a) high amount of organic wastes and aerobic microbes
v) b) B

4. Read the following and answer the questions given below:

Green manuring is the farming practice where a leguminous plant which has derived enough
benefits from its association with appropriate species of Rhizobium, is ploughed into the field soil
and then a non-legume is sown and allowed to get benefited from the already present nitrogen
fixer. Some legumes, such as, Crotolaria juncea, Sesbania rostrata, clover beans etc, are used as
green manure. Rhizobia, that fix atmospheric nitrogen in the form of Ammonia, live in the roots
in the leguminous plants. These nutrients are used by non-leguminous plants through the practice
of green manuring.
i) Green manures mainly provide nutrients enriched in (1M)
a) Magnesium b) Sulphur c) Nitrogen d) Both (a) and (b)
ii) Which of the following plants is used as green manure in crop fields? (1M)
a) Saccharum b) Dichanthium c) Phyllanthus d) Crotolaria
iii) Green manure plants belong to the Family (1M)
a) Lamiaceae b) Papilionaceae c) Liliaceae d) Poaceae
iv) Due to excess use of chemical fertilizers rich in nitrate, ______________ disease (1M)
occurred in children.
a) Jaundice b) Septicemia c) Methemoglobinemia d) Botulism
(or)
v) A green manure is (1M)
a) Rice b) Maize c) Sorghum d) Sesbania
Answers:
i) c) Nitrogen
ii) d) Crotolaria
Some legumes such as Crotolaria juncea, Sesbania rostrate. Lencaena leucocephala, etc. are
used as green manure.
iii) b) Papilionaceae

Hreen Qark, Okl Q & A [VOLUME - II]

 12
iv) c) Methemoglobinemia
Drinking water with high nitrate can cause a potentially fatal disorder called
methemoglobinemia.
v) d) Sesbania

5 MARK QUESTIONS:
1. Explain sewage treatment plant.
Sewage is treated in sewage treatment plants to make it less polluting. Treatment of waste water is
carried out in two stages:
i) Primary treatment:
The treatment involves physical removal of particles – large and small from the sewage through
filtration and sedimentation. Floating debris is removed by sequential filtration and grit is removed
by sedimentation. All solids that settle form the primary sludge, and the supernatant forms the
effluent.
ii) Secondary treatment :
Primary effluent is passed into large aeration tanks where it is constantly agitated and air is pumped
into it. This allows vigorous growth of useful microbes into flocs (Mass of bacteria associated with
fungal filaments to form mesh like structure). During growth microbes consume organic matter
present in the effluent. This significantly reduces the BOD of the effluent. BOD is a measure of the
organic matter present in the waste water. Once the BOD of sewage is reduced significantly, the
effluent is then passed into a settling tank where the bacterial ‘flocs’ are allowed to sediment. This
sediment is called activated sludge. Major part of the sludge is pumped into large tanks called
anaerobic sludge digesters. In this anaerobic bacteria digesting the flocs and releases mixture of
gases such as methane, hydrogen sulfide and carbon dioxide. These gases form biogas. The effluent
from the secondary treatment plant is generally released into natural water bodies like rivers and
streams.

2. Describe Biogas production and the microbes involved.

Biogas is a mixture of gases produced by microbial activity. Methanogens grow anaerobically on
cellulosic material produce large amount of methane along with CO2 and H2. These bacteria are also
present in the rumen of cattle. In rumen, these bacteria help in the breakdown of cellulose. The excreta
of cattle commonly called gobar, is rich with Methanogens. Dung can be used for generation of biogas.
The biogas plant consists of a concrete tank (14- 15 feet deep) in which biowastes are collected and a
slurry of dung is fed. A floating cover is placed over the slurry, which keeps on rising as the gas is
produced in the tank due to the microbial activity. The spent slurry is dried and used as fertitiser.

Hreen Qark, Okl Q & A [VOLUME - II]

 13

3. What are biofertilisers? Describe their role in agriculture. Why are they preferred to chemical
fertilizers?
Biofertilisers are microorganisms which bring about nutrient enrichment of soil by enhancing the
availability of nutrients like nitrogen (N) and phosphorus (P) to crops. Biofertilisers includes- nitrogen
fixing bacteria, nitrogen fixing cyanobacteria and mycorrhiza. Azotobacter occurring in fields of cotton,
maize, jowar and rice, not only increases yield but also saves nitrogen fertilizer upto 10 – 25 kg / ha.
A number of free living cyanobacteria or blue – green algae have the property of nitrogen fixation, e.g.,
Anabaena, Nostoc, Oscillatoria, Aulosira, Tolypothrix, Cylindrospermum, Stigonema, Cyanobacteria are
extremely low cost biofertilisers.
The most important of the symbiotic nitrogen fixing bacteria is Rhizobium. It forms nodules on the roots
of legume plants. There are about a dozen species of Rhizobium which form association with different
legume roots, e.g., R. leguminosarum, R. lupine, R. trifolii, R. meliloti, R. phaseoli.
Nitrogen fixing cyanobacteria (blue – green algae) form symbiotic association with several plants, e.g.,
cycad roots, lichens, liverworts, Azolla (fern). Azolla – Anabaena association is of great importance to
agriculture. Azolla pinnata in a free floating fresh water fern which multiplies rapidly, doubling every
5 – 7 days. The fern can co-exist with rice plants because it does not interfere with their growth. In some
South – East Asian countries, especially China, the rice fields are regularly provided with Azolla.

4. a) Find out the role of microbes in the following and discuss with your teacher:
i) Single Cell Protein (SCP) ii) Soil
i) Single Cell Protein (SCP): It is a protein – rich microbial biomass which can be used as food.
SCP contains essential amino acids and low fat. Bacteria, BGA, filamentous fungi, algae, yeast
etc., are used SCPs. Spirulina is taken as a tablet having 60 percent proteins, all minerals,
vitamins etc.

Hreen Qark, Okl Q & A [VOLUME - II]

 14
ii) Soil : Soil is the habitat of numerous microbes in the soil increase the fertility of soil by
decomposing organic matters some microbes convert nitrates into free nitrogen that escapes into
atmosphere for replenishment.
b) Arrange the following in the decreasing order (most important first) of their importance, for
the welfare of human society. Give reasons for your answer.
Biogas, citric acid, penicillin and curd.
Penicillin : It is an antibiotic used in curing numerous bacterial diseases.
Biogas : It is a source of energy in rural areas, produced by anaerobic degradation of organic
matter.
Curd: It is Vitamin – rich milk preparation which is easily digested.
Citric acid : It is an organic acid used as preservative in juice, jams and jellies etc.,

5. a) Name any two autotrophic microbes and state how they serve as biofertilisers.
Two autotrophic microbes that serve as biofertilisers are:
i) Anabaena is used as biofertilizer in paddy fields. Anabaena azollae a cyanobacterium that resides in
the leaf cavities of fern as a symbionts and helps in nitrogen fixation to form ammonia, which is
excreted from the cavities and becomes available to the fern. The decaying fern plant releases the
same for the utilization of crop plants like rice. When the field is dried at the time of harvesting, the
fern functions as the green manure decomposing and enriching the field for the next crop.
ii) The Nostoc acts as free living (or) symbiotic nitrogen fixer, which are photosynthetic and they add
organic matter as well as nitrogen to the soil and so used as bioferlizer.
(Free living nitrogen fixing cyanobacterium like Cylindrospermum licheniforme grow in sugarcane
and maize fields.)
b) What are the different microbes involved in House hold products.
i) Lactic acid Bacteria : → It produces lactic acid and helps in conversion of milk into curd. It also
improves nutritional quality of curd by increasing Vitamin B12
ii) Saccharomyces cerevisiae: → It is used for making bread and Fermented beverages. So, it is
referred as Baker’s yeast and Brewer’s yeast.
iii) Propionibacterium sharmanii:→ It is used in production of Swiss cheese (presence of large holes
is characteristic feature)
iv) Pencillium roqueforti : → It is used in production of Roquefort cheese.

6. a) Organic farmers prefer biological control of diseases and pests to the use of chemicals for the
same purpose. Justify.
b) Give an example of a bacterium, a fungus, virus and an insect that are used as biocontrol
agents.

Hreen Qark, Okl Q & A [VOLUME - II]

 15
a) Chemical pesticides used in agricultural fields are toxic and they kill even useful organisms along
with harmful ones, harm human beings and animals, pollute soil, water and crop plants. Now,
organic farmers prefer biological control of diseases and pests to the use of chemicals. Biopesticides
are the biological agents that control the growth of weeds, insects and pathogens in an agricultural
field. They have targeted actions and are harmless to the crop plants, other beneficial field animals
and humans. In organic farming, pests and pathogens are not eradicated but kept at manageable
levels by a system of checks and balances as operating in ecosystem. An organic farmer holds the
view that eradicating pests is undesirable because without them the beneficial predatory and parasitic
organisms which depend upon them for food would also be annihilated.
b) Bacterium as a biocontrol agent : Bacillus thuringiensis is effective against the butterfly catterpillars.
Fungi as a biocontrol agent : Trichoderma found in root ecosystem exerts biocontrol over several
plant pathogen.
Virus as biocontrol agent; Baculovirus, these are excellent candidates for species specific, narrow
spectrum insecticidal applications.
Insect as a biocontrol agent: Lady bird beetle and dragonflies feeds on aphids and prey upon
mosquitoes, respectively.

7. a) What are viruses parasitising bacteria called? Draw a well labelled diagram of the same. (2 M)
b) Name the scientists who were awarded with nobel prize for the discovery of pencillin? (1 M)
c) What would happen if a large volume of untreated sewage is discharged into a river? (2 M)
Answer:
a) A virus which attacks bacteria is called bacteriophage. The virus enters a bacterial cell and controls
the genetic material of bacteria in order to produce more viruses.
b) Alexander Fleming, Ernst chain and Howard Florey.
c) Following are the harmful effects of untreated sewage being
discharged into a river.
It will contaminate water and making it unfit for drinking as it
contain many pathogenic organisms.
It will alter the pH level of water which can be detrimental to
aquatic plants and animals.
This will also pollute ground water
Fish from contaminated water will be become unfit for human
consumption.

Hreen Qark, Okl Q & A [VOLUME - II]

 16

8. a) Draw a diagrammatic sketch of biogas plant, and label its various components given below:
(3 Marks)
Gas Holder, Sludge chamber, Digester, Dung + water chamber
b) Expand KVIC and IARI (1 Mark)
c) Give an example of rod shaped plant virus and an animal virus that causes respiratory
infection. (1 Mark)
Answer:

a)

b) KVIC : Khadi and Village Industries commission.

IARI : Indian Agricultural Research Institute
c) Tobacco Mosaic Virus (TMV) is a rod shaped plant virus and Adenovirus is an animal virus which
causes respiratory infections.

9. Villagers in a place near Chambur started planning to make power supply for agricultural
purposes from cow dung. They have started a biogas plant for the purpose. Study the flow chart
for biogas production given below and answer the following questions.

a) What is the composition of biogas? (1M)

b) What A and B denotes in the given flow chart? (2M)
c) What happened if ‘A’ is not added in the procedure? (1M)
d) What kind of process is represented by ‘C’ in the given flow chart? (1M)

Hreen Qark, Okl Q & A [VOLUME - II]

 17

Answer:
a) Methane, carbon dioxide and hydrogen.
b) In the second stage of biogas production the simple soluble compounds (or) monomers are acted
upon by fermentation causing microbes and converted into organic acids, especially acetic acid.
So ‘B’- is organic acids, These acids are processed by methanogenic bacteria to produce
methane. So ‘A’ - is Methanogenic bacteria.
c) Methane will not be formed.
d) Hydrolysis / Solubilization of complex ones into simple ones / Anaerobic digestion of complex
organic compounds.

10. The release of municipal waste water and industrial waste into our natural water bodies is causing
disastrous effect to the aquatic life. Explain the biological treatment that should be given to it
before releasing into the natural water bodies.
The biological treatment of waste water is also called secondary treatment of sewage water.
During 2o treatment, the primary effluent is passed into large aeration tanks where it is constantly
agitated mechanically and air is pumped into it.
This allows growth of useful aerobic microbes in flocs (its masses of Bacteria and fungi) while
these microbes growing they consume the major part of the organic matter in the effluent this
significantly reduces the BOD of the effluent.
The BOD test measures the rate of uptake of O2 by micro organisms in sample of water
indirectly. BOD is used to measure of the organic matter present in the water.
The greater BOD of waste water, more is its polluting potential.
Once the BOD of sewage / waste water is reduced the effluent is then passed into a settling tank
where the flocs are allowed to sediment. This sediment is called activated sludge.
From the settling tank effluent released into natural water bodies like rivers and streams and in
the activated sludge, a small portion used as Inoculum, remaining activated sludge used for the
production of bio-gas.

Hreen Qark, Okl Q & A [VOLUME - II]

 18

BIOTECHNOLOGY PRINCIPLES AND PROCESSES

2 MARK QUESTIONS:
1. Explain palindromic nucleotide sequence with the help of a suitable example.
The palindrome sequence in DNA is a sequence of base pairs that reads same on the two strands when
orientation of reading is kept the same. Eg: The following sequence reads the same on the two strands
in 5′ → 3′ direction. This is also true if read in 3′ → 5′ direction.

2. a) How is an exonuclease functionally different from an endonuclease?

b) Give two examples for endonucleases?
a) Exonucleases remove nucleotides from the ends of the DNA where as endonucleases make cuts at
specific position with in the DNA.
b) EcoRI, BamHI, SalI, PstI, PvuI (any two)

3. Mention the type of host cells suitable for the gene gun method to introduce alien DNA. What type
of microparticles are used in this technique.
Plant cells are the most suitable host cells for the gene gun method.
In this technique plant cells are bombarded with high velocity microparticles of gold or tungsten
coated with DNA.

4. How does EcoRI specifically act on DNA molecule, Explain?

EcoRI is a restriction endonuclease enzyme which recognizes specific palindromic DNA sequence i.e.,
GAATTC and cut the DNA strand a little away from the centre of the Palindrome, but between the same
two bases on the opposite strands and form sticky ends.

The product obtained is as follows:

Hreen Qark, Okl Q & A [VOLUME - II]

 19

5. a) Why is it essential to have a selectable marker in a cloning vector?

b) Name the selectable markers in the cloning vector PBR322.
a) Selectable markers help in identifying and eliminating non transformants and selectively permitting
the growth of the transformants. Hence, they are considered as essential property in a cloning vector.
b) pBR322 has two antibiotic resistance coding genes that acts as selectable markers.
They are : Ampicillin resistance coding gene (ampR)
Tetracycline resistance gene (TetR)

6. a) Who constructed first recombinant DNA?

b) What is the source of native plasmid and the host used during cloning of first recombinant
DNA?
a) Stanley Cohen and Herbert Boyer constructed first recombinant DNA in 1972.
b) The native plasmid used in this was extracted from salmonella typhimurium and it is ligated with
foreign DNA coding for antibiotic resistance, there by constructed recombinant DNA (r-DNA). This
r-DNA was cloned in E.coli.

7. What are the two core techniques that enabled birth of modern biotechnology?
The two core techniques of modern biotechnology are:
1) Genetic engineering: Techniques to alter the chemistry of genetic material (DNA / RNA), to
introduce these into host and thus change the phenotype of the host organism.
2) Bioprocess engineering: Maintenance of sterile ambience to enable growth of only the desired
microbe/eukaryotic cell in large quantities for the manufacture of biotechnological products like
antibiotics, vaccines, enzymes etc.,

8. a) Name the material used as matrix in gel electrophoresis and mention its role?
b) Which chemical is used to make DNA visible during gel electrophoresis?
a) Most commonly used matrix in DNA gel electrophoresis is agarose. It provides sieving effect for
separation of DNA fragments according to their size.
b) The separated DNA fragments are visible as bright orange colour bands only after staining with
ethidium bromide and exposure to UV light.

9. Explain the role of Ti plasmid in biotechnology.

Ti plasmid of Agrobacterium tumefaciens can deliver a piece of DNA known as ‘T-DNA’ to
transform normal plant cells into a tumor and direct these cells to produce chemicals required by the
pathogen.
So, this Ti plasmid has now been modified into a cloning vector which is no more pathogenic to the
plants but is still able to use the mechanisms to deliver genes of our intrest into variety of plants.
Hreen Qark, Okl Q & A [VOLUME - II]
 20

10. Name two commonly used bioreactors state the importance of using a bioreactor.
The two commonly used bioreactors are;
i) Simple – stirred tank bioreactor
ii) Sparged stirred tank bioreactor
Bioreactors which can support large volumes (100-1000 litres) of culture are developed for large scale
production of desired products.

11. What is the significance of adding proteases at the time of isolation of genetic material (DNA).
i) Proteases are those enzymes which bring about the breakdown of proteins into peptides or amino
acids by hydrolysis. Therefore, these enzymes are added at the time of isolation of genetic material
(DNA), they break down the proteins present inside a cell (from which DNA is being isolated).
ii) If the proteins are not removed from DNA preparation then they could interfere with any
downstream treatment of DNA.

12. a) Name a recombinant vaccine that is currently being used in vaccination programme.
b) Suggest a technique to a researcher who needs to separate fragments of DNA.
a) Hepatitis-B recombinant vaccine is used for vaccination against hepatitis virus.
b) Gel electrophoresis: It is a laboratory method used to separate mixtures of DNA, RNA, or proteins
according to molecular size.

13. What would be the molar concentration of human DNA in a human cell? Consult your teacher.
The molar concentration of human DNA in a human diploid cell is as follows:
⇒ Total number of chromosomes x 6.023 x 1023 Avogadro constant
⇒ 46 x 6.023 x 1023 6.023 x 1023
Hence, the molar concentration of DNA in each diploid cell in humans is 2.77 x 1023 moles.

14. a) State the role of DNA ligase in biotechnology.

b) Why is ‘plasmid’ an important tool in biotechnology experiments?
a) DNA ligases join two individual fragments of double stranded DNA by the formation of
phosphodiester bond between them.
b) Plasmid have the ability to replicate within bacterial cells independent of the control of chromosomal
DNA and have high copying number, therefore any alien DNA ligated to it, also multiplies to equal
the copy number of plansmids. So, it is used as a vector in gene cloning experiments and an
important tool in biotechnology.

Hreen Qark, Okl Q & A [VOLUME - II]

 21

15. List any two key tools used in recombinant DNA technology.
i) Enzymes: Different kinds of specific enzymes used in recombinant DNA technology are lysing
enzymes (used to open up the cells to get DNA), it includes lysozyme, cellulase and chitinase and
cleaving enzymes (enzymes used to break DNA molecules) it includes exonuclease, endonuclease and
restriction endouclease and enzymes like ligases (for joining of DNA fragments) and polymerases
etc.,
ii) Cloning vectors: These are DNA molecules that can carry foreign DNA segment and replicate
inside a host cell. It may be plasmid, a bacteriophage, cosmid, Yeast Artifical Chromosomes
(YACs), Bacterial Artifical Chromosomes (BACs) and viruses.

16. Describe briefly about competent host.

Competent host : A competent host is essential for transformation with recombinant DNA. It includes
DNA mediated or vector mediated gene transfer and direct or vectorless gene transfer (microinjection,
electroporation, chemical mediated gene transfer, biolistic method or gene gun method).

17. List out the RENs to cut AmpR gene and TetR gene in PBR322.
AmpR – Pvu – I Pst - I are used to cut AmpR
TetR – BamH – I Sal – I are used to cut TetR

18. Expand the following terms.

i) EcoRI ii) rop iii) ori iv) PBR 322
i) ECORI :
E : Escherichia
Co : Coli
R : Ry13 (strain)
I : The first enzyme isolated from the bacteria (order of isolation)
ii) Rop : repressor of primer: It codes for protein which is involved in replication of plasmid.
iii) Ori : Site of origin of replication
iv) PBR322 :
P – plasmid
B – Bolivar
R – Rodriguez
322 – Order of synthesis

19. Write Nick – names of the following terms in biotechnology.

i) Gene Taxi ii) Molecular scissor iii) Natural genetic engineer
iv) Passenger DNA v) Molecular glue vi) Mobile genetic element
Hreen Qark, Okl Q & A [VOLUME - II]
 22
i) Gene Taxi → Plasmid
ii) Molecular scissor → Restriction endonuclease
iii) Natural genetic engineer → Agrobacterium tumefaciens.
iv) Passenger DNA → Foreign DNA
v) Molecular glue → Ligases
vi) Mobile genetic element → Transposon

20. Why are molecular scissors so called? Write their use in biotechnology.
a) The restriction endonucleases are called molecular scissors, as they cut the DNA segments at
particular locations, e.g., EcoRI.
b) The restriction enzymes cut the DNA strands a little away from the centre of the palindromic sites,
but between the same two bases on the opposite strands. This leaves single stranded portions with
overhanging stretches called sticky ends on each strand as they form hydrogen bonds with their
complementary cut counterparts. This stickiness at the ends facilitates the action of the enzyme
DNA ligase.

21. Write the convention used for naming restriction enzymes. (or)
Explain with the help of a suitable example the naming of a restriction endonuclease.
The convention for naming restriction enzymes is that the first letter to the name comes from the Genus
and the second two letters come from species and third letter indicates the strain of the prokaryotic cell
from which they are isolated e.g., EcoRI comes from Escherichia coli RI, here R stands for the strain
and I follows the order in which the enzyme was isolated.

22. a) Explain how to find whether an E.coli bacterium has transformed or not when a recombinant
DNA bearing ampicillin resistant gene is transferred into it.
b) What does the ampicillin resistant gene act as in the above case?
a) E.coli bearing recombinant DNA are first grown on ampicillin containing medium and then
transferred on to a medium containing tetracycline. The transformants will grow only in ampicillin
containing medium and not in tetracycline containing medium. The non-transformants die.
b) Ampicillin resistant gene acts as a selectable marker and helps in selecting the transformants.

23. How is copy number of the plasmid vector related to yield of recombinant protein?
The recombinant DNA can multiply as many times as the copy number of the vector plasmid thereby
determining the field of recombinant protein.
So, higher the copy number of plasmid vector, higher the copy number of genes and consequently,
protein coded by the gene is produced in high amount.

Hreen Qark, Okl Q & A [VOLUME - II]

 23

24. What does H in 'd' and 'III' refer to in the enzyme Hind III?
i) The first letter 'H' indicates the genus of the organism from which the enzyme was isolated, H =
genus Haemophilus.
ii) The fourth letter 'd' specifies the particular strain which is used to produce the enzyme, d = strain Rd.

25. Restriction enzymes should not have more than one site of action in the cloning site of a vector,
Comment.
Restriction enzymes should not have more than one site of action in the cloning site of a vector
because if the restriction enzymes have more than one recognition site in a vector, then the vector
will get fragmented into pieces on treatment with the restriction enzymes.

26. What does ‘competent’ refer to in competent cells used in transformation experiments?
i) DNA being a hydrophilic molecule cannot pass through cell membranes. Therefore, the bacteria
should be made competent to accept the DNA molecules.
ii) Competent means bacterial cells, on treatment with chemicals like CaCl2 and heat shock are made
capable of taking up foreign DNA.

27. What is the significance of adding proteases at the time of isolation of genetic material (DNA)?
i) Proteases are those enzymes which bring about the breakdown of proteins into peptides or amino
acids by hydrolysis. Therefore, these enzymes are added at the time of isolation of genetic material
(DNA), they damage the proteins present inside a cell (from which DNA is being isolated).
ii) If the proteins are not removed from DNA preparation then they could interfere with any
downstream treatment of DNA.

28. What modification is done on the Ti plasmid of Agrobacterium tumefaciens to convert it into a
cloning vector?
i) The plasmid is disarmed by deleting the tumour-inducing genes in the plasmid, so that it
becomes an effective cloning vector.
ii) The modified tumour inducing (Ti) plasmid of Agrobacterium tumefaciens will no longer remain
pathogenic to the plants but still deliver genes of interest into a variety of plants.

29. A plasmid DNA and a linear DNA (both are of the same size) have one site for a restriction
endonuclease. When cut and separated on agarose gel electrophoresis, plasmid shows one DNA
band while linear DNA shows two fragments Explain.

Hreen Qark, Okl Q & A [VOLUME - II]

 24
i) When a plasmid DNA and a linear DNA having one site for a restriction endonuclease are cut and
separated, plasmid shows one DNA band, while linear DNA shows two bands because of different in
their basic structure.
ii) Plasmid is a circular DNA molecule and when cut with these enzymes, it becomes linear but
does not get fragmented due to the Presence of only one restriction site, where as a linear DNA
molecule gets cut into two fragments.

30. How can DNA segments, separated by gel electrophoresis, be visualised and isolated?
The separated DNA segments are stained with ethidium bromide.
On exposure to UV radiation, the separated and stained DNA segments become visible as orange
coloured bands.
The separated bands are cut from the agarose gel and then extracted from the gel piece, this process
in called as elution.

31. Explain the contribution of Thermus aquaticus in the amplification of gene of interest.
Thermus aquaticus (a bacteria) yields a thermostable enzyme DNA polymerase.
The enzyme can withstand the high temperature used for the denaturation and separation of DNA
strands during Polymerase Chain Reaction (PCR), and hence can be used for repeated amplification
of DNA.

32. How are bacterial cells made to act as competent host to take up DNA?
The bacterial cells are treated with a specific concentration of a divalent cation, such as calcium,
which increases the efficiency with which DNA enters the bacterium through pores in its cell wall.
The recombinant DNA can then be forced into such cells by incubating the cells with recombinant
DNA on ice, followed by placing them briefly at 42oC (heat shock) and then putting them back on
ice.
This enables the bacteria to take up the recombinant DNA.

33. What is continuous culture system? Why is this system useful for obtaining the foreign gene
product?
In a continuous culture system, the used medium is drained out from one side while fresh medium is
added from the other to maintain the cells in their physiologically most active log/exponential phase.
This type of culturing method produces a large biomass leading to higher yield of desired protein.

Hreen Qark, Okl Q & A [VOLUME - II]

 25

34. How is a foreign gene product is converted into a finished product for marketing?
The product is subjected through a series of processes called downstream processing that include
separation and purification of the product.
The product is formulated with suitable preservatives.
Such formulation has to undergo through clinical trials in case of drugs.
Strict quality control testing for each product is also carried out before the product is ready for
marketing.

35. Explain the convention for naming of restriction enzymes, giving an example.
The first letter of the name comes from the genus of the bacteria from which the enzyme is isolated.
The second two letters comes from the species, for example EcoRI comes from Escherichia coli Ry 13.
In EcoRI, the letter ‘R’ is derived from the name of strain of the bacteria.
Roman numbers following the names indicate the order in which the enzymes were isolated from
that strain of bacteria.

3 MARK QUESTIONS:
1. Why is the ‘insertional inactivation’ method used to detect recombinant DNA is preferred instead
of ‘antibiotic resistance’ procedure?
i) The presence of a chromogenic substrate gives blue coloured colonies, in absence of an insert, in
non-recombinants whereas presence of an insert (in the enzyme site), results into (insertional
inactivation of the β-galactosidase) colonies which do not produce colour. So single plating is
enough to select recombinants.
ii) Antibiotic resistance method requires duplicate plating, it is a cumbersome procedure to per form.

2. From what you have learnt, can you tell whether enzymes are bigger or DNA is bigger in
molecular size? How did you know?
i) Enzymes are smaller in size as compare to DNA molecules. This is because DNA contains genetic
information for the development and functioning of all living organisms. It contains instructions for
the synthesis of proteins and DNA molecules.
ii) On the other hand, enzymes are proteins which are synthesized from a small stretch of DNA known
as ‘genes’, which are involved in the production of the polypeptide chain.

3. Do eukaryotic cells have restriction endonucleases? Justify your answer.

i) No, eukaryotic cells do not have restriction endonucleases.
ii) Because,
Hreen Qark, Okl Q & A [VOLUME - II]
 26
a) DNA of eukaryotes is highly methylated by a modification enzyme, called methylase,
Methylation protects the DNA from the activity of restriction enzymes.
b) But these restriction enzymes are present in prokaryotes/bacteria as a defence mechanisms to
destroy the foreign DNA or to restrict the growth of bacteriophages.

4. Describe the roles of heat, primers and the bacterium Thermus aquaticus in the process of PCR.
i) Heat: It plays an important role in denaturation and separation of DNA into two strands.
ii) Primer: These are small Enzyme DNA polymerase extends the primers using the nucleotides
provided in the reaction and the genomic DNA as template, provide free 3′ OH for the activity of
Taq polymerase.
iii) Thermus aquaticus: It is a source of thermostable DNA polymerase / Taq polymerase that helps in
extension of New DNA.

5. Explain three basic steps to be followed during genetic modification of an organism.

Three basic steps to be followed during genetic modification of an organism are as follows:
i) Identification of DNA with desirable genes, so that the genetically modified organism has largely
desirable genes.
ii) Introduction of the DNA with desirable genes, into the host using vector.
iii) Maintenance of introduced DNA in the host, and transfer of the DNA to its progeny through cloning.

6. A plasmid DNA and a linear DNA (both are of the same size) have one site for a restriction
endonuclease. When cut and separated on agarose gel electrophoresis, plasmid shows one DNA
fragment while linear DNA shows two fragments. Explain.
i) When a plasmid DNA and a linear DNA having one site for a restriction endonulease are cut and
separated, plasmid shows one DNA band, while linear DNA shows two bands because of difference
in their basic structure.
ii) Plasmid is a circular DNA molecule and when cut with these enzymes, it becomes linear but does not
get fragmented due to presence of only one restriction site, whereas a linear DNA molecule gets cut
into two fragments.

7. Suggest and describe a technique to obtain multiple copies of a gene of interest in vitro.
i) With the help of polymerase chain reaction we obtain multiple copies of a gene of interest in vitro.
ii) a) Separation/denaturation of two strands of dsDNA.
b) Using two sets of primers/small chemically synthesized oligonucleotides complementary to
regions of DNA.
c) Extension of the primers, by using Taq polymerase enzyme. If the process of replication is
repeated many times multiple copies of DNA are produced.
Hreen Qark, Okl Q & A [VOLUME - II]
 27
The following diagram represents the steps in PCR :

8. a) Why must a cell be made ‘competent’ in biotechnology experiments? How does calcium ion
help in doing so?
b) What is ‘downstream processing’?
a) (1) To take up the (hydrophilic) DNA from the external medium.
(2) Divalent calcium ions increase the efficiency of DNA entering the cell through pores in the cell
walls.
b) The process that include separation and purification of desired gene product are collectively referred
to as downstream processing.

9. Explain the role(s) of the following in Biotehnology:

a) Restriction endonuclease
b) Gel-electrophoresis
c) Selectable markers in pBR322.
a) It cuts at specific position within the DNA/cuts DNA at specific nucleotide/cuts at palindromic
nucleotide sequence.
b) Separation of DNA fragements (under the influence of electric field).
c) It helps in identifying transformants by eliminating non-transformants and selectively permitting the
growth of transformants.

10. Besides better aeration and mixing properties, what other advantages do stirred tank bioreactors
have over shake flasks?
i) The shake flask method is used for a small scale production of biotechnological products in a
laboratory, whereas stirred tank biotechnology are used for a large-scale production of biotechnology
products.
Hreen Qark, Okl Q & A [VOLUME - II]
 28
ii) There are several advantages of stirred tank bioreactors over shake flasks. These are as follows:
a) Capacity of fermentor is more.
b) It has a foam breaker for regulating the foam.
c) Due to presence of baffles, oxygen transfer rate is very high.
d) It has a control system that regulates the temperature and pH.
e) Small volumes of culture can be taken out from the reactor for sampling or testing.

11. The image below depicts the result of gel electrophoresis:

If the ladder represents sequence length upto 3000 base pairs (bp),
a) Which of the bands (I-IV) correspond to 2500 bp and 100 bp respectively?
b) Explain the basis of this kind of separation and also mention the significance of this process.
a) Band III corresponds to 2500 base pairs, and Band IV corresponds to 100 bp.
b) The fragments will resolve according to their size. The shorter sequence fragments would move
farthest from well as seen in Band IV (100 bp) which is lighter as compared to Band III which is
heavier being 2500 base pairs.
The significance of electrophoresis is to separate the DNA fragments based on their size for further
use in constructing recombinant DNA by joining them with cloning vectors.

12. a) Identify and name the structures ‘A’ and ‘B’ marked in the image given below:

b) State their importance in various biotechnology experiments.

a) A : Circular DNA/Plasmid
B : Bacterlophage

Hreen Qark, Okl Q & A [VOLUME - II]

 29
b) Plasmid - Can carry foreign gene into the host cell/acts as cloning vector/has selectable
marker/independent of the control of chromosomal DNA/high copy number
Bacteriophage - Cloning vector have the ability to replicate in bacterial cells/independent of the
control of chromosomal DNA and they have high copy number per cell.

13. The image below shows the result of plating bacteria in chromogenic medium after incorporating
the gene of interest in plasmid. Some plates had blue colonies; some plates had white colonies. A
single bacterium extracted from Plate I, II, III is shown below:

On the basis of your observations:

a) Identify the plate(s) which is/are white. Give a reason.
b) Identify the plate(s) which is/are blue. Give a reason.
a) – Plate I will be white.
– Ligation of the gene of interest within the coding sequence of the enzyme β-galactosidase
caused insertional inactivation of the enzyme.
b) – Plate II will produce blue-coloured colonies.
– It is because the plasmid has no insert to cause inactivation of the enzymeand it reacts with
the chromo genic substrate that is responsible for the production of blue colour.

14. Do biomolecules (DNA, protein) exhibit biological activity in anhydrous conditions?

i) Biomolecules (DNA and protein) show change in biological activity in anhydrous conditions, in non-
aqueous or anhydrous conditions.
ii) But biomolecules like DNA and protein cannot exhibit biological activity in anhydrous conditions
because rigidity of protein and DNA increases due to the weakening of hydrogen bond strength
which results into the change in overall free energy.
iii) Therefore, in absence of aqueous condition, the free energy change is negative, which is responsible
for the denaturation of biomolecules. Increasing strength of hydrogen-bond causes water to primarily
bond with itself and not to be available for the hydrating structure of proteins or DNA or dissolving
ions.
Hence, life is unsustainable without water.

Hreen Qark, Okl Q & A [VOLUME - II]

 30

15. The following illustrates the linking of DNA fragments:

i) Name ‘a’ and ‘b’.

ii) Complete the palindrome which is recognised by EcoRI.
iii) Name the enzyme that can link the two DNA fragments.
i) a – vector DNA; b – Foreign DNA
ii) 5’ – GAATTC – 3’
3’ – CTTAAG – 5’
iii) DNA ligase

16. i) Mention the number of primers required in each cycle of Polymerase Chain Reaction (PCR).
Write the role of primers and DNA polymerase in PCR:-
ii) Give the characteristic feature and source organism of the DNA polymerase used in PCR :-
Two sets of primers are required
The primers are required for the addition of nucleotides for making multiple copies of the DNA of
interest.
The enzyme DNA polymerase extends the primers using the nucleotides.
The DNA polymerase is a thermostable enzyme, which remains active during denaturation of DNA
in PCR.
It is obtained from a bacterium, Thermus aquaticus.

17. i) Mention the role of vectors in recombinants DNA technology. Give any two examples.
ii) With the help of diagrammatic representation only, show the steps of recombinant DNA
technology.
i) Role of vectors
The vectors have the ability to replicate within the bacterial cells independent of the control of
chromosomal DNA.
If alien piece of DNA is linked to the vector, it can be made to multiply its number equal to the copy
number of the vector.
Vectors help in selection of recombinants from non-recombinants
Examples : Plasmids and bacteriophages

Hreen Qark, Okl Q & A [VOLUME - II]

 31

ii)

18. a) What are recombinant proteins?

b) How do bioreactors help in their production?
c) Name a recombinant vaccine that is currently being used in vaccination programme.
a) The protein produced by the expression of recombinant DNA in the transgenic organisms, are
called recombinant proteins.
Bioreactors help in the production of recombinant proteins in the following way.
b) The transgenic cells/ microbes are cultured in bioreactors on large scale, where they convert the
raw material into specific product.
Bioreactors provide optimum condition of temperature, pH, oxygen, salts, etc to achieve the
desired product.
c) Name a recombinant vaccine that is currently being used in vaccination programme.
Hepatitis-B recombinant vaccine is used for vaccination of Hepatitis virus.

19. Draw a schematic diagram of the E.coli cloning vector pBR322 and mark the following in it:
a) ori b) rop c) ampicillin resistance gene
d) tetracycline resistance gene e) restriction stie BamHI f) restriction site EcoRI

Hreen Qark, Okl Q & A [VOLUME - II]

 32

4 MARK QUESTIONS (CASE BASED QUESTIONS):

1. Given below is the diagram representing the observations made for separating DNA fragments by
gel electrophoresis technique?
Observe the illustration and answer the questions that follow:

a) Why are the DNA fragments seen to be moving in the direction A → B.

b) What is elution? State the importance of elution in this process?
c) Identify the alphabets representing:
i) Largest DNA bands ii) Smallest DNA bands iii) Agarose gel iv) Wells
(or)
Mention the steps involved in the gel electrophoresis.
Answer :
a) As DNA fragments are negatively charged, under electric field they move towards positively
charged electrode anode. Here A represents cathode and B represents anode. So the direction of
movement is A → B.
b) The separated bands of DNA are cut out from the agarose gel and extracted from the gel piece. This
step is known as elution. These purified DNA fragments are used in constructing recombinant DNA
by linking them with cloning vectors in the presence of DNA ligase.
c) i) Largest DNA bands – P ii) Smallest DNA bands – Q iii) Agarose gel – S iv) Well – R
(or)
Basic steps to perform gel electrophoresis are:
Pouring the gel.
Preparing the sample
Loading the DNA samples into the wells
Running the gel (exposing it to electric field)
Staining the gel with Ethidium bromide followed by exposure to UV light.
Elution
Hreen Qark, Okl Q & A [VOLUME - II]
 33

2. Plasmids are vehicles of desired DNA tragements which can undergo independent replication to
increase copies of desired genes. pBR322 has its own origin of replication, selectable marker and
unique recognition site for cloning.

a) In pBR322, alien DNA is ligated in area of Pvu I site. The recombinant plasmids are passed
into bacteria during transformation. How recombinants could be selected from non-
recombinants?
b) Which region in the pBR322controls the copy number? What is the significance of rop gene?
c) How is the copy number of the plasmid vector related to yield of recombinant protein?
(or)
Why restriction endonucleases are also called molecular scissors? From the above diagram
identify the molecular scissors that are isolated from same source?
Answer :
a) In pBR322, if alien DNA is ligated at Pvu I , then r-DNA would not possess Ampicillin
resistance but continues to have tetracycline resistance. Recombinants will grow only in
tetracycline containing medium but will die in ampicillin containing medium. But non
recombinants grow on the medium containing both the antibiotics. In this way antibiotic
resistance genes helps in selection of recombinants.
b) * origin of replication (ori) – region controls the copy number.
* rop codes for the proteins involved in the replication of the plasmid.
c) * The desired DNA which codes for a specific desired protein introduced into a plasmid vector
can multiply its number equal to the copy number of the plasmid.
* So if we want to recover many copies of the target DNA it should be cloned in a vector
whose ori support high copy number.
(or)
Restriction endonucleases attach to DNA at specific locations and breaks into fragments by
breaking phosphodiester bonds hence called as molecular scissors.
PvuI and PvuII are the restriction enzymes isolated from the same source i.e., from a bacteria
named Proteus vulgaricus.

Hreen Qark, Okl Q & A [VOLUME - II]

 34

3. Rama lives in a society where a robbery occurred last night. Robbers came into the flat and
murder the old lady residing there. Police came and restricted the entry into the flat. They took
samples from the room, where the dead body was found. While examining, they found there is
some blood and tissue in the nails of old lady. The sample taken from nail scraping was used in
PCR technique and then performed DNA fingerprinting. Finally after two days of robbery, police
caught the criminial.
a) What is the objective of using PCR technique?
b) Given below are the steps of PCR, identify the labelled parts A, B and C arrange them in the
correct sequence and give reason.

c) Mention the source of DNA polymerase used in PCR. And calculate no of DNA copies formed
after 30 cycles of PCR?
(or)
Mention any two applications of PCR in molecular diagnosis?
Answer :
a) The sample collected has very less amount of DNA, so to amplify the DNA they used PCR
technique.
b) ‘B’ is the dsDNA which on exposure to heat (i.e denaturation) give single stranded DNA.
In ‘C’ we can observe addition of complimentary primers to the 3’ end of templates (i.e Annealing)
In ‘A’ we find two copies of DNA. This is due to the enzyme DNA polymerase extends the primers
using nucleotides provided in the reaction and the genomic DNA as template. So the correct
sequence of given diagram is B, C, A.
c)
DNA polymerase used in this technique is called Taq polymerase extracted from Thermus
aquaticus, which remain active during high temperature (72oC).
After 30 cycles of PCR, no. of DNA copies formed are approximately one billion copies.
(or)
PCR is used to detect HIV in suspected AIDS patients.
It is used to detect mutations in genes in suspected cancer patients.
It is a powerful technique to identify many other genetic disorders.
It is useful in DNA finger printing.

Hreen Qark, Okl Q & A [VOLUME - II]

 35

4. Pardhu is a student of biotechnology. His professor tells him that during transformation with
recombinant DNA, the bacterial cell must be made capable of taking up DNA as DNA do not pass
through membrane. While doing experiment in the lab, Pardhu noticed that bacterial cells were
not taking up foreign DNA even after treating with sodium ion. He asked his professor, the reason
behind this. His professor explained that he should check the valency and charge of the ion that he
is using for the treatment.
a) Why it is difficult for DNA to pass through a membrane?
b) Can you suggest to Pardhu, what type of ions are used to make bacteria competent for
transformation?
c) Explain, how bacteria made competent to take up DNA.
(or)
Explain the methods/techniques that are used to introduce alien DNA into plant and animal
cells.
Answer :
a) DNA is a hydrophilic molecule therefore it can’t pass through membrane.
b) Divalent cations, such as calcium increases the efficiency with which DNA enters the bacteria
through pores in its walls.
c) Bacteria are treated with divalent cations, which increases the efficiency with which DNA enters
the bacterium through pores in its cell wall. r-DNA can then be forced into such cells by
incubating the cells with r DNA on ice, followed by placing them briefly at 42oC (Heat shock),
and then putting them back on ice. This enables the bacteria to take up r-DNA.
(or)
c) Biolistic / gene gun method: It is generally practiced in case of plant cells. Here plant cells are
bombarded with high velocity of micro particles of gold or tungsten coated with DNA.
Micro injection : In this method recombinant DNA is directly injected into the nucleus of an
animal cell.

5. Bioreactors are vessels for production of large-scale products.

Hreen Qark, Okl Q & A [VOLUME - II]

 36

Answer the following questions based on the above information.

i) How has the development of bioreactors helped in biotechnology?
ii) What are recombinant proteins?
iii) How do bioreactors help in their production?
Answer :
i) In bioreactors large volume of culture can be processed which results in higher yields of the desired
specific products (protein/enzyme). The entire process takes place under the controlled conditions of
temperature, pH and raw materials.
ii) The protein produced by genetically altered gene in a host is called recombinant protein. Bioreactors
are vessels in which raw materials are biologically converted into specific products by microbes.
iii) It provides optimum growth conditions such as temperature, pH, substrate, vitamins, oxygen and salts.

5 MARK QUESTIONS :
1. Give reasons why:
a) DNA cannot pass into a host cell through the cell membrane.
b) Proteases are added during isolation of DNA for genetic engineering.
c) Single cloning site is preferred in a vector.
a) DNA is a hydrophilic molecule, so it cannot pass into a host cell through cell membrane. The cell
membrane consists of bilipid layers that are generally impermeable to hydrophilic molecules.
b) DNA is interwined with proteins like histones and RNA. To obtain purified DNA, proteases are
added during isolation of DNA which convert proteins into amino acids and RNases are added to
break down RNA. The purified DNA finally precipitates out after the addition of chilled ethanol.
c) In order to link the alien DNA, the vector needs to have very few, preferably single, recognition sites
for the commonly used restriction enzymes. Presence of more than one recognition sites within the
vector will generate several fragments, which will complicate the gene cloning process.

2. Observe the diagram shown below of pBR322. Answer the questions that follow:

Hreen Qark, Okl Q & A [VOLUME - II]

 37

a) What is pBR322?
b) Write the role of ‘rop’.
c) State the significance of ampR and tetR.
a) pBR322 is the first artificial E.coli cloning vector constructed in 1977 by Boliver and Rodriguez. It
is widely used in gene cloning experiments.
b) ‘rop’ codes for the proteins involved in the replication of the plasmid.
c) ampR (ampicillin resistance) and tetR (tetracycline resistance) are two resistance genes which are
useful as selectable markers. The presence of restriction sites within the markers tetR and ampR
permits an easy selection of transformed cells.

3. Prepare a flow chart in formation of recombinant DNA by the action of restriction endonuclease
enzyme EcoRI.

4. Rearrange the following in the correct sequence to accomplish an important biotechnological

reaction:
Denaturation of ds-DNA
Chemically synthesized oligonucleotides
Primers
Complementary region of DNA
Thermostable DNA polymerase (from Thermus aquaticus)
Binding of Nucleotides provided
Genomic DNA template
In vitro synthesis of copies of DNA of interest
Enzyme DNA-polymerase.

Hreen Qark, Okl Q & A [VOLUME - II]

 38

5. Illustrate the design of a bioreactor with the diagrams. Highlight the difference between a flask in
your laboratory and a bioreactor which allows cells to grow in a continuous culture system.
i) Bioreactors are vessels of large volumes (100-1,000 L) in which raw materials are biologically
converted into specific products.
ii) The most commonly used bioreactors are of stirring type, which are shown in the given figure.

iii) A stirred-tank reactor is usually cylindrical or with a curved base to facilitate the mixing of the
reactor contents. The stirrer facilitates even mixing and oxygen availability throughout the
bioreactor. Altermatively, air can be bubbled through the reactor. If you look at the figure closely
you will see that the bioreactor has an agitator system, an oxygen delivery system and a foam control
system, a temperature control system, pH control system and sampling ports so that small volumes of
the culture can be withdrawn periodically.
Small volume cultures are usually employed in laboratories in a flask for research and production of
less quantity of products. However, large scale production of the products is carried out in
bioreactors.

Hreen Qark, Okl Q & A [VOLUME - II]

 39

6. Can you list 10 recombinant proteins which are used in medical practice? Find out where they are
used as therapeutics (use the internet).
10 recombinant proteins, which are used in medical practice, are given in table below:

S. No. Recombinant proteins Therapeutic uses

i) Insulin (Humulin) For the treatment of diabetes mellitus.
ii) Factor VIII For treating haemophilia A.
iii) Factor IX For treatment of haemophilia B.
For treatment of viral diseases, cancer and acquired
iv) Interferon’s
immunodeficiency syndrome (AIDS).
v) OKT – 3 For acute reversal of kidney transplantation rejection.
vi) DNAse-I For treatment of cystic fibrosis.
vii) Bovine growth hormone For increasing milk yield.
viii) Hepatitis –B growth hormone. Vaccine against hepatitis – B.
ix) Interleukins For treatment of various types of cancers.
x) Anti-thrombin-III To check the clot formation in heart patients.

7. a) Make a chart (with diagrammatic representation) showing a restriction enzyme, the

substrate DNA on which it acts, the site at which it cuts DNA and the product it produces.
b) Can you recall meiosis and indicate at what stage a recombinant DNA is made?
a) Diagrammatic representation of action of restriction enzyme EcoRI.

b) i) Meiosis is a process of cell division in which the cell divides in all sexually reproducing
organisms during the production of spores or gametes. It involves the reduction in the
amount of genetic material and leads to recombinations.

Hreen Qark, Okl Q & A [VOLUME - II]

 40
ii) Recombinant DNA is formed due to crossing over in prophase-I. During the pachytene stage
of prophase I, crossing over of chromosomes takes place where the exchange of genetic
material between non-sister chromatids of homologous chromosomes takes place. This
results in the formation of recombinant DNA.

8. a) Write the definition of Biotechnology given by EFB.

b) Explain the sources of the following REN’S?
Sal – I
Hind – III
Bam H – I
EcoR – I
c) Explain the following words.
i) Spooling
ii) Polyethylene glycol
Answer :
a) Definition of Biotechnology given by EFB
Biotechnology is “The integration of natural science and organisms cells parts there of and
molecular analogues for products and services”.
b) Sources of the following REN’S
1. Sal – I → Streptomyces albus
2. Hind – III → Haemophilus influcnzae Rd
3. Bam H I → Bacillus amyloliquefaciens H
4. EcoR I → Escherichia coliRY13
c) Explain the words.
i) Spooling : The purified DNA finally precipitates out after addition of chilled ethanol and by
using glass rod we can separate and isolate the purified DNA is called spooling.
ii) Polyethylene glycol: The chemical which helps in transfer of foreign DNA in to the host
cell. (vector less)

9. i) Differentiate between sticky ends and blunt ends.

ii) Differentiate between plasmid DNA and genomic DNA.
Answer :
i) Sticky ends:
Restriction enzymes cuts each of the two strands of DNA double helix at specific points in their
sugar – phosphate backbone, a little away from the centre of palindrome site but between the
same two bases on both the strands.

Hreen Qark, Okl Q & A [VOLUME - II]

 41
As a result single stranded over hanging portions are left at the end of DNA in each strand called
sticky ends.
They form hydrogen bonds with their complementary cut counter parts.
Stickyness of ends facilitates action of enzyme Ligase.
Eg : EcoR I (REN) produces sticky ends
Blunt ends:
Many restriction enzyme cut both strands of DNA at exactly the same nucleotide position
typically in the centre of recognition sequence called blunt ends.
No stickiness in the DNA cut portions, only ligase enzyme helps in joining.
Eg : Hind - II
ii) Plasmid DNA and genomic DNA
Plasmid DNA Genomic DNA
1. It is always double stranded 1. It may be single stranded or double stranded
2. It is circular 2. It is linear or circular
3. It is made without histone protein 3. It is coated with histone protein (Eukaryotes)
It can replicate independent of main
4. 4. It replicates with genome
genome
Both Exon and introns are present (Eukaryote)
5. Introns are absent 5.
Introus are absent (Prokaryotes)

10. Some restriction enzymes break a phosphodiester bond on each of the DNA strands, such that only
one end of each molecule is cut and these ends have regions of single stranded DNA. BamH1 is one
such restriction enzyme which binds at the recognition sequence, 5′-GGATCC-3′ and cleaves these
sequences just after the 5′-guanine on each strand.
a) What is the objective of this action?
b) Explain how the gene of interest is introduced into a vector.
c) You are given the DNA shown below.
5′ ATTTTGAGGATCCGTAATGTCCT 3′
3′ TAAAACTCCTAGGCATTACAGGA 5′
If this DNA was cut with BamH1, how many DNA fragments would you expect? Write the
sequences of these double-stranded DNA fragments with their respective polarity.
d) A gene M was introduced into E.coli cloning vector pBR322 at BamH1 site. What will be its
impact on the recombinant plasmids? Give a possible way by which you could differentiate
non-recombinant from recombinant plasmids.

Hreen Qark, Okl Q & A [VOLUME - II]

 42
a) The two different DNA molecules will have compatible ends to recombine.
b) Restriction enzyme cuts the DNA of the vector and then DNA ligase as used to ligate the gene of
interest into the DNA of the vector.
c) 2 fragments
5′ ATTTTGAG 3′5′GATCCGTAATGTCCT 3′
3′ TAAAACTCCTAG 5′.3′GCATTACAGGA 5′
d) BamH1 site will affect tetracycline antibiotic resistance gene, hence the recombinant plasmids will
lose tetracycline resistance due to inactivation of the resistance gene.
Recombinants can be selected from non recombinants by plating into a medium containing
tetracycline, as the recombinants will not grow in the medium because the tetracycline resistance
gene is cut.

11. Development of recombinant DNA technology has opened gates to many breakthroughs in the
fields of medicine and agriculture. This has enabled scientists to isolate, sequence and manipulate
individual genes obtained from diverse living or dead cells. Given below is a diagram showing the
basic steps involved in genetically modifying an organism. Study the given diagram and answer
the questions that follow:

a) Are two different types of restriction endonucleases used, one to cut the vector DNA and
another to cut the desired DNA to be cloned? Support your answer, given reason.
b) Which enzyme is used at step (X) to integrate the foreign DNA with the vector DNA?
c) What is the term used for step (Y) showing multiple copies of the foreign DNA being formed in
transformed E.coli?
d) Draw a diagram of E.coli cloning vector pBR322 to show the following:
i) Any one restriction endonuclease site in tetracycline resistance gene.
ii) Any one restriction endonuclease site in ampicillin resistance gene.
iii) ‘ori’ site.
e) What does “rop” code for in plasmid pBR322?

Hreen Qark, Okl Q & A [VOLUME - II]

 43
a) No, same restriction endonuclease is used to cut both vector and desired DNA. This is done to form
same sticky ends. This ensures easy and firm ligation.
b) Ligase.
c) Amplification
d) E.coli cloning vector pBR322.

e) “rop” codes for the proteins involved in the replication of the plasmid.

12. The structure below shows pUC18 which is similar to pBR322 in its function. However, they differ in
some of their restriction sites and number of ori. The ori number for pBR322 is approximately 20.

a) How are pUC18 and pBR322 used in biotechnological studies? and What will be the impact if
ori in the above structure gets damaged?
b) The lac z gene has many recognition sites. Study the segment of DNA given below and answer
the questions.
5′… ATC GTA AAG CTT CAT …3′
3′… TAG CAT TTC GAA GTA …5′
i) Applying your knowledge of palindrome sequences identify and mark the possible region
where the restriction enzyme X will act.
ii) Restriction enzyme Y was used to extract gene of interest from a plant. This gene needs to
be inserted in the given DNA segment which has been treated with restriction enzyme X.
Will there be a successful recombination? Explain with a reason.
c) Which one of the two (pUC18 and pBR322) would you prefer for biotechnological studies?
Justify.
Answer :
Hreen Qark, Okl Q & A [VOLUME - II]
 44
a)
They are used as vectors to transfer the gene(s) of interest from an organism into the host cells
for gene cloning; they provide the origin of replication to the DNA linked, for multiplication.
If ‘ori’ is damaged, the DNA linked to the plasmid cannot replicate, i.e., there cannot be any gene
cloning.
b) i) – Restriction enzymes recognize and cut the strands at the palindromic sequences.
– The palindromic sequence in this segment of DNA is:
5′__________AAGCTT_________3′
3′__________TTCGAA_________5′
ii) – No, recombinant formation will not be successful.
– The same restriction enzyme should be used to cut the plasmid DNA and the DNA of interest
from the plant.
c) pUC18 will be preferred, as it has a higher copy number (100) than pBR322 (20).

13. a) Name the bacterium, whose plasmid was used successfully for the first time as a vector by
Stanley Cohen and Herbert Boyer. Name the gene they linked to the vector to create an rDNA.
b) How did it become possible to isolate the gene of interest from the DNA? Name the host cell
into which the rDNA was introduced.
c) Draw a diagram of E.coli cloning vector pBR322 and label two selectable markers in it and two
restriction sites present on each of the marker genes labelled.
a) – Salmonella typhimurium.
– Antibiotic resistance gene.
b) – It became possible with the use of restriction endonucleases.
– The rDNA was introduced into Escherichia coli.

c)

14. Three circular DNA molecules were incubated independently with three different restriction enzymes,
RE-1, RE-2 and RE-3 and gel electrophoresis was carried out to separate the DNA fragments formed
by restriction digestion.
Observe the gel showing the migration of DNA fragments cut with the restriction endonucleases and
answer the questions that follow:

Hreen Qark, Okl Q & A [VOLUME - II]

 45

a) Write the principle responsible for the migration of DNA fragments to such different positions
in the gel.
b) How many recognition sites for each of these restriction enzymes were present in the DNA cut
with these enzymes? Justify your answer.
c) How can one visualize the separated DNA fragments and extract them from the gel?
a) – DNA being negatively charged, can be separated by forcing them to move towards the anode
under an electric field through a matrix, which is agarose.
– The matrix provides the sieving effect and the DNA fragments resolve according to their size;
hence, the smaller fragments move farther towards anode.
b) – The number of recognition sites for RE-1 is 3, for RE-2 is 2 and for RE-3 is 3.
– Since the DNA is circular, the number of fragments is equal to the number of recognition
sites where the enzyme cuts the DNA.
c) – The gel containing DNA fragments is stained with ethidium bromide and exposed to UV
radiation; orange-coloured bands (of DNA) become visible.
– Elution is the process in which the separated bands of DNA are cut out and DNA extracted
from the gel.

15. Bioreactors are the containment vehicles of any biotechnology-based production process. For
large scale production and for economic reasons the final success of biotechnological process
depends on the efficiency of the bioreactor.
Answer the following questions w.r.t. the given paragraph:
Hreen Qark, Okl Q & A [VOLUME - II]
 46

a) List the operational guidelines that must be adhered to so as to achieve optimization of the
bioreactor system. Enlist any four.
b) Mention the phase of the growth we refer to in the statement “Optimisation of growth and
metabolic activity of the cells”.
c) Is the biological product formed in the bioreactor suitable for the intened use immediate? Give
reason in support of your answer.
a) i) A bioreactor is usually cylindrical or with a curved base to facilitate the mixing of the reactor
contents.
ii) The stirrer facilitates even mixing and oxygen availability throughout the bioreactor.
Alternatively air can be bubbled through the reactor.
iii) Regular cleaning and maintenance of the reactor is important.
iv) It is important to maintain aseptic conditions to minimize contamination.
b) Exponential phase of growth.
c) After completion of the biosynthetic stage, the product has to be subjected through a series of
processes before it is ready for marketing as a finished product. Purification, which are collectively
referred to as downstream processing. The product has to be formulated with suitable preservatives.
Such formulation has to undergo thorough clinical trials as in case of drugs. Strict quality control
testing for each product is also required.

Hreen Qark, Okl Q & A [VOLUME - II]

 47

BIOTECHNOLOGY AND ITS APPLICATIONS

2 MARK QUESTIONS:
1. In view of the current food crisis, it is said, that we need another green revolution. Highlight the
major limitations of the earlier green revolution.
Limitations of green revolution are given as : Though the green revolution succeeded in tripling the
food supply, yet it was not enough to feed the growing human population. Increased yields have
partly been due to the use of improved crop varieties, but mainly due to the use of better
management practices and use of agrochemicals (fertilizers and pesticides).
However, it is difficult for the farmers of developing world to increase the crop yield due to
expensive agrochemicals, use of existing varieties with conventional breeding methods.
Further, use of agrochemicals cause eutrophication in aquatic ecosystems and biomagnifications in
terrestrial ecosystems. Water logging and soil salinity are some of the other problems that have
come in the wake of green revolution.

2. Expand GMO. How is it different from a hybrid?

GMO stands for Genetically Modified Organism. It differs from a hybrid because hybrid organisms is
produced by carrying out crossing between total genomes of two species or strains while in a GMO,
foreign gene(s) is introduced in the organism and is usually maintained as extra-chromosomal entity or is
integrated into the genome of the organism.

3. Discuss the advantages of GMO.

Plants, bacteria, fungi, and animals whose genes have been altered by manipulation, through genetic
engineering, are called Genetically Modified Organisms (GMO). GM plants have been useful in many
ways. The process of Genetic modification has:
i) Made crops more tolerant to abiotic stresses (cold, drought, salt, heat).
ii) Reduced reliance on chemical pesticides (pestresistant crops).
iii) Helped to reduce post-harvest losses.
iv) Increased efficiency of mineral usage by plants (this prevents early exhaustion of fertility of soil).
v) Enhanced nutritional value of food, e.g., Vitamin ‘A’ enriched rice.

4. Differentiate between diagnostics and therapeutics. Give one example and for each category.
A diagnostic technique helps us to diagnose or identify and monitoring diseases or injuries by
analyzing images. Example: ELISA is a test for HIV.
A therapeutic agent on the other hand helps in the treatment of a disease. Example: Antibiotics for
bacterial infections.

Hreen Qark, Okl Q & A [VOLUME - II]

 48

5. Give the full form of ELISA. Which disease can be detected using it? Discuss the principle
underlying the test.
Enzyme Linked Immuno-Sorbent Assay (ELISA) is a diagnostic technique used for the detection of
AIDS.
ELISA is based on the principle of antigen-antibody interaction. Infection by pathogen can be
detected by the presence of antigens (proteins, glycoproteins, etc.) or by detecting the antibodies
synthesized against the pathogen.

6. Can a disease be detected before its symptoms appear? Explain the principle involved.
Presence of a pathogen (bacteria, viruses, etc.) is normally suspected only when a pathogen produces
disease symptom. By the time, the symptoms of a disease appear on our body and the concentration
of pathogen in our body is very high.
However, low concentration of a bacteria or virus, even at a time when the symptoms of the disease
are not visible, can be detected by amplification of their nucleic acid by PCR methods.

7. What is bio-piracy? Give on example of one such condition.

Bio-piracy is defined as the illegal utilization of biological material by organizations or multinational
companies without proper authorization from the concerned countries.

8. Many proteins are secreted in their inactive form. This is also true of many toxic proteins
produced by micro-organisms. Explain how the mechanism is useful for the organisms producing
the toxin?
Many proteins including certain toxins are secreted in their inactive form. They get activated, only when
exposed to a specific trigger (pH, temperature, etc.). It is advantageous to the bacteria producing it
because the bacterium does not get killed due to the action of protein.

9. While creating genetically modified organisms, genetic barriers are not respected. How can this
be dangerous in the long run?
The manipulation of living organisms by the human race cannot be undertaken further without regulation
as unpredictable results may create serious issues. Some ethical standards are required to evaluate the
morality of all human activities that might help or harm living organisms. Going beyond the morality of
such issues, the biological significance of such things is also important. Genetic modification of
organisms can have unpredictable results when such organisms are introduced into the ecosystem and
therefore, ecosystem may be get disturbed causing threat to the existing of life in a particular ecosystem.

Hreen Qark, Okl Q & A [VOLUME - II]

 49

10. Why has the Indian Parliament cleared the second amendment of the country’s patents bill?
The Indian Parliament has recently cleared the second amendment of the Indian Patents Bill that
empowers our country to protect our bio-resources and traditional knowledge from their unauthorized
and irregular use by the other countries. The amended bill provides for patent terms emergency
provisions and research and development initiatives.

11. Name the first transgenic cow. Which gene was introduced in this cow?
Rosie is the first transgenic cow. Gene for human alpha-lactalbumin was introduced in its gene and
introduction of said gene increased the nutritional value of the milk of transgenic cow.

12. Does our blood have proteases and nucleases?

No, human blood does not have enzymes, nucleases and proteases. Blood serum of human beings
contains different types of protease inhibitors, which protect the blood proteins from being broken down
by the action of proteases. The enzyme, nucleases, catalyses the hydrolysis of nucleic acids that is
absent in blood.

13. What is GEAC and what are its objectives?

GEAC (Genetic Engineering Approval Committee) is an organization of Indian Government to examine
the matters related to our bio-resources and traditional knowledge.
a) Examine the validity of GM (Genetic modification of organism) research.
b) Inspect the safety of introducing GMO for public services.

14. For which variety of Indian rice, the patent was filed by a USA Company?
A new variety resulted form a cross between Indian Basmati and a semi-dwarf variety. This new variety
was claimed by the US Company and a patent was obtained for the same by the US company restricting
its future use by others.

15. What are Cry genes? In which organism are they present?
Cry genes codes a toxin which is poisonous to some insects thus, giving resistant to the plants. They are
present in bacterium Bacillus thuringiensis.

16. Which disease is treated by α-1-antitrypsin? Which transgenic animal produce human protein
milk?
Human protein (α-1-antitrypsin) used to treat emphysema.
In 1997, the first transgenic cow, Rosie, produced human protein-enriched milk (2.4 grams per litre).
The milk contained the human alpha-lactalbumin and was nutritionally a more balanced product for
human babies than natural cow-milk.
Hreen Qark, Okl Q & A [VOLUME - II]
 50

17. What are conventional methods and early diagnostic methods to determine diseases?
Conventional methods of diagnosis are
a) Serum analysis
b) Urine analysis
Three techniques, serve the purpose of early diagnosis are
a) Recombinant DNA technology
b) Polymerase chain reaction
c) ELISA

18. Define transgenic animals? List four disease for which transgenic animals serve as model for
disease study?
Animals that have had their DNA manipulated to possess and express an extra (foreign) gene are
known as transgenic animals.
Today transgenic animals serve as models for many human diseases such as cancer, Alzheimers,
cystic fibrosis, rheumatoid arthritis.

19. Compare and contrast the advantages and disadvantages of production of genetically modified
crops.
Advantages
i) made crops more tolerant to abiotic stresses (cold, drought, salt, heat).
ii) reduced reliance on chemical pesticides (pest-resistant crops).
Disadvantages
i) Transgenic genes in GM crops endanger native species.
ii) They cause damage to natural environment by reducing biodiversity.
iii) They may cause human health problems by altered genes
iv) Development of new strains of bacteria which are antibiotic resistance or other drug resistance.

20. What qualities of Basmati accounts for its distinct nature?

Basmati rice is distinct for its unique aroma and flavour and 27 documented varieties of Basmati are
grown in India.
In 1997, an American company got patent rights on Basmati rice, but this variety had actually been
derived from Indian farmer’s varieties.

21. What are recombinant proteins? How do bioreactors help in their production?
The proteins produced by the expression of recombinant DNA in a transgenic organism are called
recombinant proteins.

Hreen Qark, Okl Q & A [VOLUME - II]

 51
Bioreactors help in the production of recombinant proteins in the following ways:
i) Large volumes of culture can be processed in them, to produce appreciable quantities of the
product.
ii) Bioreactors provide optimum conditions of temperature, pH, oxygen, salts, substrate etc. to
achieve the desired product.

22. What are transgenic bacteria? Illustrate using any one example.
Transgenic bacteria are bacteria, whose DNA has been manipulated to possess and express a foreign
gene.
For example, Eli Lilly an American company prepared two DNA sequences corresponding to A and
B chains of human insulin, and introduced into the plasmids of E.coli.

23. What are the advantages of molecular diagnosis over conventional methods?
rDNA technology, PCR (Polymerase Chain Reaction) and ELISA (Enzyme Linked Immuno-sorbant
Essay) are molecular diagnosis techniques which help in an early diagnosis of a disease.
Such techniques can be used to detect mutations in genes in suspected cancer patient.

24. How can molecular diagnostic technique be helpful in early detection of cancer?
A single stranded DNA or RNA, tagged with a radioactive molecule (probe) is allowed to hybridise
to its complementary DNA in a clone of cells followed by detection using autoradiography.
A clone having the mutated gene (as in cancer cells), will not appear on the photographic film,
because the probe will not have complimentarity with the mutated gene.

25. Plasmid is boon to biotechnology. Justify this statement quoting the production of human insulin
as an example.
Plasmid is an autonomously replicating extra-chromosomal circular DNA found in bacterial cells.
Since it can replicate within a bacterial cell, it is used as vector in rDNA technology. Eli Lilly an
American company prepared two DNA sequences corresponding to A and B chains of human insulin
and introduced them in plasmids of E.Coli to produce insulin chains.
Chains A and B were produced separately, extracted and combined by creating disulphide bonds to
form human insulin.

26. Recombinant DNA technology is of great importance in the field of medicine. With the help of a
flow chart, show how this technology has been used in preparing genetically engineered human
insulin.

Hreen Qark, Okl Q & A [VOLUME - II]

 52

3 MARK QUESTIONS:
1. Gene expression can be controlled with the help of RNA. Explain the method with an example.
RNA interference or RNAi technology , also referred as gene silencing, is used to control the gene
expression with the help of RNA molecule. The technology blocks the expression of certain genes.
During the process, a complementary RNA to the mRNA, being produced by the gene, is introduced into
the cell. This RNA binds to the mRNA making it double stranded and therefore stops its translation.
Resistance to nematode Meloidegyne incognitia in tobacco has been achieved by this method.

2. Suggest and describe a technique to obtain multiple copies of a gene of interest in vitro.
PCR is called as polymerase Chain Reaction. Multiple copies of the gene of interest is synthesized in
vitro using two sets of primers and enzyme DNA polymerase. The enzyme extends the primers using
nucleotides provided and genomic DNA as template. The process of DNA replication is repeated
several times for amplification of DNA with the help of thermostable DNA polymerase which remains
active during high temperature and induced denaturation of double stranded DNA.

3. What is a recombinant DNA vaccine? Give two examples.

A recombinant DNA vaccine is produced through recombinant DNA technology. These vaccines
usually consist of synthetic DNA containing the gene that encodes the disease-agent protein which
stimulates immune response into bacterial or mammalian cells. Recombinant DNA technology has
allowed the production of antigenic polypeptides of pathogen in bacteria or yeast.
For example: hepatitis B vaccine (Recombivax HB) is produced from yeast. Until June 2015, one
human DNA vaccine had been approved for human use, the single-dose Japanese encephalitis
vaccine called IMOJEV, released in 2010 in Australia.
Hreen Qark, Okl Q & A [VOLUME - II]
 53

4. What are Cry proteins? Name an organism that produces it. How has man exploited this protein
to his benefit?
Cry proteins are encoded by cry genes. These proteins are toxins, which are produced by Bacillus
thuringiensis bacteria. This bacterium contains these proteins in their inactive from. When the inactive
toxin protein is ingested by the insect, it gets activated by the alkaline pH of the gut. This results in the
lysis of epithelial cell and eventually the death of the insect. Therefore, man has exploited this protein to
develop certain transgenic crops with insect resistance such as the cotton, Bt corn, etc.,

5. Can you suggest a method to remove oil (hydrocarbon) from seeds based on y our understanding
of rDNA technology and chemistry of oil?
Recombinant DNA technology (rDNA) is a technique used for manipulating the genetic material of
an organism to obtain the desired result. This technology is used for removing oil from seeds.
The constituents of oil are glycerol and fatty acids. Using rDNA, one can obtain oil less seeds by
preventing the synthesis of either glycerol or fatty acids. This is done by removing the specific gene
responsible for the synthesis.

6. Consult internet and find out how to make orally active protein pharmaceutical. What is the
major problem to be encountered?
Orally active protein contains pharmaceuticals biologically active materials such as peptides or
proteins, antibodies, and polymeric beads. It is administered orally into the body through various
formulations.
Process of manufacturing of orally active protein pharmaceutical involved the encapsulation of
protein or peptide in liposomes or formulations using penetration enhancers.
These proteins or peptides are used for treatment of various diseases and are also used as vaccines.
However, the oral administration of these peptides or proteins has some problems related to it. Once
these proteins are ingested, the proteases present in the stomach juices denature the protein. As a
result, their effect will be nullified. Hence, it is necessary to protect the therapeutic protein from
digestive enzymes, if taken orally. This is the reason for the proteins to be injected directly into the
target site.

7. Who was the first patient who was given gene therapy? Why was the given treatment recurrent in
nature?
First clinical gene therapy was given in the year 1990 to a 4-year old girl with ADA (Adenosine
deaminase) deficiency.
ADA deficiency causes SCID (Severe Combined Immuno Deficiency) in which B-lymphocytes and
T-lymphocytes are not formed. The ADA gene provides instructions for producing the enzyme
adenosine deaminanse. This enzyme is produced in all cells, but the highest levels of adenosine
deaminase occur in immune system cells called lymphocytes. The absence of ADA results in a
dysfunctional immune system due to build-up of toxic metabolites.

Hreen Qark, Okl Q & A [VOLUME - II]

 54
In some children ADA deficiency can be cured by bone marrow transplantation, in others it can be
treated by enzyme replacement therapy, in which functional ADA is given to the patient by injection.
Drawback of these two methods is that cure is not permanent as patient needs periodic treatment to
remain fit.
As a first step towards gene therapy, lymphocytes from the blood of the patient are grown in a
culture outside the body. A function ADA cDNA (using a retroviral vector) is then introduced into
these lymphocytes, which are subsequently returned to the patient, However, as these cells are not
immortal, therefore, patient requires periodic infusion of such genetically engineered lymphocytes.
However, if the gene isolated from marrow cells producing ADA is introduced into cells at early
embryonic stages, it could be cured permanently.

8. Why do lepidopterans die when they feed on Bt cotton plant? Explain how does it happen.
Some strains of Bacillus thuringiensis contain gene called cry gene produce protein that kill certain
insects such as Lepidopterons (tobacco budworms, armyworms) coleopterans (beetes) and dipterans
(flies, mosquitoes). Bacillus thuringiensis forms protein crystal during as particular phase of their
growth. These crystals contain a toxic insecticidal protein. The activated toxin binds to the surface of
midgut epithelial cells and create pores that causes cell swelling and lysis. The toxin is coded by a gene
named cry.

9. Explain the various steps involved in the production of artificial insulin.

i) Insulin contains two short polypeptide chains: chain A and chain B linked together by disulphide
bridges.
ii) In mammals, insulin is synthesized as a pro-hormone. It contains an extra stretch called C-peptide.
It is absent in the mature insulin and is removed during maturation into insulin.
iii) Insulin can be produced by rDNA technique and it was achieved by an American company, Eli Lily
in 1993. It is prepared by two DNA sequences corresponding to A and B, chains of human insulin
and introduced them in plasmids of E. coli for production. The A and B chains produced were
separately, extracted and combined, by creating disulphide bonds to form human insulin.

10. How has RNAi technique helped to prevent the infestation of roots in tobacco plants by a
nematode Meloidegyne incognitia?
A nematode Meloidegyne incognitia infects the roots of tobacco plants and causes a great reduction in
yield. Using Agrobacterium vectors, nematode specific genes were introduced into the host plant
(Figure given below). The introduction of DNA was such that it produced both sense and antisense
RNA in the host cells. These two RNA’s being complementary to each other formed a double stranded
RNA (dsRNA) that initiated RNAi and thus, silenced the specific mRNA of the nematode. The
consequence was that the parasite could not survive in a transgenic host expressing specific interfering
RNA. The transgenic plant therefore got itself protected from the parasite.

Hreen Qark, Okl Q & A [VOLUME - II]

 55

(a) (b)
Figure:
a) Roots of plant with nematode infestation
b) Transgenic plant roots after deliberate infection of nematode but protected through novel
mechanism.

4 MARK QUESTIONS (CASE BASED QUESTIONS) :

1. Gm crops especially Bt crops known to have higher resistance to pest attacks. To substantiate this,
an experimental study was conducted to 4 different farmlands growing Bt and Non Bt Cotton
crops. The farm lands had the same dimensions fertility and were under similar climatic
conditions. The histogram below shows the usage of pesticides on Bt crops and Non-Bt crops in
these farm lands.

Hreen Qark, Okl Q & A [VOLUME - II]

 56

a) Which of the above four farm lands have successfully applied the concepts of Biotechnology
to show better management practices and use of agrochemicals? If had to cultivate, which
crop would you prefer Bt or Non-Bt and why?
b) Cotton bollworms were introduced in another experimental study on the above farm lands
whereas no pesticide was used explain hat effect would a Bt and Non-Bt crop have on the
pest.
Answer :
a) Farm land II shows better management practices and use of agro chemicals. If I had to cultivate I
would personally prefer Bt crop because the using of pesticides is highly reduced for Bt crops.
b) In cotton a cry gene has been introduced from bacterium Bacillus thuringiensis (Bt), which
causes synthesis of a toxic protein. This protein becomes active in the alkaline gut of bollworm.
Bollworm feeds on cotton, punching holes in the epithelial lining causing death of the insect.
However a non Bt crop will have no effect on the cotton boll worm and the yield of cotton will
decrease as non-Bt will succumb to pest attack.

2. Read the text carefully and answer the questions:

GM is a technology that involves inserting DNA into the genome of an organism. To produce a GM
plant, new DNA is transferred into plant cells. Usually the cells are then grown in tissue culture where
they develop into plants. The seeds produced by these plants will inherit the new DNA.
Given below is a table depicting the different genetically engineered plants and the organism used.
Genetically engineered plants Micro organisms used to modify the plant

1) a) ?

2) b) ?

Hreen Qark, Okl Q & A [VOLUME - II]

 57

a) Name the organisms used in (a) and (b).

b) Write the name of plants modified (1) and (2).
c) How to construct a transgenic cotton plant such as Bt-cotton? (or) How does a transgenic
Tobacco shows RNAi?
Answer :
a) The micro organism used for developing GM crops for 1st plant (a) Bacillus thuringicnsis and for
2nd plant is (b) Agrobacterium tumifaciens.
b) The name of the plant which is genetically engineered by (a) is cotton and (b) is Tobacco.
c) To develop the resistant variety of cotton plant against the infection of Bollworm, Bt toxin gene
is cloned from the bacteria and it is expressed in plants. Thus GM crop produced in this way can
grow effectively with out the need for insecticides.
(OR)
In case of Tobacco plant a nematode Meloidegyne incognitia infects the roots which results in
the reduction of yield. To develop a resistant variety RNA interference (RNAi) technology is
used using Agrobacterium vectors, Nematode specific genes were introduced into the host plant.
The introduction of genes is such that they produce both sense and antisgense strends of mRNA.
These bind together to form dsRNA. This silences the mRNA of Nematode and Nematode
cannot infest in tobacco roots and plant has resistance to Nematodes.

3. Insulin is a hormone created by our pancreas that controls the amount of glucose in your blood
stream at any given moment. It also helps to store glucose as glycogen and fats in liver and
Muscles. Finally it regulates our body’s metabolism of carbohydrates, fats and proteins sound
important.
a) Name the source from which insulin was extracted earlier. Why is this insulin no more in
use by diabetic people?
b) Explain the process of synthesis of Insulin by Eli lily compound. Name the technique used
by the company?
c) How is the insulin produced by human body different from the insulin produced by the
above mentioned company?
Answer :
a) Insulin was extracted earlier from the pancreas of slaughtered pigs and cattle. Insulin obtained
from these sources caused some allergy or some other reactions to the foreign protein.

Hreen Qark, Okl Q & A [VOLUME - II]

 58
b) Steps involved in insulin production by the Eli lily company are as follows.
i) DNA sequences corresponding both 2 polypeptides A and B chains of insulin were
synthesised in vitro.
ii) They were introduced into plasmid DNA of E.coli.
iii) They were extracted and combined by creating disulphide bridge.
iv) The transgene was expressed in the form of polypeptides. A and B secreted into the medium.
c)
Insulin produced by rDNA Insulin produced in the pancreas

1) A and B polypeptides 1) It has polypeptides A, B and C chains before

maturing and together it is called prohormone.
2) It directly synthesizes the mature 2) It undergoes processing to form mature and
hormone. functionally active hormone.
3) Disulphide bridges are made during 3) It occurs inside the cell.
down streaming process.

4. Oil spill is a major environmental issue. It has been found that different strains of Pseudomonas
bacteria have genes to produce proteins that break down the four major hydrocarbons in oil.
Trial are underway to use different biotechnologic tools to incorporate these genes and create a
genetically engineered strain of pseudomonas a Super bug to break down the hydrocarbons in oil.
Such bacteria might be sprayed onto surfaces polluted with oil and to clean that film.
a) List 2 advantages of using bacteria for such biotechnological studies?
b) For amplification of the gene of interest PCR was carried out, the PCR was run with the
help of polymerase which was functional only at a very low temp. How will this impact the
efficiency of the PCR? Justify.
c) If such bacteria are sprayed on water bodies with oil spills. How all this have effect on the
environment? Would they have a positive or negative effect?
Answer :
a) You can easily grow a large quantity of the bacteria that have plasmids and transform them using
genetic engineering.
b) PCR will not amplify the gene. In PCR, enzyme required should be heat stable and they help in
denaturction where at high temperature dsDNA becomes ssDNA. As the enzyme given for PCR is
thermo sensitive enzyme, it does nto help in denaturation step and thus PCR will not amplify the gene.
c) Positive effect: Oil spills can be treated and environment becomes better and safe for aquatic forms.
Negative effect: The bacteria can mutate and can harm other organisms and can conjugate with other
non virulent forms and make them super bugs with detrimental effects unpredictable for a longer
duration. It may reduce the dissolved oxygen and leading to mortality of aquatic organisms.

Hreen Qark, Okl Q & A [VOLUME - II]

 59

5. Monopoly over indigenous resources Read the following and answer the questions that follows :
Turmeric is one of the most famour plants that is known to miraculously cure almost all health
problems and is known to be used by Indians for thousands of years due to its immense health
benefits and anti-inflammatory properties. The University of Mississippi applied for a patent on
the use of turmeric for wound healing properties and the patent was granted to them in 1994. The
university claimed that the turmeric was mainly used in India for curing sprains and for anit-
inflammatory applications but there was no proof on the use of turmeric for treating external
wounds. The Indian Council for Scientific and Industrial Research disputed the patent by
submitting relevant records and Sanskrit tests, including a research that showed the use of
turmeric in treating wounds which was published in 1953. On the basis of submitted proofs, the
U.S patent and trademark office revoked the patent which was given to the Mississippi University
on the use of turmeric for healing external wounds.
a) Suggest the term for the unauthorized use of bio resources by multinational companies and
organizations, without approval of a nation or its related people
b) Give any two examples of plants for which patent have been revoked.
c) What are the three criteria to obtain a patent?
d) State any two drawbacks of patents.
Answer:
a) Biopiracy
b) Neem and Basmati
c) Novelty, Non-obviousness and Utility
d) Biopiracy and patenting of indigenous knowledge is a double theft because first it allows theft of
creativity and innovation, and secondly, the exclusive rights established by patents on stolen
knowledge steal economic options of everyday survival on the basis of our indigenous
biodiversity and indigenous knowledge. Overtime, the patents can be used to create monopolies
and make everyday products highly priced.

6. Gene Therapy Read the following and answer the questions that follows :
Human gene therapy seeks to modify or manipulate the expression of a gene or to alter the
biological properties of living cells for therapeutic use. Gene therapy is a technique that modifies a
person’s genes to treat or cure disease. Gene therapies can work by several mechanisms:
Replacing a disease-causing gene with a healthy copy of the gene
• Inactivating a disease-causing gene that is not functioning properly
• Introducing a new or modified gene into the body to help treat a disease

Hreen Qark, Okl Q & A [VOLUME - II]

 60

i) In gene therapy, the gene defects are cured in a child or in ____________ stage.
a) adulthood b) adolescent c) old age d) embryonic
ii) In 1990 the first gene therapy was given to treat which deficiency?
a) Adenosine deaminase b) phenylketonuria
c) phenylalanine d) tyrosine
iii) __________ is an alternative method to cure ADA deficiency
a) Cloning b) Bone marrow transplantation
c) Hybridization d) Southern blotting
iv) Introduction of gene isolate from bone marrow producing ADA should be introduced at
what age to permanently cure ADA?
a) adulthood b) adolescent c) old age d) embryonic
v) What kind of disease can be cured with the help of gene therapy?
a) acute diseases b) physiological diseases
c) hereditary diseases d) infectious diseases
Answer:
i) d) embryonic
ii) a) Adenosine deaminase
iii) b) Bone marrow transplantation
iv) d) embryonic
v) c) hereditary diseases

5 MARK QUESTIONS:
1. How has the use of Agrobacterium as vectors helped in controlling Meloidegyne incognitia
infestation in tobacco plants? Explain in correct sequence.
Several nematodes parasite, a wide variety of plants and animals including human beings. A nematode
Meloidogyme incognita infects roots of tobacco plants and causes a great reduction in yield. The novel
mechanism was adopted to prevent this infestation was based on the process of RNA interference
(RNAi). It takes place in all eukaryotic organisms as a method of cellular defence. The method
involves:
i) Silencing of a specific mRNA due to a complementary dsRNA molecule that binds to and prevents
translation of the mRNA (silencing).
ii) Using Agrobacterium vectors,
a) Nematode-specific genes were introduced into the host plant.
b) The introduction of DNA was such that it produced both sense and anti-sense RNA in the host
cells. This two RNA’s being complementary to each other formed a double stranded (dsRNA)
that initiated RNAi and thus, silenced the specific mRNA of the nematode.
c) The consequence was that the parasite could not survive in a transgenic host expressing specific
mRNA.

Hreen Qark, Okl Q & A [VOLUME - II]

 61

2. What are transgenic bacteria? Illustrate using any one example.

Transgenic bacteria contain foreign gene which is introduced into its genome. They are manipulated
to express the desirable gene for the production of commercially important products.
Example of transgenic bacteria: E.coli. In the plasmid of E.coli, the two DNA sequences
corresponding to A and B chain of human insulin are inserted, so as to produce the respective human
insulin chains. Therefore, after the insertion of insulin gene into the bacterium, it becomes
transgenic and starts producing chains of human insulin. Later on, these chains are extracted from
E.coli and combined to form human insulin.

3. Compare and contrast the advantages and disadvantages of production of genetically modified crops.
The production of genetically modified modified (GM) or transgenic plants has several advantages.
i) Most of the GM crops are pest resistant, which increases the crop productivity and therefore, reduces
the reliance on chemical pesticides.
ii) GM food crops have enhanced nutritional quality. For example, golden rice is a transgenic variety in
rice, which is rich in vitamin A.
iii) These plants prevent the loss of fertility of soil by increasing the efficiency of mineral usage.
iv) They are highly tolerant to unfavourable abiotic conditions.
v) The use of GM crops decreases the post harvesting loss of crops.
However, there are certain controversies regarding the use of GM crops around the world. The use
of these crops can affect the native biodiversity in an area. For example, the use of Bt toxin to
decrease the amount of pesticide is posing a threat for beneficial insect pollinators such as honey bee.
If the gene expressed for Bt toxin gets expressed in the pollen, then the honey bees might be affected.
As a result, the process of pollination by honey bees would be affected. Also, GM crops are
affecting human health as they supply allergens and certain antibiotic resistance markers in the body.
Also, they can cause genetic pollution in the wild relatives of the crop plants. Hence, it is affecting
our natural environment.

4. A patient is suffering from ADA deficiency. Can he be cured? How?

First clinical gene therapy was given in the year 1990 to a 4-year old girl with ADA (Adenosine
deaminase) deficiency. ADA deficiency causes SCID (Severe Combined Immuno Deficiency) in
which B-lymphocytes and T-lymphocytes are not formed. The ADA gene provides instructions for
producing the enzyme adenosine deaminase. This enzyme is produced in all cells, but the highest
levels of adenosine deaminase occur in immune system cells called lymphocytes. The absence of
ADA results in a dysfunctional immune system due to the build-up of toxic metabolites.

Hreen Qark, Okl Q & A [VOLUME - II]

 62
In some children ADA deficiency can be cured by bone marrow transplantation; in others it can be
treated by enzyme replacement therapy, in which functional ADA is given to the patient by injection.
Drawback of these two methods is that cure is not permanent as patient needs periodic treatment to
remain fit.
As a first step towards gene theraphy, lymphocytes from the blood of the patient are grown in a
culture outside the body. A functional ADA cDNA (using a retroviral vector) is then introduced into
these lymphocytes, which are subsequently returned to the patient. However, as these cells are not
immortal, therefore, patient requires periodic infusion of such genetically engineered lymphocytes.
However, if the gene isolated from marrow cells producing ADA is introduced into cells at early
embryonic stages, it could be cured permanently.

5. Define transgenic animals. Explain detail any four areas where they can be utilized.
Transgenic animals are the products of genetic engineering and express specific genes from totally
unrelated source.
Following are the four main areas where they can be utilized:
i) To study normal physiology and development: These animals can be used to study as to which
factor/gene products are needed at what time of development. By expression of certain genes, they
help scientists to understand the normal gene expression at various stages of growth and
development.
ii) Study of diseases: Transgenic animals can be created to serve as models for various human diseases.
They also help us to understand the involvement of various genes in diseases like cancer, Parkinson’s
disease, etc.,
iii) Vaccine safety: Transgenic animals can be used to test vaccines like polio vaccine. Transgenic mice
have shown promising results in this area and would replace the vaccine testing on monkeys in the
years to come.
iv) Chemical safety testing: Transgenic animals are created which are more sensitive to certain
chemicals/drugs. These are used to study the toxicity or side effects of that chemical/drug. The
advantage is that we get results faster.

6. Diagrammatically represent the experimental steps in cloning and expressing a human gene (say
the gene for growth hormone) into a bacterium like E.Coli?
DNA cloning is a method of producing multiple identical copies of specific template DNA. It involved
the use of a vector to carry the specific foreign DNA fragment into the host cell. The mechanism of
cloning and transfer of gene for growth hormone into E.coli is represented below.

Hreen Qark, Okl Q & A [VOLUME - II]

 63

7. What are the various advantages of using genetically modified plants to increase the overall yield
of the crop?
Genetically modified (GM) plants have been useful in several ways as given under:
a) Made crops more tolerant to abiotic stresses (heat, cold, drought, etc).
b) Reduced reliance on chemical pesticides (pest-resistant crops).
c) Reduce post-harvest losses.
d) Increased efficiency of mineral usage by plants so that this can prevent early exhaustion of fertility of
soil.
e) Enhanced nutritional value of food, for example: use vitamin ‘A’ enriched rice.
f) In addition to these uses, GM has been used to create tailor-made plants to supply alternative
resources to industries, in the form of pharmaceuticals, starches and fuel.

Hreen Qark, Okl Q & A [VOLUME - II]

 64

8. What is meant by the term bio-pesticide? Name and explain the mode of action of a popular bio-
pesticide.
Bio-pesticide is a pesticide which is:
i) Not chemical in nature.
ii) More specific in action against the pest.
iii) Safer for environment than chemical pesticides. The commonly known bio-pesticide is BT toxin,
which is produced by a bacterium called Bacillus thuringiensis. Bt toxin gene has been cloned from
this bacterium and expressed in plants. Bt toxin gene has been cloned from this bacterium and
expressed in plants. Bt toxin protein when ingested by the insect, gets converted to its active form
due to the alkaline pH of the gut. The activated toxin binds to the surface of midgut epithelial cells
and create pores that cause cell swelling and lysis and eventually kills the insect.

9. List the disadvantage of insulin obtained from the pancreas of slaughtered cows and pigs.
i) Insulin being a hormone is produced in very little quantity in the body of cattle. Therefore, large
numbers of cattle need to be sacrificed for obtaining small quantities of insulin due to increasing the
cost of insulin.
ii) Slaughtering of animals is also not ethical practice.
iii) Insulin, extracted from animal sources, differs from the human insulin and it may have serious health
problems in long run due to allergic response of body and other types of reactions to foreign protein
may results into other types of complications in patients.
iv) There is possibility of slaughtered animals being infested with some infectious microorganism which
may contaminate insulin.

Hreen Qark, Okl Q & A [VOLUME - II]

 65

ZOOLOGY
HUMAN HEALTH AND DISEASES

2 MARK QUESTIONS:
1. What measures would you take to prevent water-borne diseases?
i) Underground disposal of human feces.
ii) Periodic cleaning and disinfection of water sources.
iii) Use of boiled water to kill the pathogens.
iv) Consumption of clean drinking water.

2. Name the primary and secondary lymphoid organs.

a) Primary lymphoid organs = Bone marrow and thymus.
b) Secondary lymphoid organs = Spleen, lymph nodes, tonsils, Peyer's patches, etc.

3. What are the various routes by which transmission of human immunodeficiency virus takes place?
Various modes of transmission of HIV are sexual intercourse; use of contaminated hypodermic needles
and syringes; blood transfusion; organ transplantation; artificial insemination; from infected mother to
baby during parturition (30%) and breast feeding.

4. How is a cancerous cell different from a normal cell?

i) Cancer cells undergo uncontrolled growth and uncontrolled mitotic division of cells.
ii) Cancer cells do not show contact inhibition as found in normal cells.
iii) Cancer cells lead to the formation of tumor (also called neoplasm)
iv) These have less survival capability than the normal cells.
v) These cells have high invasiveness

5. Explain what it meant by metastasis.

The cancerous cells of malignant tumor initially show slow growth called the latent stage, but later their
growth becomes very rapid causing over-crowding and damage to the normal cells. This phase of
secondary rapid growth of cancer cells is called metastasis. In this, the cancer extends to the
neighbouring tissues like the roots of a tree. Small pieces of primary tumor break off and are carried to
other parts of the body by the blood or lymph, where these form the secondary tumors.

Hreen Qark, Okl Q & A [VOLUME - II]

 66

6. List the harmful effects caused by alcohol/drug abuse.

a) Harmful effects of alcohol :
i) Alcohol has anaesthetic effect and intoxication on cerebrum and cerebellum of brain due to
which alcoholic suffers from loss of judgement, will power, emotional control, visual problems,
antisocial behaviour, incoherent speech, staggering gait, neuritis, etc.
ii) Gastritis and peptic ulcer as alcohol causes increased secretion of HCl.
iii) Cirrhosis of liver in which liver becomes hard and dry. Liver becomes store house of fats.
iv) Increased deposition of fats on the walls of blood vessels which causes increased blood pressure
and cardiomyopathy.
b) Harmful effects of drugs :
i) Opiates act as depressant and the excess consumption of opiates may cause death due to blockage
of respiration.
ii) Stimulants like amphetamines impair vision and judgement of distance.
iii) Over dose of cocaine may cause death due to cardiovascular or respiratory failure.
iv) LSD is most dangerous hallucinogen which is known to cause chromosomal and foetal
abnormalities.

7. Why is that once a person starts taking alcohol or drugs, it is difficult to get rid of this habit?
Discuss it with your teacher.
Initially, one may be motivated to take alcohol or drugs by many causes like peer pressure, liking of
taste, desire for excitement, advertisements, false belief of enhanced performance etc. but the regular
consumption of alcohol or drugs develops dependency on it called addiction. Then if alcohol or drug is
not available to an addict, then he/she start showing certain unpleasant characteristics cal1ed withdrawal
symptoms.

8. Where are B-cells and T-cells formed?

In humans, B-cells are differentiated in lymphoid tissues of tonsils, peyer’s patches, etc., while T-cells
are differentiated in thymus gland.

9. Many microbial pathogens enter the gut of humans along with food. What are preventive barriers
to protect the body from such pathogens? What type of immunity do your observe in this case?
i) Mucus of goblet cells of gut acts as physical barrier and traps the microbes going inside along with
food.
ii) Saliva of salivary glands contains lysozyme which kills the germs.
iii) HCI of oxyntic cells of gastric glands of stomach also kills the bacteria.
iv) Bile of liver prevents the growth of bacteria in intestine. These collectively form Innate immunity.

Hreen Qark, Okl Q & A [VOLUME - II]

 67

10. If a regular dose of drug or alcohol is not provided to an addicted person, he shows some
withdrawal symptoms. List any four such withdrawal symptoms.
Commonly observed withdrawal symptoms are: anxiety, nausea, muscular twitching, sweating,
nervousness, epilepsy, etc.

11. Lymph nodes are secondary lymphoid organs. Explain the role of lymph nodes in our immune
response.
i) These contain phagocytes which remove microorganisms.
ii) These contain macrophages which remove cellular debris.
iii) These contain lymphocytes which, when stimulated, form antibodies.
iv) These also destroy cancer cells.

12. Name and explain two types of immune responses in humans.

Humoral immune system is formed of antibodies produced by B-lymphocytes and protects the body
from those bacteria and viruses which enter the blood and lymph, while cell-mediated immune system is
formed of T-lymphocytes which kill the microbes or reject the allografts or autoantigens.

13. Define antigen and antibody with a suitable example of each.

Any animate or inanimate substance which, when enters the body, is capable of stimulating an
inflammatory response is called antigen. It has a specific site for attaching to specific site of antibody
and is called epitope e.g. infectious organisms and vaccines. Antibodies are defensive proteins which
provide immunity and are capable of neutralisation or agglutination or lysing or precipitation or
opsonisation of antigens. each antibody has a specific site for binding antigen and is called Paratope e.g.
IgA, IgE, IgG, etc.

14. Why is using tobacco in any form injurious to the health?

Tobacco is used for smoking, chewing and snuffing. It has in it a poisonous, volatile alkaloid nicotine
which causes addiction. Tobacco smoke also contains carbon monoxide. Continuous use of tobacco in
any form may cause many diseases in humans, e.g., cancer, cough and bronchitis, changes in blood
pressure etc.

15. Explain how narcotic drug addiction leads to rapid spread of AIDS.
Many drug addicts use the same injection needle to inject narcotic drugs into their bodies. So, if any one
of the drug addicts is having HIV, then it will be transferred to all other addicts through the infected
injection needle. In this way, AlDS will spread rapidly.

Hreen Qark, Okl Q & A [VOLUME - II]

 68

16. Why does a doctor administer tetanus antitoxin and not a tetanus vaccine to a child injured in
roadside accident with a bleeding wound? Explain.
Doctor administers tetanus antitoxin to a child injured in a road side accident with a bleeding wound, so
that his body is quickly able to interact with pathogens (antigens) and destroy them with antibodies.

17. Why is that once a person starts taking alcohol or drugs, it is difficult to get rid of this habit?
Discuss it with your teacher.
Once a person starts taking alcohol or drugs, he becomes addict to these substances physically and
mentally. Whenever, he tries to get rid of this habit, he shows unpleasant withdrawal symptoms and
these include vomiting, diarrhoea, shivering, twitching, perspiration, abdominal and muscular cramps,
etc. Therefore it becomes difficult to get rid of this habit.

18. In which way the study of biology has helped us to control infectious diseases?
Study of biology has helped us to know about causes of diseases, carriers of diseases (vectors), effects of
diseases on different body functions and above all means to control diseases.

19. What is interferon? How does it defend the body?

Interferon is protein ' that appears in the plasma during viral infections. It is released from infected cells
and inhibits the growth of viruses. Interferon contributes to immunity as it can enter uninfected cells and
render them immune to viral infections.

20. Explain briefly the different types of organ transplantation.

Organ transplantation is of four types:
a) Autograft: It is grafting of one’s tissue to another part of the body, e.g., skin graft. It is most
successful transplantation.
b) Isograft: It is transplantation from a twin brother or sister that is, donor and recipient are generally
identical.
c) Allograft: It is the transplantation between individuals of same species, but with different genetic
background.
d) Xenograft: It is transplantation between animals of different species.

21. a) Write the scientific names of the two species of filarial worms causing filariasis.
b) How do they affect the body of infected person(s)?
c) How does this disease spread?
Hreen Qark, Okl Q & A [VOLUME - II]
 69
a) Wuchereria bancrofti and Wuchereria malayi.
b) Filariasis is a condition most often caused by an obstruction of the lymphatic vessels, which results
in extreme swelling of the skin and tissues, typically in the lower trunk, and body. It primarily
affects the legs and genitals, resulting in baggy, thickened and, ulcerated skin, along with fever and
chills.
c) The pathogens are transmitted to a healthy person through the bite by the female mosquito vectors.

3 MARK QUESTIONS:
1. In the figure, structure of an antibody molecule is shown. Name the parts A, B and C. Shown the
diagram.

A= Variable region of heavy chain.

B = Constant region of light chain.
C = Heavy chain.

2. Do you consider passive smoking is more dangerous than active smoking? Why?
Passive smoking is the inhalation of tobacco-smoke containing air by the non-smokers which is exhaled
by active smokers. It is more dangerous than active smoking because active smokers inhale only 10% of
smoke produced and release about 90% of the smoke which is inhaled by the non-smokers.

3. Harmful allele of sickle cell anaemia has not been eliminated from human population. Such
affected people derive some other benefit. Discuss.
Sickle cell anaemia occurs when the recessive (semilethal) gene is in homozygous condition (Hbs Hbs).
Such persons die before the sexual maturity. But the heterozygotes can transmit the defective gene to
the progeny, the chances of which are high because the heterozygotes are resistant to malarial pathogen-
Plasmodium, while normal persons (HbA HbA) are sensitive to plasmodium.

Hreen Qark, Okl Q & A [VOLUME - II]

 70

4. The outline structure of a drug is given below:

a) Which group of drugs does this represent?
b) What are the modes of consumption of these drugs?
c) Name the organ of the body which is affected by consumption of these drugs.

a) Cannabinoid molecule.
b) By smoking or oral ingestion.
c) Cannabinoids generally affect the cardio-vascular system of body

5. Diseases like dysentery, cholera, typhoid etc. are more common in over-crowded human
settlements. Why?
Over-crowded human settlements are generally with unhygienic conditions due to heaps of garbage,
improper disposal of human and animal excreta, stagnant water sources, etc. and these conditions
increase the chances of spread of infectious diseases like cholera, typhoid, TB, etc.

6. In the metropolitan cities of India, many children are suffering from allergy/asthma. What are the
main causes of this problem? Give some symptoms of allergic reactions.
In the metropolitan cities more children are suffering from the allergy/asthma due to high level of air
pollutants especially Suspended Particulate Matter (SPM) produced by the rapid increase in vehicles.
Metropolitan children are more sensitive to allergens due to protected environment provided early in life.
Allergy is characterised by hypersensitivity of the body to the allergens and is characterised by sneezing,
watery eyes, running nose, difficulty in breathing, irritation of throat and trachea, skin rashes, etc.

7. What is the basic principle of vaccination? How do vaccines prevent microbial infections? Name
the organism from which Hepatitis-B vaccine is produced.
Vaccine has antibody-generating agents which may have killed germs or attenuated live germs or
inactivated toxins having antigenicity and called Toxoid or readymade antibodies.
a) Vaccination is based on the property of "memory" of the immune system.

Hreen Qark, Okl Q & A [VOLUME - II]

 71
b) When a vaccine is injected, it generates the primary immune response of low intensity but also
produces memory B-and T-cells. When the person is given the same vaccine for second time, the
existing memory cells recognize the antigen and initiate a very quick secondary immune response of
high intensity by producing large number of antibodies.
c) Hepatitis-B vaccine has been produced from yeast by recombinant DNA technique.

8. What are recombinant DNA vaccines? Give two examples of such vaccines. Discuss their
advantages'
i) Vaccines produced by genetic engineering (or recombinant DNA technique) are called recombinant
DNA vaccines or second generation vaccines.
ii) Examples:
a) Hepatitis-B vaccine produced from transgenic yeast and is effective against hepatitis.
b) Spf 66 vaccine produced from Plasmodium falciparum against malaria.
c) Anthrax vaccine.
iii) By recombinant DNA techniques, the vaccines can be produced on larger scale so providing greater
availability for immunisation.

9. A disease caused by a protozoan parasite and spread through mosquitoes is prevalent in tropics.
Give its name, symptoms, treatment and its control measures.
a) Causative agent Malaria is caused by protozoan parasites of the genus Plasmodium. Malaria caused
by plasmodium falciparum is the most serious and can be fatal one. Their primary hosts and
transmission vectors are female mosquitoes of genus Anopheles; humans act as intermediate hosts.
b) Symptoms: Chills, shivering, recurring fever every 3rd or 4th day, increase in pulse and respiration
rates, sweating and anaemia.
c) Prevention and control:
i) Destruction of mosquito by spraying DDT or malathion.
ii) Killing the larvae and pupae by spraying surface of ponds with kerosene oil or with some
insecticide,
iii) Eradication of mosquito breeding grounds by draining/ filling ditches and puddles,
iv) In places where there is malaria, people should sleep under mosquito nets,
v) The method for avoiding malaria is to take drugs that protect against the disease. These drugs kill
parasites as soon as they enter the bloodstream. Effective drugs for treatment of malaria are
quinine, chloroquine, primaquine etc.

Hreen Qark, Okl Q & A [VOLUME - II]

 72

10. Discuss the various methods employed in treatment of cancer.

Cancer is currently treated either singly or combining two or more of the following processes:
a) Surgery: Benign tumor can be completely removed by surgery. Preliminary goal of the surgery is to
remove either the tumor, or the entire organ. Removal of the breast cancer tumor is called
mastectomy, and that of prostate tumor is called prostatectomy. Surgery is not possible during
metastasis.
b) Radiotherapy: Also called radiation therapy, it involves the use of ionizing radiation externally via
external beam radiotherapy (EBRT) or internally via brachytherapy to kill cancer cells and reduce
the size of the tumors.
c) Chemotherapy: It involves treatment with anticancer drugs. However, there may be side effects
leading to hair loss, etc.
d) Immunotherapy: In this, the proteins encoded by oncogenes are inhibited. It induces the patien’t own
immune system to fight the tumor, α-lnterferon can be used to activate the immune system.

11. Why is secondary immune response more intense than primary immune response in humans?
The presence of memory cells makes the secondary response much faster than the primary response. In
the secondary response, as in the primary response, IgM is produced before IgG. However, IgM is
produced in smaller quantities over a shorter period, and IgG is produced sooner and in much larger
quantities than in the primary response. Thus, the secondary response is characterized by a rapid increase
in antibodies, most of which are lgG.

5 MARK QUESTIONS:
1. Innate immunity consists of the four types of barriers. What are they? Explain with suitable
examples.
Innate immunity consists of the following four types of barriers:
a) Physical barriers: These barriers obstruct the entry of pathogens into the body. They consist of skin
and the mucous membranes. The skin provides a physical barrier to the entry of pathogens. The
tough, outer layer of dead cells contains keratin and very little water, which microorganisms need for
growth. Microorganisms rarely penetrate the healthy skin. Mucus is a sticky secretion produced by
goblet cells that line the air passages. Microorganisms and undesirable particles get caught up in
mucus and are carried by the beating cilia towards the glottis and then to throat where they are
swallowed. Coughing and sneezing help to expel foreign bodies from the respiratory tract.
b) Physiological barriers: Factors like body temperature, pH and diverse body secretions, check the
growth of many pathogenic microorganisms For example, fever response inhibits growth of
numerous pathogens. The acid in the stomach kills many bacteria that come in with food and from
the breathing tract. Lysozyme present in secretions, such as tears, catalyses the hydrolysis of
molecules in the cell walls of bacteria, and interferon induces antiviral state in non-infected cells.
Hreen Qark, Okl Q & A [VOLUME - II]
 73
c) Cellular-barriers: Phagocytosis is a significant mechanism of innate immunity. In response to
pathogenic infections, the total count of leukocytes increases sharply. Phagocytosis is carried out by
white blood cells called phagocytes. particular types of leukocytes (WBC) of our body like
polymorpho-nuclear leukocytes (PMNL-neutrophils) and monocytes and natural killer (type of
lymphocytes) in the blood as well as macrophages in tissues can phagocytose and destroy microbes.
d) Cytokine barriers: Virus infected cells secrete proteins called interferon which protect non-infected
cells from further viral infection.

2. Write an explanatory note on drug addiction.

Psychological and physiological dependence of an individual to the intake of certain drugs is called drug
addiction. Drug addiction is a state of periodic or chronic intoxication detrimental to the individual and
to the society. It is produced by repeated consumption of a drug. Drug addiction has two components:
physical dependency, and psychological dependency. Physical dependency occurs when a drug has been
used habitually and the body has become accustomed to its effects. The person must then continue to
use the drug in order to feel normal, or its absence will trigger the symptoms of withdrawal.
Psychological dependency occurs when a drug has been used habitually and the mind has become
emotionally reliant on its effects, either to elicit pleasure or relieve pain, and does not feel capable of
functioning without it. Its absence produces intense cravings, which are often brought on or magnified
by stress. A dependent person may have either aspects of dependency, but often has both.
If a drug addict stops taking a drug (abstinence), his body ceases to function normally (physical
dependence). A whole complex of unlikable withdrawal symptoms and rebound are experienced. The
withdrawal symptoms may range from mild tremors to convulsions, severe agitation and fits, depending
on the type of drug abused. In some cases, withdrawal symptoms can be very severe and even life
threatening, and the person may need medical supervision during the withdrawal period. Drug abuse is
on the rise among the youth due to several factors, like tension and peer group pressure.

3. List the various harmful effects which alcohol abuse may have.
Alcoholism is the consumption of or preoccupation with alcoholic beverages to the extent that this
behaviour interferes with the alcoholic’s normal personal, family, social or work life.
Effects of alcoholic drinks on health.
a) alcohol generates more energy, mostly in the form of heat, but at the same time, it dilates the blood
vessels. Consequently, the heat generated is rapidly lost. Due to constant dilation, the arterial walls
soon become brittle and rigid. Such a change in the property of blood vessels and deposition of
alcoholic fat affect the working of the heart.

Hreen Qark, Okl Q & A [VOLUME - II]

 74
b) In a chronic alcoholic the axons of the nerve inflame, thus causing neuritis.
c) Alcoholism leads to gastric ulcers and gastritis.
d) Permanent damage to liver cells occurs due to the depositions of fat. The liver dries up and hardens.
Damaged liver also affects other body organs.
e) The users of alcohol neglect their health and soon the body loses its resistance to infections. the
alcoholics are victims of malnutrition and are easily susceptible to diseases like pneumonia.

4. Describe the asexual and sexual phases of life cycle of Plasmodium that causes malaria in humans.
Asexual phase of life cycle of Plasmodium occurs in humans. It takes place as:
When the infected mosquito bites a healthy human, the infective stage of Plasmodium is injected into
the human blood. The infective stage is called sporozoite. Sporozoites reach the liver through blood. The
parasite (sporozoites) reproduces asexually in liver cells, bursting the cell and releasing into the blood.
Parasites enter the red blood cells and reproduce asexually there by bursting the red blood cells and
cycles of fever and other symptoms. Released parasites infect new red blood cells. Sexual stages
(gametocytes) develop in red blood cells.
Sexual phase of life cycle of Plasmodium occurs in female anopheles mosquito. It takes place as:
Female mosquito takes up gametocytes with blood meal. Fertilisation and development take place in
the mosquito’s stomach. The zygote elongates and becomes motile structure called ookinete. The
ookinete moves and bores through the wall of the stomach of female Anopheles mosquito. The ookinete
changes to oocyst on the surface of the stomach. Inside the oocyst, sporozoites are formed which are
released in the body cavity of the mosquito. Mature sporozoites move to different organs of the body
cavity but many of them penetrate salivary glands of the mosquito. When the female Anopheles
mosquito bites a healthy person, the sporozoites are injected into the blood along with saliva.

Hreen Qark, Okl Q & A [VOLUME - II]

 75

ORGANISMS AND POPULATION

2 MARK QUESTIONS:
1. Define population and community.
Population is defined as the total number of individuals of a species in a specific geographical area
which can interbreed under natural conditions to produce fertile offsprings and share a common gene
pool.
Community is the assemblage of all the populations of different species found in the same
geographical area.

2. What does nature’s carrying capacity for a species indicate?

Nature’s carrying capacity for a species indicate that a given habitat has enough (limited) resources to
support a maximum possible number and there is no further growth in population is possible.

3. Construct an age pyramid which reflects a stable growth status of human population.

Post-reproductive
Reproductive
Pre-reproductive

4. How does a monarch butterfly defend itself from predators? Explain.

The monarch butterfly is highly distasteful to its predators because of a chemical present in its body.
It has acquired it at the caterpillar stage by feeding on a poisonous weed.

5. List the attributes that populations, but not individuals possess.

The attributes that populations but not individuals possess are :
i) Population density
ii) Population growth
iii) Mortality or death rate
iv) Natality or birth rate
v) Sex ratio
vi) Age distribution

Hreen Qark, Okl Q & A [VOLUME - II]

 76

6. Why has life history of variation evolved?

Life history of variation has evolved. In order to maximize reproductive fitness of individual.

7. State Gause’s Competitive Exclusion principle.

Gause’s Competitive Exclusion Principle states that two closely related species competing for same
resources, cannot coexist indefinitely, (the inferior will be eliminated) by the superior one. It is true
when resources are limited.

8. Give two reasons as to why a weed such a Calotropis flourishes in abandoned fields.
Calotropis flourishes in abandoned fields because of :
i) It has dry hairy seeds which help in dissemination
ii) It has xerophytic adaptations like thick hair on leaves and stems.
iii) It is not grazed by animals as it produces poisonous substances like cardiac glycosides.

9. Why are cattle and goats not seen browsing on Calotropis growing in the fields?
Calotropis produces highly poisonous cardiac glycosides. Therefore, cattle and goats do not browse on
them.

10. If 8 individuals in a laboratory population of 80 fruit flies died in a week, then what would be the
death rate of population for the said period?
Number of individuals dead 8
Death rate = = = 0.1
Total number of individual 80
The death rate will be 0.1 individuals per week.

11. In a pond there were 20 Hydrilla plants. Through reproduction 10 new Hydrilla plants were
added in a year. Calculate the birth rate of the population.
Number of individuals born 10
Birth rate = = = 0.5
Total number of individual 20
Birth rate is 0.5 plants per year.

12. What does sigmoid growth curve of a population indicate?

Sigmoid growth curve of a population indicates following characteristics :
i) Initially the growth is slow.
ii) The growth becomes rapid and the curve becomes steady due to environmental resistance.

Hreen Qark, Okl Q & A [VOLUME - II]

 77

13. Pollinating species of wasps show mutualism with specific fig plants. Mention the benefits the
female wasps derive from the fig trees from such an interaction.
The wasp uses the fruit as oviposition, i.e., egg laying and the developing seeds for nourishing its larvae.

14. Name two basic types of competition found amongst organisms. Which one of them is more
intense and why?
The two basic types of competitions are :
i) Interspecific competition
ii) Intraspecific competition
The intraspecific competition is more intense because the requirement of the individual of the species
are similar.

15. a) Label the three tiers 1, 2, 3 given in the above age pyramid.
b) What type of population growth is represented by the above age pyramid?

a) 1 represents Pre-reproductive age group

2 represents Reproductive age group
3 represents Post-reproductive age group
b) Expanding population.

16. a) What is “r” in the population equation given : dN / dt = rN?

b) How does the increase and the decrease in the value of ‘r’ affect the population size?
a) ‘r’ is called intrinisic rate of natural increase.
b) Population size increases with increase in ‘r’ and it decreases with decrease in ‘r’.

17. Identify the curves ‘a’ and ‘b’ shown in the graph given below. List the conditions responsible for
growth patterns ‘a’ and ‘b’.
Curve ‘a’ is exponential growth curve. When the resources (food +
space) are unlimited, this type of growth curve appears.
Curve ‘b’ is logistic growth curve. When the resources become
limited at certain point of time, this type of growth curve appears.

Hreen Qark, Okl Q & A [VOLUME - II]

 78

18. Why do clown fish and sea anemone pair up? What is this relationship called?
The clown fish gets protection from predators which stay away from stinging tentacles of anemone but
anemone does not derive any benefit from the fish. This relationship is called commensalism.

3 MARK QUESTIONS:
1. List the attributes that populations possess but not individuals.
A population can be defined as a group of individuals of the same species residing in a particular
geographical area at a particular time and functioning as a unit. It has some attributes which are not
shown by its individual members. An individual may have births and deaths whereas the population
has a birth rates and a death rates.
Each population has a certain pattern of distribution, variation in numbers, age structure, Natality
(birth rate), mortality (death rate), dispersal, biotic potential, growth forms, and sex ratio. All these
attributes are not possessed by individuals. Further, a population has a gene pool shared by its
members.

2. An orchid plant is growing on the branch of mango tree. How do you describe this interaction
between the orchid and the mango tree?
An orchid growing on the branch of a mango tree is an epiphyte. Epiphytes are those plants which
grows on other plants and do not derive nutrition from them.
Therefore, they both show the inter-specific interaction and considered as an example of
commensalism where one species gets benefited while the other remains unaffected.
Orchid derives the benefit of habitat only but derives no nutrition from the mango tree. The mango
tree is neither benefitted nor harmed.

3. What is the ecological principle behind the biological control method of managing with pest
insects?
Biological control method adopted in the management of agricultural pest insects is based on the
principle of predation.
Predation is a biological interaction between the predator and the prey, whereby the predator feeds
on the prey. Hence, the predators regulate the population of preys in a habitat, thereby helping in the
management of pest insects.
Example, control of mosquito larvae in the water bodies by Gambusia fish; and control of aphids by
lady bird beetles.

Hreen Qark, Okl Q & A [VOLUME - II]

 79

4. Predation is usually referred to as a detrimental association. State any three positive roles that a
predator plays in an ecosystem.
Three positive roles that a predator plays in an ecosystem are as follows:
It keeps prey population (phytophagous /herbivores/carnivore) under control.
It maintains ecological balance and species diversity.
It acts as conduit for energy transfer.

5. a) Write the importance of measuring the size of a population in a habitat or an ecosystem.

b) Explain with the help of an example, how the percentage cover is a more meaningful measure
of population size than more numbers.
a) The study tells about the status of the population. A change in the population size can indicate the
outcome of competition with another species, the impact of a predator or the effect of a pesticide
application.
b) The per cent cover is a more meaningful measure of population size, in case of a single huge banyan
tree with a large canopy in an area where 200 small plants like Parthenium are present.
In such a case, stating that the population density of banyan is low is underestimating the
enormous role of the banyan tree in the community.

6. a) Explain ‘birth rate’ in a population taking a suitable example.

b) Write the two characteristics which only a population shows but an individual cannot.
a) Birth rate refers to the per capita births in a population at a given time.
In a pond has 20 lotus plants on a particular date and 8 new plants are added by reproduction in one
year, the birth rate is 8/20 = 0.4, i.e. 0.4 plant per lotus plant in a year.
b) Death rate, Sex ratio

7. Explain Verhulst-Pearl Logistic Growth of a population.

According to Verhulst-Pearl Logistic growth, a population growing in a habitat with limited resources
initially shows a lag phase, followed by phases of acceleration and deceleration and finally an asymptote
when the population density reaches the carrying capacity. It is given by the following equation :
dN K − N
= rN 
dt  K 
Where, N = population density at time t,
r = intrinsic rate of natural increase,
K = carrying capacity.

Hreen Qark, Okl Q & A [VOLUME - II]

 80

8. Co-evolution is a spectacular example of mutualism between an animal and a plant. Describe co-
evolution with the help of an example.
(or)
Describe the mutual relationship between fig tree and wasp and comment on the phenomenon that
operates in their relationship.
Co-evolution can be observed in Fig(plant) and wasp (animal). The female wasp uses the fruit for
oviposition or egg laying. It also uses developing seeds within the fruit for nourishing its larvae. The
wasp in turn pollinates the fig inflorescence. The given Fig species can be pollinated by its ‘partner’
wasp species and no other species.

9. Egrets are often seen along with grazing cattle. How do you refer to this interaction? Give a
reason for this association.
The interaction between them can be referred to as commensalism. Egrets always forage close to where
the cattle are grazing because the cattle, as they move stir up and flush out insects from the vegetation
which otherwise might be difficult for the egrets to find and catch.

10. Explain brood parasitism with the help of an example.

Kocl is a parasitic bird (which has lost the instinct to make its own nest to lay eggs), has evolved the
technique of laying eggs in the nest of a crow.
Its eggs bear resemblances to those of crow.

11. Explain parasitism and co-evolution with the help of one example of each.
Mode of interaction between two species in which one species (parasite) depends on the other species
(host) for food and shelter is called parasitism. In this one organism is benefitted and the other is
harmed.
For example, Human liver fluke or Malarial parasite or Cuscuta.
Co-evolution is the relationship between two interacting organisms where an organisms fails to survive
in the absence of the other.
For example, Fig and fig wasp or Ophrys and bumble bee.

12. What is mutualism? Mention any two examples where the organisms involved are commercially
exploited in agriculture.
Interaction between two species in which both are benefited is called mutualism.
i) Rhizobium in the roots (nodules) of legumes.
ii) Mycorrhiza → Glomus living with the roots of higher plants.

Hreen Qark, Okl Q & A [VOLUME - II]

 81

13. How does the Mediterranean orchid Ophrys ensure its pollination by bees?
The petals of the Ophrys resembles the female of a bee species in size, colour and odour, etc. Male bee
mistakes the Ophrys for female bee and tries to copulate. Few pollen grains adhered with the body of
the male bee fall over stigma of the flower thereby leading to pollination.

14. How do plants benefit from having mycorrhizal symbiotic association?

Mycorrhizal association is found between fungi and the roots of higher plants. The fungi help the plant
in the absorption of essential nutrients from the soil while plant in turn provides energy-yielding
carbohydrates to fungi.

15. An organic farmer relies on natural predation for controlling plant pests and diseases. Justify
giving reasons why this is considered to be a holistic approach.
Besides acting as ‘conduits’ for energy transfer across trophic levels, predators are used in biological
control of plant pests. This ability of the predator is based on its regulating the prey population. The
natural predators reduce interspecific competition and do not harm the crop plants. For example, in an
area the invasive cactus can be brought under control by cactus-feeding predator (a moth). Using natural
predation, the ecosystem is kept stable without harming any of the trophic levels.

16. a) Write the importance of measuring the size of a population in a habitat or an ecosystem.
b) Explain with the help of an example how the percentage cover is a more meaningful measure of
population size than mere numbers.
a) By measuring the size of a population, following can be predicted :
i) Status of the population in a habitat.
ii) Outcome of competition with other species.
iii) Impact of predator or pesticides.
iv) Increase or decrease of population size.
v) Effect of pesticide application
b) Example : Banyan tree and Parthenium plants.
When 1 banyan tree is compared with 100 Parthenium plants, the population of banyan in terms of
number is very much low as compared to Parthenium. But in terms of percentage cover or biomass,
the banyan tree provides a much larger cover in comparison to 100 Parthenium plants. Thus, the
percentage cover or biomass is a more meaningful measure of population size.

17. Study the graph given alongside and answer the questions which follow :
i) The curve ‘b’ is described by the following equation :
dN K − N 
= rN  
dt  K 
What does ‘K’ stand for in this equation? Mention its significance.

Hreen Qark, Okl Q & A [VOLUME - II]

 82

ii) Which one of the two curves is considered a more realistic one for most of the animal
populations?
iii) Which curve would depict the population of a species of deer if there are no predators in the
habitat? Why is it so?

i) ‘K’ stands for carrying capacity. Carrying capacity is defined as the maximum number of
individuals of a population that can be sustained by the given habitat / environment.
ii) Curve ‘b’ is more realistic.
iii) Curve ‘a’. When the predators are absent, the prey population grows exponentially.

18. When do you describe the relationship between two organisms as mutualistic, competitive and
parasitic? Given one example of each type.
Mutualism is referred to as the interspecific interaction in which both the interacting species are
benefited from each other. For example, lichens represent close association between fungus and Algae.
Competition is a type of interaction due to limited resources between closely related species where they
compete for the same resource and both species suffer. For example, In South American lakes, visiting
flamingos and resident fishes compete for zooplanktons.
Parasitism is the mode of interaction between two species, in which one species (parasite) depends on
the other species (host) for food and shelter, and in the process damages the host. For example, human
liver fluke depends on two hosts, a snail and a fish, to complete its life cycle.

19. Name the type of interaction seen in each of the following examples :
i) Ascaris worms living in the intestine of humans
ii) Wasp pollinating fig inflorescence
iii) Clown fish living among the tentacles of sea-anemone
iv) Mycorrhizae living on the roots of higher plants
v) Orchid growing on a branch of a mango tree
vi) Disappearance of smaller barnacles when Balanus dominated in the coast of Scotland

Hreen Qark, Okl Q & A [VOLUME - II]

 83

Answer :
i) Parasitism
ii) Mutualism
iii) Commensalism
iv) Mutualism
v) Commensalism
vi) Competition

20. Comment on the following diagrams :

A, B, C, D, G, P, Q, R, S are species.

Figure I :
It is a single population and all individuals are of the same species, i.e., A individuals interact among
themselves and their environment.
Figure II :
It is a community and it contains three populations of species A, B and C. They interact with each other
and their environment.
Figure III :
It is a biome. It contains three communities. All three communities are in the same environment and
they interact with each other and their environment.

4 MARK QUESTIONS:
1. A population of Paramecium caudatum was grown in a culture medium. After 5 days the culture
medium become over crowd with paramecium and had depleted nutrients.
What will happen to the population and what type of growth curve will the population attain?
At first, after a lag phase (phase during which little or no growth takes place due to small size of
population and lack of adaptation) the population will grow in an exponential manner due to
abundant space and nutrients.

Hreen Qark, Okl Q & A [VOLUME - II]

 84
When the food sources get exhausted, the population density starts decreasing and ends in an
asymptote phase, after that population density reaches the carrying capacity (maximum number of
individuals of a population or species that a given environment can sustain indefinitely)
The population shows a pattern of logistic growth curve giving an S-shaped (sigmoidal) curve.
Where,
K = carrying capacity
N= population density at time ‘t’
r = Intrinsic rate of natural increase

5 MARK QUESTIONS:
1. a) List any four characters that are employed in human population census.
(or)
b) i) Represent diagrammatically three kinds of age-pyramids for human populations.
ii) How does an age pyramid for human population at given point of time helps the policy-
makers in planning for future.
a) A population has the following characteristics that are employed in human population census.
i) Natality and mortality: Natality is the production of new individual of any organisms per unit of
population per unit time whereas mortality is the rate of death of individuals per unit time.
ii) Sex ratio: It is the proportion of males to females in a given population, usually expressed as the
number of males per 100 females at a specific stage in life.
iii) Population density: It is number of individuals of a species per unit area or space at a given time.
iv) Age distribution: It is the number or percentage of individuals in a population in different age
group.
b) i)

(Pyramid-shaped) (Bell-shaped) (Urn-shaped)

ii) Planning of health/ education / transport / infrastructure / finance / food / employment can depend
on the age pyramid analysis of a population.

Hreen Qark, Okl Q & A [VOLUME - II]

 85

2. a) Explain any two defence mechanisms plants have evolved?

b) How does predation differ from parasitism?
a) Defence mechanisms plants have evolved against their predators are thorns and chemicals.
Thorns: These are modified shoot which plants evolved for their self defence against predation
because of their prickly nature.
Chemicals: It produces chemicals which inhibit digestion / disrupts reproduction / kill the
predators. For example, calotropis produces highly poisonous cardiac glycosides / plants may
produce chemicals such as nicotine / caffeine /quinine / strychnine / opium are produced as
defence.
b) The difference between parasitism and predation is that, in parasitism, the parasites remain associated
with the host for obtaining food and shelter whereas, in predation, the prey and predator are free
living from one another. Predator’s survival depends on its ability to catch its prey whereas prey’s
survival depends on its ability to avoid being caught.

3. The following diagrams are the age pyramids of different populations. Comment on the status of
these populations.

i) Figure A : It is a triangular shaped age pyramid, In this figure, the base, that is, pre-reproductive
stage is very large as compared with the reproductive and post-reproductive stages of the population.
This type of age structure indicates that the population would increase rapidly. The rate of growth
depends upon the size of pre-reproductive population.
ii) Figure B: It is an ‘inverted bell’ shaped pyramid. In this figure, the number of pre-reproductive and
reproductive stage is same. Post-reproductive individuals are comparatively fewer. The population
size remains stable, neither growing nor diminishing. This type of age structure indicates that the
population is stable.
iii) Figure C : It is ‘urn’ shaped pyramid. In this figure, the number of individuals in pre-reproductive
and reproductive stages are less than the post-reproductive stages of this population. In this
population more older people are present. This type of age structure indicates that the population is
definitely declining.

Hreen Qark, Okl Q & A [VOLUME - II]

 86

4. a) Compare giving reason, the J-shaped and S-shaped models of population growth of a species.
b) Explain “fitness of a species” as mentioned by Darwin.
a) Difference between J-shaped growth curve and S-shaped growth curve.
S.No J shaped-growth curve S shaped-growth curve
i) Resource are unlimited Resources are limited
ii) Growth is exponential Logistic Growth
iii) As resources are unlimited all Fittest individual will survive and
individuals survive and reproduce. reproduce
iv) Growth Equation dN/dt=rN Growth Equation dN/dt=rN (K-N/K)
b) When resources are limited, competition occurs between individuals, fittest will survive, who
reproduce to leave more progeny.

5. If a population growing exponentially doubles in size within 3 years, what is the intrinsic rate of
increase (r) of the population?
A population grows exponentially if sufficient amounts of food resources are available to the individual.
Its exponential growth can be calculated by the following integral form of the exponential growth
equation:
Nt = No ert
Where,
Nt = Population density after time t
NO = Population density at time zero
r = Intrinsic rate of natural increase
e = Base of natural logarithms (2.71828)
From the above equation, intrinsic rate of increase,
(r) of the population can be calculated as follows:
As per the given question
Present population density = x
Then,
population density after two years = 2x
t = 3 years
substituting these values in the given formula, we
get:
⇒2x = x e3r
⇒2 = e3r

Hreen Qark, Okl Q & A [VOLUME - II]

 87
Applying log on both sides:
⇒ log 2 = 3r log e
log 2
⇒ =r
3log e
log 2
⇒ =r
3 × 0.434
0.301
⇒ =r
1.302
⇒ 0.2311 = r
Hence, the intrinsic rate of increase for the above illustrated population is 0.2311

6. Name and explain the type of interaction that exists in mycorrhizae and between cattle egret and
cattle.
Mycorrhizae
i) These are the mutualistic association between certain fungi and roots of higher plants.
ii) Fungi help the plant in the absorption of essential nutrients from the soil and the plants provide the
fungi with energy rich carbohydrates.
Cattle egret and cattle
iii) It is a case of commensalism, an interspecific interaction in which one of the species is benefitted
and the other is neither harmed nor benefitted.
iv) In this association, the cattle egret is benefitted; the cattle, as they move, stir up the ground and flush
out the insects from the vegetation, which otherwise would be difficult for the egrets to find and
catch them

7. Define the following terms and give one example for each :
a) Commensalism b) Parasitism c) Camouflage
d) Mutualism e) Inter specific competition.
a) Commensalism : It is an interaction between two different species where one is benefited and other
remains unaffected, e.g., clown fish and sea anemone. Here, the clown fish gets protection from
predators which stay away from stinging tentacles of anemone but anemone does not derive any
benefit from fish.
b) Parasitism : It is an interaction between two organisms in which one is benefited and the other is
harmed, i.e., one organism lives at the cost of other organism. e.g., Cuscuta, a parasitic plant that is
found growing on hedge plants, do not have chlorophyll and thus derives its nutrition from the host.
c) Camouflage : It is a phenomenon of blending of an organism with the surrounding due to similar
colour, marking and shape so as to avoid the predators, e.g., leaf-like insect such as grasshopper.

Hreen Qark, Okl Q & A [VOLUME - II]

 88
d) Mutualism : It is the interaction between two species in which both organisms are benefited to
maintain the life process, e.g., lichen (association between algae and fungi). Here, fungi helps in
absorption of nutrients and water while the algal partner manufactures food.
e) Interspecific competition : It is the competition among the members of different species for limited
natural resources. The Abingdon tortoise in Galapagos Islands became extinct within a decade after
goats were introduced on the Island, apparently due to the greater browsing efficiency of the goats.

8. Study the population growth curves in the graph given below and answer the questions that follow
i) Identify the growth curves ‘a’ and ‘b’.
ii) Which one of them is considered a more realistic one and why?
dN K − N 
iii) If = rN   is the equation of the logistic growth curve, what does K stand for?
dt  K 
iv) What is symbolized by N?

i) a is exponential growth curve or J-shaped curve.

b is logistic growth curve or S-shaped curve.
ii) Logistic growth curve (b) is considered more realistic because unlimited resources are never
available in an ecosystem or in a habitat.
iii) K stands for carrying capacity.
iv) N indicates population density, which is the number of species of a population per unit area.

9. Interspecific interactions of two species of any population may be beneficial, detrimental or

neutral. Explain each of them with the help of suitable examples.
Population interactions :
Species A Species B Name of interaction
+ + Mutualism
– – Competition
+ – Predation
+ – Parasitism
+ 0 Commensalism

Hreen Qark, Okl Q & A [VOLUME - II]

 89
i) + = Beneficial; – Detrimental; 0 Neutral. Both species benefit in mutualism, e.g. lichens
ii) Both species lose in competition, Lion and Tiger (or) Deer and Rabbit.
iii) In predation the predator gets benefit but it is detrimental to the other species (host) e.g. (Lion and
deer)
iv) In parasitism the parasite gets benefits but it is detrimental to the other species (prey) e.g. (Man and
Ascaris)
v) In commensalism one species is benefitted but the other is neither harmed nor benefitted. e.g. (Sea
anemone and Clown fish)

10. a) Which of the above represents the increase or decrease of population?

b) If N is the population density at time t, then what would be its density at time (t + 1)? Give the
formula.
c) In a barn there were 30 rats. 5 more rats enter the barn and 6 out of the total rats were eaten
by the cats. If 8 rats were born during the time period under consideration and 7 rats left the
barn, find out the resultant population at time (t + 1).
d) If a new habitat is just being colonized, out of the four factors affecting the population growth,
which factor contributes the most?

a) a and d represents increase of population and b and c represent decrease of population.

b) Nt + 1 = Nt + [(B + I) – (D + E)]
c) Here, Nt = 30; I = 5; E = 7; D = 6; B = 8
Putting the value in Nt + 1 = Nt + [(B + I) – (D + E)]
Nt + 1 = 30 + [(8 + 5) – (6 + 7)]
= 30 + [13 – 13]
= 30 + 0
= 30 rats
d) Immigration contributes the most.

Hreen Qark, Okl Q & A [VOLUME - II]

 90

ECOSYSTEM

2 MARK QUESTIONS :
1. Justify the importance of decomposers in an ecosystem.
Decomposers are those heterotrophic organisms (Eg. Some bacteria and some fungi), which meet
their energy requirements by degrading dead organic matter.
By decomposing the complex organic matter into simple organic matter and ultimately into inorganic
molecules, they help in nutrient cycling.
The decomposers reduce the pollution level of water bodies.

2. a) Why is the pyramid of energy always upright?

b) State what does ‘standing crop’ of a trophic level represents.
a) Pyramid of energy is always upright because,
Only 10 percent of energy is passed on from one trophic level to the next.
During the flow of energy from one trophic level to the next, some energy is always lost as heat
at each step.
b) Standing crop of a trophic level represents the amount of living matter in a trophic level at a given
time.

3. Name the type of food chains responsible for the flow of larger fraction of energy in an aquatic and
a terrestrial ecosystem, respectively. Mention the differences between the two chains.
Grazing food chain (GFC) and Detritus food chain (DFC) responsible for the flow of larger fraction of
energy in an aquatic and a terrestrial ecosystems, respectively.
Grazing food chain Detritus food chain
It is a food chain where transfer of energy It is the food chain where transfer of
starts from producers. energy starts from detritus/decomposing
organic matter.
In aquatic ecosystems, this is the major In terrestrial ecosystems, DFC is the
conduit for energy transfer. major conduit for energy flow.

4. What is meant by the term biomass?

The term biomass may be defined as the total amount of biotic matter ( = living matter) in a specific
environment.

Hreen Qark, Okl Q & A [VOLUME - II]

 91

5. What are the different components of an ecosystem?

The ecosystem comprises of two major components, biotic and abiotic components, Biotic components
include all the living elements such as plants, animals and micro-organisms. Abiotic components
include non-living elements such as air, water, soil, temperature and humidity.

6. Differentiate between standing state and standing crop in an ecosystem.

In an ecosystem, standing crop is the mass of living material in each trophic level at a particular time.
Whereas standing state refers to the amount of nutrients in the soil at any given time.

7. How is decomposition depends on the type of substrate?

Decomposition is slow if detritus is rich in lignin and chitin. Whereas, high sugar substrate, water
soluble substances and nitrogen rich components decompose faster.

8. ‘Decomposition will be slow in anaerobic conditions. Is it true or false? Why?

True, decomposition largely requires oxygen thus it will be slow in anaerobic conditions.

9. Differentiate between a detrivore and a decomposer giving an example of each.

S.No. Detrivore Decomposer
1. They are organisms which feed on detritus They are organisms which breakdown
and break them into smaller particles, complex organic matter into inorganic
substances by secreting enzymes.
2. e.g., earthworm e.g., some bacteria and fungi

10. Define food web.

Food web is a network of natural interconnection of food chains. These food chains are interconnected
at various trophic levels, so as to form a number of feeding connections amongst different organisms of
ecosystem.

11. Why is the rate of assimilation of energy at the herbivore level called secondary productivity?
It is because the biomass available to the consumer for consumption is a resultant of the primary
productivity from plants.

12. Organisms at a higher trophic level have less energy available. Comment.
The transfer of energy follows 10% law, that is, only 10% of the energy is transferred from the lower
trophic level to higher trophic level. Hence, trophic level has less energy as compared to lower trophic
level.
Hreen Qark, Okl Q & A [VOLUME - II]
 92

13. The number of trophic levels in an ecosystem are limited. Comment.

Only 10% of the total amount of energy, generated at each level, is passed on to the next trophic level
from the previous trophic level. So, there is a decrease in the amount of energy available at the
successive trophic levels. Therefore, as we move higher up in the food chain the amount of energy
diminishes to a certain level which cannot sustain any trophic level, thereby limiting the number of
trophic levels to 3 - 4.

14. Is an aquarium a complete ecosystem?

An ecosystem has biotic and abiotic components. An aquarium has both, that is biotic and abiotic
components of an ecosystem. Hence, aquarium is a complete ecosystem.

15. What could be the reason for the faster rate of decomposition in the tropics?
In tropics the temperature and soil moisture are high and the rate of decomposition is regulated by
climatic factors like temperature and soil moisture as they have an effect on the activities of soil
microbes. Therefore, tropics climate with hot and humid climatic condition provides a conducive
environment which is ideal for the microbes to speed up the process of decomposition.

16. Flow of energy through various trophic levels in an ecosystem is unidirectional and non-cyclic.
Explain.
In ecosystem primary producers produce energy by using sun light which is subsequently used by the
consumers. The energy from the sun is utilized by the primary producers (plants) and is transferred in
the food chain through successive trophic levels following 10% energy law wherein only 10% of the
energy is transferred from one trophic level to the next successively and is never returned back. So, the
movement of energy is only in one direction from lower to higher trophic level.

17. Apart from plants and animals, microbes form a permanent biotic component in an ecosystem.
While plants have been referred to as autotrophs and animals as heterotrophs, what are microbes
referred to as? How do the microbes fulfil their energy requirements?
Microbes are known as heterotrophs and saprotrophs which cannot synthesize their food at their own.
They fulfil their energy requirement by feeding on dead remains of plants and animals through the
process of decomposition.

Hreen Qark, Okl Q & A [VOLUME - II]

 93

18. Poaching of tiger is a burning issue in today’s world. What implication would this activity have on
the functioning of the ecosystem of which the tigers are an integral part?
Ecological balance of ecosystem is disturbed by the poaching (hunting) of tiger. Tigers are the
important predator of forest as they regulate or control the population of prey. However, hunting of
tigers reduces their population which results into increase in the population of deer (prey) and increase in
the population of deer, vegetation (grass, plants, etc.) are destroyed rapidly causing ecological
disturbance.

19. In relation to energy transfer in ecosystem, explain the statement “10kg of deer’s meat is
equivalent to 1kg of lion’s flesh”.
It follows the principle of 10% of energy law, that is, only 10% energy is transferred from one trophic
level to higher trophic level. Only 10% of the energy produced by the deer is transferred to the lion
therefore, if lion feeds on deer then 10kg of deer’s meat will form 1kg of lion’s flesh.

20. Describe the inter-relationship between productivity, gross primary productivity and net
productivity.
Productivity is the rate of biomass production per unit area over a period of time.
Gross primary productivity is the rate of production of organic matter during photosynthesis in an
ecosystem.
Net productivity = (Gross primary productivity - Respiration losses).

21. What is an incomplete ecosystem? Explain with the help of suitable example.
An ecosystem is composed of biotic and abiotic components whose interaction with each other results
into a physical structure. Absence of any component will make an ecosystem incomplete as it will
hinder the functioning of the ecosystem. Examples of such an ecosystem can be a fish tank or deep
aphotic zone of the oceans where producers are absent.

22. How do you distinguish between humification and mineralization?

Humification results into accumulation of a dark coloured amorphous substance called as humus which
is highly resistant to microbial action and undergoes decomposition at an extremely slow rate. Humus,
being colloidal in nature, serves as a reservoir of nutrients. The humus is further degraded by some
microbes and the latter releases inorganic nutrients by the process of mineralization.

Hreen Qark, Okl Q & A [VOLUME - II]

 94

23. Fill in the trophic levels (1, 2, 3 and 4) in the boxes provided in the figure.

Answer :

3 MARK QUESTIONS:
1. a) What is primary productivity? Why does it vary in different types of ecosystems?
b) State the relation-between gross and net primary productivity?
a) Primary productivity is the amount of biomass or organic matter during photosynthesis by plants; it
is the amount of energy available for consumption by herbivores and decomposers.
It varies in different ecosystems because it depends on
i) The plant species inhabiting the particular area.
ii) The environmental conditions of the habitat.
iii) Availability of Nutrients.
iv) Photosynthetic capacity of the plants species.
b) Gross primary productivity (GPP) – Respitory loss (R) = Net Primary Productivity (NPP).

Hreen Qark, Okl Q & A [VOLUME - II]

 95

2. a) Differentiate between two different types of pyramids of biomass with the help of one
example of each.
b) How is ‘stratification’ represented in a forest ecosystem?
The upright pyramid and the inverted pyramid are the two types of pyramids of biomass.

Upright Pyramid of biomass Inverted pyramid of biomass

The base tier (of producers) is broad i.e the The base tier (of producers) is narrow, i.e
biomass of producers is the maximum in the the amount of biomass is less than that of
pyramid. consumers.
This type of pyramid occurs in grasslands where This type of pyramid occurs in aquatic
the biomass of the producers is much higher than ecosystems, where the biomass of
that of primary consumers. planktons is much lower and that of
primary consumers far exceeds it.

b)
Stratification refers to the vertical distribution of different species occupying different levels in
the ecosystem.
In a forest ecosystem, trees occupy the topmost vertical layer, shrubs occupy the second layer
and herbs and grasses occupy the bottom layers.

3. a) “In a food-chain, a trophic level represents a function level, not a species”. Explain.
b) Why is an earthworm called a detrivore?
a) A trophic level represents a function level and not a species for the following reasons:
i) All organisms, irrespective of species must be included or considered for any calculation of
energy content, biomass or number; for example, grasshoppers, rats and sparrows are all
consumers in an agricultural field.
ii) A particular species may occupy more than one trophic level simultaneously in a given
ecosystem, for example a sparrow is a primary consumer when it eats fruits/seeds, but is a
secondary consumer when it eats insects or worms.
iii) No generalisation can be arrived at, if we consider only a few individuals (of one species) in a
trophic level.
b) Earthworms ingest and breakdown the detritus into smaller particles; hence they are called
detritivores.

Hreen Qark, Okl Q & A [VOLUME - II]

 96

4. What are the different types of ecosystem?

Ecosystem can be classified on the basis of the nature, duration and size. They are :
On the basis of nature, an ecosystem can be classified as :
a) Natural : An ecosystem which is operating under natural conditions without any major interference
by man. For example, terrestrial (grassland, desert, forest etc.) & aquatic (ponds, lakes, streams etc.)
b) Artificial : It is the man-made ecosystems. For example, cropland, aquarium, garden, spaceship etc.
An ecosystem can be temporary or permanent. Example of temporary ecosystem are ponds in rainy
season. Permanent ecosystem, such as a forest, ocean or a lake.
Depending upon size, an ecosystem may be micro-ecosystem very small. For example, flower pot or a
site under a stone. Macro-ecosystem is very large. For example ocean, forests etc.

5. a) Explain primary productivity and the factors that influence it.

b) Describe how do oxygen and chemical composition of detritus control decomposition.
a) Primary productivity is defined as the rate of biomass or organic matter produced per unit area by
plants during photosynthesis. It is expressed in terms of weight (g m–2 yr-1) or energy (kcal m–2yr-1).
It varies in different types of ecosystems. It depends on the following factors :
i) Plant species inhabiting a particular area
ii) Environmental factors
iii) Availability of nutrients
iv) Photosynthetic capacity of plants.
b) Decomposition of detritus is slow if it contains lignin, chitin, tannins and cellulose, whereas it is
quicker if detritus is made up of nitrogenous compounds and water-soluble substances like sugars.
This is because the latter are easy to degrade.
Oxygen is required for the activity of decomposers and detritivores. Therefore, a reduced oxygen
amount will slow down the process of decomposition.

6. What are decomposers? Name two kind of decomposers.

Decomposers : These are the small organisms which obtain their food from the organic materials of dead
producers, consumers and their waste products. They decompose their organic matter into small organic
molecules and inorganic compound. Organic molecules are used by themselves and inorganic
compounds are released into atmosphere for their reuse. Bacteria and fungi are two main kinds of
decomposers.

Hreen Qark, Okl Q & A [VOLUME - II]

 97

7. Give a trophic level presentation of ecosystem.

8. Explain with the help of two examples, how the pyramid of number and the pyramid of biomass
can look inverted.
The pyramid of biomass in sea is generally inverted because the biomass of fishes far exceeds that of
phytoplankton and the number of big fishes eating the small fishes is also greater than the small ones.
Also in pyramid of number, the number of insects feeding on a big tree is far greater than the tree.

9. Taking an example of a small pond, explain how the four components of an ecosystem function as
a unit.
Productivity:
Conversion of inorganic substances into organic material with the help of radiant energy or sunlight by
the autotrophs or producers.
Decomposition:
It (for example: fungi) breaks down dead and decayed organic matter into simpler compounds.
Energy Flow:
Unidirectional movement of energy towards higher trophic levels (producer to consumer) and its
dissipation and loss as heat to the environment.
Nutrient cycle:
Mineralisation of dead matter release them back for reuse of autotrophs.

Hreen Qark, Okl Q & A [VOLUME - II]

 98

10. What will happen to an ecosystem if:

a) All producers are removed;
b) All organisms of herbivore level are eliminated; and
c) All top carnivore population is removed
a) Reduction in primary productivity. No biomass available for consumption by higher trophic levels.
b) Increase in primary productivity and biomass of producers. Carnivores population will subsequently
dwindle due to food shortage.
c) Increase in number of herbivores
1) Overgrazing by herbivores
2) Desertification

11. Draw a pyramid of biomass and pyramid of energy in sea. Give your comments on the type of
pyramids drawn.

Pyramid of energy in sea = 1

The pyramid of biomass in sea is inverted = ½
The pyramid of energy in sea is upright = ½

12. Ecological pyramids give important information about the ecological system, but do have some limitations.
List any two limitations of ecological pyramids
The decomposers which are a major part of the food chain, are not given any place in any trophic
level.
The organisms from the same species may be present in one or more trophic level but are considered
in the same level.
The food web is not considered in the ecological pyramid but only the details of the food chain are
shown.

Hreen Qark, Okl Q & A [VOLUME - II]

 99
13. Given below is a food web that involve nine organisms.

a) Identify two producers and two carnivores shown in the food web.
b) Is it possible to make an ecological pyramid depicting this food web? Give reason in support of
your answer.
a) Producers - 1,2 and 3
Carnivores- 6,7,8 and 9
b) No, it is not possible to make an ecological pyramid depicting this food web as ecological pyramid
assumes a simple food chain, something that almost never exists in nature; it does not accommodate
a food web.

14. a) Name an ideal pyramid existing in an ecosystem. Construct it upto it's three trophic levels along with
their names.
b) The sun provides 1,000,000J of sunlight (solar energy) to an ecosystem. Write the amount of
energy that is available to the first and third trophic levels, respectively.
a) An ideal pyramid existing in an ecosystem is the pyramid of energy
In the ecological pyramid, the first trophic level represents the producers which are the green
plants. Primary consumers, which are the herbivores, represents the second trophic level.
Secondary consumers represent the third trophic level.

b) Primary producers convert only 1% of the energy in the sunlight available to them. So, if the sun
provides 1,000,000J of solar energy, only 10,000J is available at the producer or the first trophic
level. Now, according to the 10% law of energy transfer, only 10% of energy is transferred from one
trophic level to the next higher level. Therefore, the third trophic level will get 100J of energy.

Hreen Qark, Okl Q & A [VOLUME - II]

 100
15. a) Name the type of detritus that decomposes faster. List any two factors that enhance the rate of
decomposition
b) Write the different steps taken in humification and mineralisation during the process of
decomposition?
a) Detritus that decomposes faster are those rich in nitrogen and water-soluble substances, such as
leaves,barks, flowers, faecal matter and dead and decomposed bodies of animals.
Factors that enhance the rate of decomposition are warm and moist environment and presence of
oxygen.
b) Humification is the accumulation of a dark coloured amorphous substance called humus that is
highly resistant to microbial action and undergoes decomposition at an extremely slow rate. It is rich
in nutrients. The humus is further degraded by some microbes and release of inorganic nutrients
occur by the process known as mineralisation.

4 – MARK QUESTIONS:
1. An ecosystem can be visualised as a functional unit in nature, where living organisms interact
among themselves and with the surrounding physical environment also. The interaction of the
biotic and abiotic components results in a physical structure that is characteristic of an ecosystem
a) Name the two features that define the structural aspect of an ecosystem.
b) Mention the four common functional aspects of an ecosystem.
Answer :
a) Species composition and stratification are the two main structural features of an ecosystem.
b) Functional aspects of an ecosystem are Productivity, energy flow, decomposition and nutrient cycle.

2. A pond is a shallow water body, which is fairly a self-sustainable unit that explains the complex
interactions in an aquatic ecosystem. The water with all the dissolved inorganic and organic
nutrients is the major abiotic component.
a) Define ecosystem
b) Name the three groups of biotic components in the pond and give an example for each.
Answer :
a) Ecosystem may be defined as an interaction between the biotic communities and their abiotic
environment resulting in an exchange of materials between them.
b) The three groups of biotic components in the pond are
Plants - hydilla, lotus etc.
Animals - fish,frog etc.
Microbes - bacteria and fungi

Hreen Qark, Okl Q & A [VOLUME - II]

 101

3. The fallen parts of plants such as leaves, flowers etc., faecal matter of animals, etc. are ultimately
broken down into simpler inorganic nutrients, carbon dioxide and water.
1. Fragmentation, 2. Leaching, 3. Catabolism are some important steps in the process; they occur
simultaneously.
a) What term is given to the group of organisms that carry out the steps 1 and 3, respectively and
give an example for each
b) Name the other two steps involved in the process.
Answer :
a) Fragmentation is done by detritivores like earthworm and catabolism is done by decomposers like
bacteria and fungi.
b) Other two steps involved in the process are humification and mineralisation.

4. Organisms occupy a specific place in their natural surroundings or in a community according to

their feeding relationship with the other organisms. Based on the source of nutrition of food
organisms occupy a particular place, called trophic level, in a food chain.
a) What technical term is given to the organisms occupying the first, second and third trophic
levels in a food chain?
b) Choose an example for each of the above trophic levels, from the following list of organisms:
rabbit, wolf, phytoplanktons,frog,snail,hydrilla,jackal
Answer :
a) Producers always occupy the first trophic level of a food chain. The primary consumers or the
herbivores occupy the second trophic level. Carnivores or the secondary consumers occupy the third
trophic level in a food chain
b) producers - phytoplankton, hydrilla
Primary consumers - rabbit, snail
Secondary consumers - frog, wolf, jackal

5. Pyramids of Biomass of two types are shown in the diagram given below.

Hreen Qark, Okl Q & A [VOLUME - II]

 102

Answer the following questions.

a) Identify the type of ecosystems in which the pyramid of biomass A and B occur, respectively.
b) Why is the pyramid A inverted and B upright?
Answer :
a) 'A' represents an aquatic ecosystem
'B' represents a forest ecosystem
b) In aquatic ecosystem the biomass of producers is least and this value gradually shows an increase
towards the apex of the pyramid. Thus this pyramid is in inverted shape.
In forest ecosystem, the pyramid of biomass is typically upright. Trees, being the producers, occupy
the base with the highest biomass. These are followed by primary consumers like deer and squirrels,
which are then followed by secondary consumers like foxes and wolves.

5 MARK QUESTIONS:
1. a) Explain the different steps involved in the process of decomposition.
b) Describe how do oxygen and chemical composition of detritus control decomposition.
a) The process of breaking down complex organic matter into inorganic substances like CO2, water and
nutrient is called decomposition. The raw materials for decomposition is called detritus. They are
dead remains of plants and animals.
Process of decomposition:
i) Fragmentation:
It is the process of breaking of the detritus into smaller particles by detrivores. Eg:
Earthworm.
ii) Leaching :
It is the process in which water soluble inorganic substances run down into soil horizon and
get precipitated as unavailable salts.
iii) Catabolism :
The enzymatic conversion of the detritus into simple organic compounds and then into
inorganic compounds, is called catabolism.
The enzymes are secreted by the decomposers like bacteria and fungi.
iv) Humification :
Humification during decomposition leads to the accumulation of a dark coloured amorphous
substance called humus that is highly resistant to microbial action and undergoes
decomposition at an extremely slow rate.
v) Mineralization :
The humus is further degraded by some microbes and release inorganic substances or
nutrients by this process.
b) Oxygen increases rate of decomposition.
Decomposition rate is slower if detritus is rich in lignin and chitin and quicker, if detritus is
rich in nitrogen and water soluble substances like sugars.
Hreen Qark, Okl Q & A [VOLUME - II]
 103

2. a) What are decomposers? Name two kinds of decomposers.

b) What are major biotic components of ecosystem?
a) Decomposers are the heterotrophic organisms mainly consisting of bacteria and fungi which live on
dead organic matter. e.g., Bacteria and fungi.
b) Biotic components of ecosystem include producer, consumer and decomposer.
i) Producers : These are the photoautotrophic organisms which can produce their own organic food
from some inorganic raw materials, by photosynthesis e.g., Cyanobacteria, algae, bryophytes,
pteridophytes, gymnosperms and angiosperms.
ii) Consumers : These are the heterotrophic organisms which obtain their food from the producers
e.g., herbivores, carnivores and parasites.
iii) Decomposers : These are the saprophytic micro-organisms which feed upon the dead remains of
plants and animals. They decompose the complex dead organic matter into simple forms of matter.
Some part of this decomposed matter is used as food by them, and the rest is added to the soil and
the environment in the form of mineral and gaseous matter. Thus, decomposers are also called soil
mineralizers.

3. What is ecological pyramid? Draw pyramid of numbers with suitable examples.

Ecological pyramids are also called Eltonian pyramids after the name of the proposer Charles Elton.
It is a graphical representation of a food chain showing the arrangement of number of individuals of
different trophic levels. In a food chain, the animals at higher trophic level shows increase in size but
decrease in number.
Pyramid of numbers is usually upright but in a tree pyramid of numbers is inverted as many birds
depend on a tree.
Example :
Pyramid of numbers in a grassland ecosystem represent that only three top-carnivores are supported
in an ecosystem based on production of nearly 6 millions plants.

In pond ecosystem, large number of phytoplankton support comparatively small number of

zooplankton. The zooplankton support small-sized fish. Ultimately small sized fish becomes the
food of fewer larger-sized fish.

Hreen Qark, Okl Q & A [VOLUME - II]

 104

BIODIVERSITY AND CONSERVATION

2 MARK QUESTIONS:
1. What are the main attributes of a stable community?
A stable community should not show too much variation in productivity from year to year.
It must be either resistant or resilient to occasional, natural or man-made disturbances.
It must be resistant invasions by alien species.

2. What could be the reason that biologists are uncertain about the number of prokaryotic species
present in our biosphere?
The uncertainty with the total estimates of prokaryotes is that conventional taxonomic methods are
not suitable for identifying microbial species.
Microorganisms need to be cultured for biochemical and molecular classification.
But unfortunately, many species are not culturable under laboratory conditions.

3. Indicate how the current occurrence of species extinction is different from the earlier mass
extinctions?
In pre human era mass extinctions occurred because of natural calamities such as volcanic eruptions,
landslides, floods etc.
Unlike previous mass extinctions, in sixth mass extinction, species extinction rates are estimated to
be 100 to 1,000 times faster and it is mainly induced by anthropogenic effects.

4. What is “biodiversity hotspots”? Explain the main criteria for considering an ecosystem as
“biodiversity hotspots”?
These are vulnerable ecosystems identified for maximum protection.
To be qualified as a biodiversity hotspot the region should be with very high levels of species
richness and high degree of endemism i.e., species confined to that region and not found anywhere
else.

5. What is the difference between endemic and exotic species?

Endemic species are those species confined to that region and not found anywhere else.
Exotic species - plant or animal species those are non-native. It is introduced in to an area where it
does not occur naturally.
Introduction of species may be deliberate or accidental by human.

Hreen Qark, Okl Q & A [VOLUME - II]

 105

6. Why is genetic variation important in the plant Rauwolfia vomitoria?

Rauwolfia vomitoria grows in different region of Himalaya.
It is a source of drug reserpine.
Genetic variation is important in the plant Rauwolfia vomitoria because it results in variations in
potency and concentration of Reserpine produced from this plant.

7. What accounts for the greater ecological diversity of India?

Greater ecological diversity of India is due to greater geographical and topographical diversities.
At the ecosystem level, India, substrates, altitudes and water bodies which provide a high ecological
diversities like occurrence of coral reefs, mangroves, wetlands, estuaries, rain forests, deserts, alpine
meadows etc.

8. Define the terms

i) Bioprospecting ii) Endemism
i) Bioprospecting is a term which describes the process of discovery and commercialization of new
products on the basis of their biological resources. (economic importance)
ii) Endemism is a situation in which a species is restricted to a particular geographic region as a result
of factors such as isolation or in response to abiotic conditions.

9. What does the term ‘Frugivorous’ mean?

The term ‘Frugivorous’ refers to those animals which feeds on fruit or eat fruit as their staple food.
Several species of bats and many passerine birds are the examples.

10. Mention the kind of biodiversity of more than a thousand varieties of mangoes in India represent.
How is it possible?
Biodiversity of more than a thousand varieties of mangoes in India represents genetic diversity.
It is seen due to the differences in the soil of different agricultural practices and use of different
horticulture techniques like grafting and breeding in different areas.

11. How does species diversity differ from ecological diversity?

The number of species of plants and animals that are present in a region constitutes its species
diversity.
Ecological diversity is the variation in ecosystems within a region or habitat.
For example monkey, dragonfly, rose etc are all different species.
Whereas deserts, wetlands, forests, grasslands, ocean etc are examples of ecological diversity.
Hreen Qark, Okl Q & A [VOLUME - II]
 106

12. List the factors that cause loss of biodiversity.

Destruction of natural habitat.
Introduction of exotic species
Over exploitation of natural resources
Co-extinction of species.
Resources is crucial to sustain food and ecological security.

13. Why are sacred groves highly protected?

Sacred groves form important sources of forest biodiversity
It also provides vital ecosystem services to local people.
They are highly protected areas because, they have
a) Cultural and religious traditions that emphasized protection of nature.
b) A large number of rare, threatened plants.

14. State how does ex-situ conservation help in protecting biodiversity.

Ex-situ conservation is the method of preserving components of biological diversity outside the
natural habitats.
This will play an important role in recovery programmes for endangered species.
Considering the rate of habitat loss world wide, ex-situ conservation is becoming increasingly
important as compared to in-situ conservation.

15. How do we conserve biological diversity for food and ecological security?
Conservation of genetic resources is crucial to sustain food and ecological security.
It can be achieved by the following ways.
a) to maintain them in the wild places like forests and nature preserves.
b) to conserve them in protected areas, like national parks and botanical gardens.
c) to feed them into the agricultural and horticultural trade so that they are cultivated by people at large
d) to preserve them in the form of seeds or some other suitable material.

16. How can you, as an individual, prevent the loss of biodiversity?

As an individual, to prevent the loss of biodiversity the following things will be done.
a) Practise of recycling waste paper.
b) Judicious exploitation of medicinal and economically important plants and animals.
c) Creating awareness among the public about the importance of biodiversity and its conservation.
d) Use of alternate eco-friendly solar energy, wind energy, biogas, organic farming etc.

Hreen Qark, Okl Q & A [VOLUME - II]

 107

17. Can you think of a situation where we deliberately want to make a species extinct? How could you
justify it?
Since many microorganisms, such as polio virus, malarial parasite etc, are very harmful to the human
society.
We are trying to eradiate such organisms.
In my opinion, such attempt is justified because such organisms do not affect the functioning of a
healthy ecosystem.

18. Name the sociobiologist who popularised the term biodiversity. What is biodiversity?
Edward Wilson popularised the term Biodiversity
Biodiversity refers to the combined diversity at all the levels of biological organisation.

19. Mention the kind of biodiversity of more than a thousand varieties of mangoes in India represent.
How is it possible?
It represents genetic diversity.
It is because a single species shows high diversity at the genetic level over its distributional range.

20. Compare the ecological biodiversity existing in India and Norway.

India is located in the tropical region and has a greater ecological diversity with its deserts, coral
reefs, mangroves, tropical rainforests, wetlands, estuaries, etc.
Norway is a Scandinavian country located in the temperate region has very little ecological diversity.

21. Provide two reasons that make the count of prokaryotic species difficult.
Prokaryotes are not given any number because:
The conventional taxonomic methods are not suitable/sufficient for identifying these microbes.
Many of these cannot be cultured under laboratory conditions.
Biochemical and molecular biology techniques would put their diversity into millions.

22. India is one of the l2 megadiversity countries. Justify.

India has only 2.4 per cent of the land area of the world; but, its share of global species diversity is
8.1 per cent.
India has about 45,000 species of plants and twice as many animal species; hence, India is one of the
12 mega diversity countries.

Hreen Qark, Okl Q & A [VOLUME - II]

 108

23. State the 'two' observations made by the German naturalist Alexander Von Humboldt during his
extensive explorations in the South American Jungles.
Alexander Von Humboldt observed that within a region, species richness increased with increasing
explored area, but only upto a limit.
The relation between species richness and area for a wide variety of taxa like angiosperms, birds,
fishes, etc. turns out to be a rectangular hyperbola.

24. Stability of a community depends upon its species richness'. How did David Tilman show this
experimentally? (or) How did Tilman show that stability of a community depends on its species-
richness. Explain.
Tilman had shown that:
The plots with more species showed less year-to year variation in total biomass.
Plots with increased diversity showed higher productivity.

25. a) What is meant by threatened species?

b) What is common about Eichhornia, Lantana and Parthenium with reference to the threat to
our biodiversity?
a) Threatened species are those organisms facing a very high risk of extinction in the wild in the near
future.
b) They are all exotic species, introduced into India; these alien species have caused environmental
damage and posed threat to our native species.

26. How does over-exploitation of beneficial species affect biodiversity? Explain with the help of one
example.
Humans depend on nature for food and shelter:
But over-exploitation of natural resources has led to extinction of many species in the last 500 years,
e.g. Steller's sea-cow and Passenger pigeon, are lost due to over-exploitation.
Many marine fish populations around the world are over-exploited, thus endangering the continued
existence of some commercially important species.

27. Biodiversity must be conserved as it plays an important role in many ecosystem services that
nature provides. Explain any two services of the ecosystem.
Pollination of crops by insects like bees, butterflies, birds, bats, etc. is an important ecosystem
service, without which no fruit or seed can be formed.
The forests are responsible for adding oxygen to the atmosphere.
Certain intangible benefits like aesthetic pleasure of watching the spring flowers or listening to the
bulbul's song, are provided by ecosystems.
Hreen Qark, Okl Q & A [VOLUME - II]
 109

28. What is Ramsar Convention? How was it called previously?

Ramsar Convention is a global environmental treaty that provides the framework for national action
and international cooperation for the conservation and wise use of wetlands and their resources.
It was called convention on wetlands of International Importance.

29. What is cryopreservation? Mention how it is used in conservation of biodiversity.

Cryopreservation is the method of preserving pollen grains, gametes, etc at –196oC in liquid
nitrogen.
Gametes of threatened species are preserved for long periods in viable and fertile conditions.

30. When and where was the World Summit on sustainable development held? How many countries
signed the convention? What was the objective?
The World Summit on sustainable development was held in 2002, in Johannesburg, South Africa.
190 countries signed the convention.
Its objective was to achieve by 2010, a significant reduction in the current rate of biodiversity loss at
global, regional and local levels.

3 MARK QUESTIONS:
1. Explain Species-Area relationship equation with the help of a graph and explain the significance of
Z value?
It is the relationship between species richness and the area of study.
It is given by the graph as follows

log S = log C + Z log A

Where, S= Species richness, A= Area, Z = slope of the line, C = Y-intercept
Z is the slope of the regression line (graph) and it represents regression coefficient.
This value tells us how much the species richness (S) changes in relation to changes in the explored
area(A).
A steeper slope means an increase in species richness in a unit area.
Hreen Qark, Okl Q & A [VOLUME - II]
 110

2. What are the differences between in situ and ex situ conservation?

These are the two different modes of protecting endangered and endemic species.
In-situ conservation is the method of conserving biodiversity in its own natural habitat.
In in-situ conservation ecological hotspots are identified and less human activity is maintained in
these regions by enforcing strict laws to conserve biodiversity.
In ex-situ conservation threatened species are taken out from their natural habitat and placed in
special setting where they can be protected and given special care.
Zoological parks, botanical gardens and wildlife safari parks serve this purpose.
Other approaches in this conservation include maintenance of gametes of threatened species for long
periods using cryopreservation techniques and conserving seeds of commercially important plant for
long periods in seed banks.

3. What are the indirect benefits we receive from biodiversity?

Forest acts as a carbon sink and produce oxygen which helps in the perpetuation of human being on
earth.
Amazon forests which produce 20 per cent of the total oxygen in the earth’s atmosphere substantiate
this fact.
The current agricultural productivity could not have been possible without the enormous service
provided by bees, bumblebees, birds, bats etc as pollinators.
We derive intangible benefits from the nature.
The aesthetic pleasures of walking through thick woods, watching spring flowers in full bloom or
waking up to a bulbul’s song in the morning are all considered priceless.

4. What are the major initiatives made by the world nations to protect our biodiversity?
Conservation of biodiversity is a collective responsibility of all nations as it is beyond the political
boundaries.
The historic Convention on Biological Diversity (‘The Earth Summit’) held in Rio de Janeiro in
1992, called upon all nations to take appropriate measures for conservation of biodiversity and
sustainable utilisation of its benefits.
World Summit on Sustainable Development held in 2002 in Johannesburg, South Africa, 190
countries pledged their commitment to achieve a significant reduction in the current rate of
biodiversity loss at global, regional and local levels by 2010.

Hreen Qark, Okl Q & A [VOLUME - II]

 111

5. How do India’s religious and cultural traditions contribute the protection of nature?
We have a rich religious and cultural tradition, which is entwined with the nature.
Some trees, plants are considered as sacred because of religious reasons.
In India areas of forest were set aside near place of worship known as sacred groves.
All the trees and wildlife within this were venerated and given total protection.
Sacred groves are the last refuges for a large number of rare and threatened plants.
Sacred groves are found in Khasi and Jaintia Hills in Meghalaya, Aravalli Hills of Rajasthan,
Western Ghat regions of Karnataka and Maharashtra.

6. What is known as mass extinction? What are the reasons for this phenomenon? Will there be any
more mass extinction in future?
a) Mass extinctions are catastrophic event which occurred in our earth millions of years ago.
b) Mass extinctions were triggered by the natural disturbances in earth like glaciation, volcanic activity,
high temperature, meteorite attacks etc, which could erase more than 75% of existing life forms from
earth in past time.
c) Scientific communities believe the occurrence of human induced sixth mass extinction, in fact it is in
progress. Unlike previous mass extinctions in current mass extinction the species extinction rates are
estimated to be 100 to 1,000 times faster than in the pre-human times and our activities are
responsible for faster rates.
d) Ecologist warn that present trends continue nearly half of all the species on earth might be wiped out
with in the next 100 years.

7. The effect of species extinction on ecosystem is well explained using the analogy of an airplane and
rivets joining its parts. Explain this hypothesis in terms of biodiversity-ecosystem relationship?
Paul Ehrlich put forth this hypothesis, which is known as Rivet Popper Hypothesis.
He explained the effect of species extinction on ecosystem with the analogy of an airplane, with all
parts joined together using thousands of rivets.
He considered the ecosystem as a plane and thousands of rivets that join the plane as species present
in that ecosystem.
Species extinction is compared with passengers removing rivet to take home, it may not initially
affect flight safety i.e. proper functioning of the ecosystem.
In long-term, the extinction of species one by one will affect the stability of ecosystem just like a
weak plane with a lot of rivets removed.
Key species that drive major ecosystem functions are similar to rivets on important location like the
wings rivets rather than the rivets on the seats or windows inside the plane.

Hreen Qark, Okl Q & A [VOLUME - II]

 112

8. Give three hypothesis for explaining why tropics show greatest levels of species richness.
There are three different hypothesis proposed by scientists for explaining species richness in the tropics.
These are as follows
i) Tropical latitudes receive more solar energy than temperate regions which leads to high productivity
and high species diversity
ii) Tropical regions have less seasonal variations and a more constant environment. Thus promotes the
niche specialisation and thus, high species richness.
iii) Temperate regions were subjected to glaciations during the ice age, while tropical regions remained
undisturbed which led to an increase in the species diversity in the region.

9. Of the four major causes for the loss of biodiversity, which according to you is the major cause for
the loss of biodiversity? Give reasons in support.
Loss of habitat and fragmentation occur due to clearing and over exploitation of forest areas for
agriculture, urbanization and industrialization. It is the major cause for the loss of biodiversity.
Because,
a) It results in destruction of natural habitats.
b) Increasing human population has over burdened the forest resources and have destroyed forest land,
which means loss of habitat for several species.
c) Large habitats are broken up into small fragments due to which mammals and birds requiring large
territories and migratory habits are badly affected, leading to decline in population.

4 MARK QUESTIONS:
1. From the pie chart it is quite evident that insects make up more than 70 per cent of the
biodiversity among invertebrates. In fact, out of every 10 animals on this planet, 7 are insects.

Amphibians

Hreen Qark, Okl Q & A [VOLUME - II]

 113

a) From this data can you list out some reasons for this enormous diversification in insect’s
species?
b) Same way as insects, the diversity of fish species is more among vertebrates. Can you suggest
some common reasons for this high biodiversity in both groups?
a) Insects have the long geological history i.e. they are one of the earliest groups to make their life on
the earth so got enough evolutionary time to diversify to occupying various habitats of soil and
water.
They have physiological and ecological advantages of their small in size, which require less
space, food, time and energy requirements for development and sustaining life.
They have high fecundity and smaller developmental period.
Insects possess wings, which make them highly mobile to seek food, mate, shelter and
oviposition sites.
Wings enable them colonize in a new habitat and to escape predation and unfavourable
conditions.
All these feature helps insect to diversify and multiply enormously
b) Surely, we can derive some common reasons for the diversification of both fish and insect species.
Aquatic system which is 70% compared to land, offers a diverse habitat like coral reefs, kelp forest,
temperate and tropical sea for its diversification.
Both groups have long relative age or geological history.
Both of these groups have high fecundity and smaller developmental period.
Mobility of fish is also more or less similar to fish which help them migrate and adapt to new
habitat.

2. What is Biodiversity? Explain the biodiversity at important levels of biological organisation?

Biodiversity is the term popularised by the sociobiologist Edward Wilson.
It refers to the immense heterogeneity or variability seen in our biosphere.
This heterogeneity exists every at levels of biological organisation ranging from macromolecules
within cells to biomes.
Biodiversity at important level of organization are following.
Genetic diversity
Individuals from a single species might show high diversity at the genetic level because of
inheritance of different genes.
Genetic variation can be simply put as variation of genomes at the individual level.
This diversity in gene level is known as genetic variation or genetic diversity.
For example, India has more than 50,000 genetically different strains of rice and 1,000 varieties of
mango.

Hreen Qark, Okl Q & A [VOLUME - II]

 114

Species diversity
Species diversity is defined as the number of species and abundance of each species that inhabitat a
particular location or it is the species richness at a specific location.
For example, the Western Ghats have a greater amphibian species diversity than the Eastern Ghats.
Ecological diversity
It is the variation in ecosystem such as deserts, rain forests, mangroves, coral reefs, wetlands,
estuaries, and alpine meadows.
Each ecosystem constitutes great deal of both species and genetic diversity.
For instance, India being a tropical has a greater ecosystem diversity than a temperate Scandinavian
country like Norway.

3. Can you think of a scientific explanation, besides analogy used by Paul Ehrlich, for the direct
relationship between diversity and stability of an ecosystem.
Paul Ehrlich (Stanford ecologist) proposed a hypothesis called rivet popper hypothesis
Besides analogy used by Paul Ehrlich for the direct relationship between diversity and stability of an
ecosystem, it can be explained scientifically as follows:
Imagine a forest area, where diverse species of plants are growing.
Plants harbour a variety of insects on which a lot of bird species would depend for their food.
If a specific plant species dies, the related insect population will be affected that would lead to food
unavailability for the birds.
In addition, if the plant species was a nitrogen fixer, the death of these plants would mean no
replenishment of soil with nitrogen.
Thus it will obviously affect the other plants as well.
So, if the cycle continues, the whole habitat / ecosystem will be negatively affected.

4. Is it possible that productivity and diversity of a natural community remain constant over a time
period of, say one hundred years? Justify.
No, it is not possible that productivity and diversity of a natural community remain constant over a
certain time period.
Because
a) The natural habitat is never maintained in real
b) Abundant resources are never available, they are always in short supply or just enough.
c) Environmental conditions for survival and reproduction are continuously changing.

Hreen Qark, Okl Q & A [VOLUME - II]

 115

5. Study the pie chart given below, representing the global diversity, proportionate number of species
of major taxa and answer the following questions based on it :

a) Identify 'X' and 'Y' in the given pie chart.

b) Which one of the two, 'X' or 'Y', is the most species-rich taxonomic group and by what
percentage
Answer:
a) 'X' is Insects
'Y' is Molluscs
b) X is species-rich
More than 70 Percent of animals'

6. Explain, giving three reasons, why tropics show greatest levels of species diversity.
Biodiversity is more in tropical latitudes than temperate ones for the following reasons
Speciation is a function of time; the temperate regions were subjected to frequent glaciation in the
past, while the tropics have remained relatively undisturbed and hence, had longer time to evolve
more species diversity.
The tropical environments are less seasonal and relatively more constant and more predictable than
temperate regions: speciation has been promoted / favoured by such constant environments and
hence there is greater species diversity.
There is more solar radiation available in the tropical region; this contributes directly to more
productivity and indirectly to greater species diversity.

7. The following graph shows the species-area relationship. Answer the following questions as
directed.

Hreen Qark, Okl Q & A [VOLUME - II]

 116

a) Name the naturalist who studied the kind of relationship shown in the graph. Write the
observations made by him.
b) Write the situations as discovered by the ecologists when the value of ‘Z’ (slope of the line) lies
between i) 0.1 and 0.2 ii) 0.6 and 1.2
What does 'Z' stand for?
c) When would the slope of the line ‘b' become steeper?
Answer :
a) Alexander Von Humboldt.
He observed in the South American jungles that within a region, species richness increased with the
increasing explored area, but only upto a certain limit.
The relation between species richness and area for a wide variety of taxa turns out to be a rectangular
hyperbola.
On a logarithmic scale, the relationship is a straight-line.
b) i) The slopes of regression line are very similar, regardless of the taxonomic group or region when
small areas are explored.
ii) Species-area relationship in very large area like the entire continent is analysed, the slope of the
line becomes steeper with ‘Z’ value between 0.6 and 1.2.
'Z' stands for slope of regression.
d) The slope of the line ‘b’ becomes steeper when the species richness is very high.

8. Study the graphical representation of species richness-Area relationship given below and answer
the questions that follow:

a) What do ‘S’, ‘C’, ‘Z’ and ‘A’ represent in the given graph?
b) What will be the range of value of ‘Z line’, if we analyse the species-area relationship among
very large areas like entire continent?
Answer:
a) S - Species richness
C - Y-intercept
Z - Slope of the line or Regression coefficient
A - Area (explored)
b) Z value will be in the range of 0.6 to 1.2.
Hreen Qark, Okl Q & A [VOLUME - II]
 117

9. Biodiversification of life started to occur almost 3 billion years ago. Since then new species have
been evolving and then disappearing mass from earth.
a) How many episodes of mass extinctions of species have already taken place and which one is in
progress in the current era?
b) How is the current episode in progress different from the previous episodes and why? Explain.
Answer :
a) There were five episodes of mass extinction. The sixth one is in progress.
b) The current episode is 100-1000 times faster than the previous ones. Human activities are
responsible for this, whereas the others have taken place in the pre-human times.

10. What are the consequences of loss of biodiversity in a region? Explain.

Loss of biodiversity in a region leads to:
i) decline in plant productivity.
ii) lowered resistance to environmental perturbations like drought.
iii) increased variability in certain ecosystem processes like water use, productivity, pest and disease
cycles, etc.

11. Explain giving one example, how co-extinction is one of the causes of loss of biodiversity. List the
three other causes also (without description)?
Co-extinction is a phenomenon in which when a species becomes extinct, the plant and animal species
associated with it, in an obligatory manner, also become extinct. e.g.
Other causes - over exploitation, Habitat loss and fragmentation and Invasion of alien species.

12. What is the contribution of biodiversity to medical field?

More than 25 per cent of the drugs are derived from plants.
About 25,000 species of plants contribute to traditional medicines used by native people across the
world.

13. ‘In situ’ conservation can help endangered / threatened species. Justify the statement.
In situ conservation is the method of protecting the endangered/threatened species in their natural
habitats, i.e., the whole ecosystem is conserved.
The in situ conservation strategies include:
Biodiversity hotspots can reduce the ongoing mass extinctions by about 30 per cent.
Sacred groves are the last refuges for a large number of rare and threatened species.
Biosphere reserves and national parks are the ecologically unique and biodiversity-rich regions that
are legally protected.
Ramsar sites are meant for conservation of wetlands.
Hreen Qark, Okl Q & A [VOLUME - II]
 118

5 MARK QUESTIONS:
1. Colombia located near the equator has nearly 1,400 species of birds while New York at 41° N has
105 species and Greenland at 71° N only 56 species. Based on this fact answer the following.
a) What is the pattern of biodiversity observed here and explain this pattern?
The pattern seen here is latitudinal gradient in biodiversity.
Species diversity decreases as we move away from the equator towards the poles
b) Does India come under this pattern of biodiversity? If yes explain it?
Latitudinal gradient in biodiversity is observed in India since much of its land area is in the
tropical latitudes.
Species richness in our country is the indication for this pattern. Moreover, India is one of the 12
megadiversity countries of the world with nearly 45,000 species of plants and twice as many of
animals.
c) List out the reasons for a greater biological diversity observed in tropics compared to the
temperate regions?
Temperate regions were subjected to frequent glaciations in the past while tropical latitudes
remained relatively undisturbed for millions of years and had enough evolutionary time for
species diversification.
Tropics are less seasonal with constant and predictable environments.
These constant environments promote niche specialisation and lead to a greater species diversity.
The availability of more solar energy in the tropics is another reason that contributes to a high
productivity, which indirectly leads to a greater diversity.

2. Anthropogenic effects or human activities are the major cause of accelerated rates of species
extinctions and there by the loss of biodiversity. Explain those major causes?
The accelerated rates of species extinctions and biodiversity loss is due to human activities.
The four major causes are nick named as “The Evil Quartet”.
They are as follows
Habitat loss and fragmentation.
This is the major human activity which accelerates extinction of plants and animals.
Human activities like large scale agriculture, industries, construction of highways, bridges and
dam etc break larger habitats into smaller fragments.
This hampers the growth and survival of mammals and birds having migratory habits and species
requires large territories.
The habitat loss is usually followed by a population decline and ends in species extinction.
For example, Amazon rain forest is being cut and cleared for cultivating soya beans and for
raising beef cattle.
Hreen Qark, Okl Q & A [VOLUME - II]
 119

Over-exploitation.
Over-exploitation refers to the over utilization of natural resources by humans without giving
time to replenish.
Nature always offers food and shelter to the needy but not to the greedy.
Last centuries have witnessed extensive loss of biodiversity due to large scale fishing, over
hunting etc.
E.g. Extinction of Steller’s sea cow and passenger pigeon is due to over hunting.
Alien species invasions.
Alien species means a new species introduced into a new habitat.
They often multiply rapidly in the new habitat due to lack of predation or competition.
This population explosion of alien species causes decline or extinction of indigenous species.
For instance, Nile perch introduced into Lake Victoria in east Africa led extinction of more than
200 species of cichlid fish in the lake.
Introduction of invasive species can be deliberate as in the case of African catfish introduced for
aquaculture or it can be unintentional in the cases like carrot grass (Parthenium).
Co-extinctions.
This is a phenomenon in which extinction of a species leads to the extinction of other species
obligately associated with it.
For example, when a host fish species becomes extinct, its unique assemblage of parasites also
meets the same fate.

3. There is a pressing need for biodiversity conservation. There are arguments and many reasons for
conserving biodiversity.
a) List out and explain those major arguments?
b) The ethical argument seems contradictory to science. Should we consider this argument as
valid reason for conserving biodiversity.
a) The narrowly utilitarian, the broadly utilitarian and the ethical are the major arguments.
The narrowly utilitarian arguments for conserving biodiversity consider only the practical and
direct economic benefits we derive from nature like food, firewood, fibre, construction material,
industrial products and products of medicinal importance.
While the broadly utilitarian arguments consider the indirect and intangible benefits that we
derive from nature like oxygen production from forest, vegetation, pollination of agricultural
crops and other economical crops by the diverse group of pollinators and the aesthetic pleasures
we feel while interacting with the nature.

Hreen Qark, Okl Q & A [VOLUME - II]

 120
The ethical arguments suggest the fact that we share millions of plant, animal and microbe
species in this planet.
The proponents of this concept argue that philosophically or spiritually every species has an
intrinsic value so we have a moral duty to care for their well-being and pass on our biological
legacy in good order to future generations even if it is of no current economic value.
b) There are many reasons, some obvious and others not so obvious, but all are equally important when
come to biodiversity conservation.
As a science person one has reasons to appreciate the intrinsic value of an organism.
In periphery sometimes a species seems harmful or useless but it might be very complicatedly
linked to the ecosystem.
Only on extinction we will realise the importance of a species in an ecosystem.
It is due to lack of our understanding about a species we often classify them as useful or useless.

4. Why should we conserve biodiversity? How can we do it?

Biodiversity conservation is necessary because of the following reasons.
Many commercially important products such as food, fibre and wood and countless industrial
products are obtained from nature.
Certain activities cannot be accomplished without the help of nature such as production of oxygen
and pollination.
Intangible benefits such as aesthetic pleasure and derived from nature.
Conserving the species, we share our planet with and passing the rich legacy of biodiversity to our
future generations is our ethical duty.
Biodiversity can be conserved by the following means
In-situ conservation :
It is the protection and management of important components of biological diversity through a
network of protected area.
In order to conserve biodiversity, some of the world’s biodiversity hot spots have been identified and
are being protected.
In India, biosphere reserves, wildlife sanctuaries and national parks are built for this purpose.
Ex-situ conservation :
It is a set of conservation techniques which involves the transfer of a target species away from its
native habitat.
The threatened species of plants and animals are taken out of their habitats and are kept in special
settings such as zoological parks, botanical gardens and wild life parks.

Hreen Qark, Okl Q & A [VOLUME - II]

 121

5. How can you, as an individual prevent the loss of biodiversity?

Biodiversity is defined as the variety of living forms present in various ecosystems.
It includes variability amongst the life forms from all sources including land, air and water.
Around the world, it is declining at a very fast speed.
As an individual biodiversity can be conserved with conservation strategies and management of both
biotic and abiotic resources.
Some of the conservation strategies are as follows :
Protection of useful animals and plants in their natural habitat or natural conservation.
Preservation of critical habitats like feeding and breeding areas and resting area of endangered
species to promote their growth and multiplication.
Hunting should be banned or regulated.
Habitat of migratory animals should be protected by bilateral or multilateral environments.
People should be made aware of the importance of biodiversity and its conservation
Over exploitation of natural resources must be avoided.
biodiversity plays an important role in maintaining and sustaining supply of goods and services.
Conservation of biodiversity ensures well being of all the living creatures and their future
generations.

6. Elaborate how invasion by an alien species reduces the species diversity of an area.
Any new species entering in a geographical region unintentionally or deliberately are known as
exotic or alien species lake carrot grass Lantana and water hyacinth.
These species cause disappearance or extinction of native or indigenous species through changed
biotic interaction.
a) Nile perch : It is a large predator fish. When this alien species was introduced into lake of victoria
in East Africa, led eventually to the extinction of an ecologically unique assemblage of more than
200 species of cichlid fish in the lake.
b) Water hyacinth (Eichhornia) : It is introduced in Indian waters to reduce pollution but leads to
death of several aquatic plants and animals.
c) Lantana Camara : It is a straggling shrub. It has become a serious weed which has replaced many
species in forest of uttar Pradesh and Madhya Pradesh.

7. Explain the importance of species diversity to the ecosystem.

The number of species in a community really matter to the functioning of the ecosystem.
For many decades, ecologists believed that communities with more species generally, tend to be
more stable than those with less species.
A stable community should not show too much variations in productivity from year to year.
Hreen Qark, Okl Q & A [VOLUME - II]
 122
It must be either resistant or resilient to occasional disturbances (natural or man-made) and it must
also be resistant to invasions by alien species.
These attributes are linked to species richness in a community.
David Tilman did long term ecosystem experiments using outdoor plots.
Tilman found that plots with more species showed less year to year variation in total biomass.
He also showed that in his experiments, increased diversity contributed to higher productivity.
We may not understand completely how species richness contributes to the well being of an
ecosystem.
The rich biodiversity is not only essential for ecosystem health but imperative for the very survival of
the human race on this planet.

8. How many species are there on Earth? Explain.

Since there are published records of all species discovered and named, we know how many species
in all have been recorded so far.
It is not easy to answer the question of how many species there are on Earth.
According to the International Union for conservation of Nature and Natural Resources the total
number of plant and animal species described so far in slightly more than 1.5 million.
We have no clear idea of how many species are yet to be discovered and described.
Estimates vary widely and many of them are only educated guesses.
For many taxonomic groups, species inventories are more complete in temperate than in tropical
countries considering that an overwhelmingly large proportion of the species waiting to be
discovered are in the tropics, biologists make a statistical comparison of the temperate - tropical
species richness of an exhaustively studied group of insects and extrapolate this ratio to other groups
of animals and plants to come up with a groups estimate of the total number of species on Earth.
Some extreme estimates range from 20 to 50 million but a more conservative and scientifically
sound estimate made by Robert May places the global species diversity at about 7 million.
Based on currently available / species inventors
More than 70 percent of all the species recorded are animals.
While plants comprise not more than 22 percent of the total.
Among animals, insects are the most species rich taxonomic group, making up more than 70 percent
of the total.
That means, out of every 10 animals on this planet, 7 are insects.
The number of fungi species in the world in more than the combined total of the species of fishes,
amphibians, reptiles and mammals.

Hreen Qark, Okl Q & A [VOLUME - II]

 123

9. Read the following passage and answer the questions that follow:
The accelerated rates of species extinctions that the world is facing now, are largely due to human
activities. The last twenty years alone have witnessed the disappearance of 27 species of organisms.
Humans have always depended on nature for food and shelter; but, when 'need' tums to 'greed', it
leads to overexploitation of the natural resources.
a) Name two animals that have become extinct in the last 500 years, due to over-exploitation.
b) Name two subspecies of tigers that have become extinct recently.
c) There are four major causes, for loss of biodiversity, collectively known by the sobriquet, 'The
Evil Quartet'. List them.
(or)
c) The Amazon rain forest is referred to as 'the lungs of the planet, Earth'. Mention any two
human activities, which lead to loss of biodiversity in this region.
a) Steller’s sea cow and passenger pigeon.
b) Javan, Bali and Caspian.
c) Over Exploitation, Habitat loss and fragmentation, Co-extinction, Invasion of alien species.
(or)
d) Unchecked Agriculture expansion
Illegal logging
Clearing forest land for roads, hydropower dams, house - building and other development.

10. Read the following passage and answer the questions that follow:
It is learnt from the study of the history of life on earth through fossil records that there were large scale
extinctions even in the pre-human times. During the long period since the origin and diversification of life on
earth, there were five episodes of mass extinction of species. The 'sixth Extinction' is currently in progress.
a) What percent of i) bird species and ii) mammal species in the world face the threat of
extinction?
b) How many species have become extinct in the last 500 years, according to IUCN Red List?
c) Give two points as to how the sixth episode of mass extinction is different from the earlier five
episodes.
(or)
c) Name two International conventions and their commitments to biodiversity conservation.
a) 12% and 23%
b) 784 species extincted (338 - vertebrates, 359 - Invertebrates, 87 - plants)
c) The rate of the sixth mass extinction is 100 - 1000 times faster than the earlier extinction rates
because of mindless human intervention.
(or)
d) CITES - Convention on International trade in Endangered species
Ramsar convention.

Hreen Qark, Okl Q & A [VOLUME - II]