Article

Mechanical competition triggered by innate immune

signaling drives the collective extrusion of
bacterially infected epithelial cells
Graphical Abstract Authors
Effie E. Bastounis,
Francisco Serrano-Alcalde,
Prathima Radhakrishnan, ...,
Matthew D. Welch,
José M. Garcı́a-Aznar, Julie A. Theriot

Correspondence
[email protected]

In Brief
Bastounis et al. show that, during
infection with the intracellular bacterial
pathogen L. monocytogenes, large
infected domains in epithelial cell
monolayers extrude to form three-
dimensional mounds due to the collective
onslaught by their uninfected neighbors.
This mechanical competition between
uninfected and bacterially infected cells
limits pathogen dissemination through
the epithelium.

Highlights
d Epithelial host cells form extruded mounds after infection
with L. monocytogenes

d 3D mounds result from mechanical competition between

infected and uninfected cells

d Inhibition of cell-matrix and/or cell-cell forces inhibits

infection mound formation

d Innate immune signals control this mechanical competition

that limits pathogen spread

Bastounis et al., 2021, Developmental Cell 56, 443–460

February 22, 2021 ª 2021 Elsevier Inc.
https://doi.org/10.1016/j.devcel.2021.01.012 ll
 ll

Article
Mechanical competition triggered by innate
immune signaling drives the collective extrusion
of bacterially infected epithelial cells
Effie E. Bastounis,1 Francisco Serrano-Alcalde,2,7 Prathima Radhakrishnan,1,3,7 Patrik Engström,4
Marı́a J. Gómez-Benito,2 Mackenzi S. Oswald,5 Yi-Ting Yeh,6 Jason G. Smith,5 Matthew D. Welch,4
José M. Garcı́a-Aznar,2 and Julie A. Theriot1,8,*
1Department of Biology and Howard Hughes Medical Institute, University of Washington, Seattle, WA 98195, USA
2Department of Mechanical Engineering, University of Zaragoza, Zaragoza 50009, Spain
3Biophysics Program, Stanford University, Stanford, CA 94305, USA
4Department of Molecular and Cell Biology, University of California Berkeley, Berkeley, CA 94720, USA
5Department of Microbiology, University of Washington School of Medicine, Seattle, WA 98109, USA
6Department of Mechanical and Aerospace Engineering, University of California, San Diego, La Jolla, CA 92093, USA
7These authors contributed equally
8Lead contact

*Correspondence: [email protected]
https://doi.org/10.1016/j.devcel.2021.01.012

SUMMARY

Intracellular pathogens alter their host cells’ mechanics to promote dissemination through tissues.
Conversely, host cells may respond to the presence of pathogens by altering their mechanics to limit
infection. Here, we monitored epithelial cell monolayers infected with intracellular bacterial pathogens,
Listeria monocytogenes or Rickettsia parkeri, over days. Under conditions in which these pathogens
trigger innate immune signaling through NF-kB and use actin-based motility to spread non-lytically inter-
cellularly, we found that infected cell domains formed three-dimensional mounds. These mounds resulted
from uninfected cells moving toward the infection site, collectively squeezing the softer and less contrac-
tile infected cells upward and ejecting them from the monolayer. Bacteria in mounds were less able to
spread laterally in the monolayer, limiting the growth of the infection focus, while extruded infected cells
underwent cell death. Thus, the coordinated forceful action of uninfected cells actively eliminates large
domains of infected cells, consistent with this collective cell response representing an innate immunity-
driven process.

INTRODUCTION et al., 2014; Sellin et al., 2014). Similar single cell extrusion
occurs in human intestinal enteroids infected with S.Tm. or
Mammalian cells communicate through both biochemical and L.m. (Co et al., 2019). The mechanism resembles that which
biomechanical signals. Examples of the latter include the forces normal epithelia use to extrude apoptotic cells (Gudipaty and
that cells transduce to each other and to their extracellular matrix Rosenblatt, 2017). A dying cell contracts and signals its neigh-
(ECM), critical for maintaining tissue integrity and barrier func- bors to assemble a multicellular contractile ‘‘purse string’’ that
tion. Intracellular bacterial pathogens can manipulate host cell moves basally, squeezing out the extruding cell and promoting
functions, including mechanotransduction, to disseminate. For formation of cell-cell junctions among the new neighbors
example, two intracellular bacterial pathogens that generate (Kuipers et al., 2014; Rosenblatt et al., 2001; Tamada et al.,
actin comet tails for propulsion through the cytoplasm of in- 2007). At a low cell density, crawling of neighboring cells also
fected host epithelial cells, Listeria monocytogenes (L.m.) and contributes to apoptotic cell extrusion (Kocgozlu et al., 2016).
Rickettsia parkeri (R.p.), both secrete virulence factors that Some bacterial pathogens resist this innate immune extrusion
reduce intercellular tension, making it easier for bacteria to reaction by secreting virulence factors that stabilize cell-ECM
spread (Lamason et al., 2016). Conversely, host cells may exhibit adhesions (Kim et al., 2009).
biomechanical alterations after infection that could function as Epithelia that are infected by pathogens capable of direct,
innate immune responses limiting bacterial spread. In intestinal non-lytic intercellular spread face a particular challenge. In
epithelial cells infected with Salmonella enterica serovar Typhi- addition to L.m. and R.p., other intracellular bacterial patho-
murium, (S.Tm.) innate immune activation of the inflammasome gens have developed biochemically distinct mechanisms to
triggers apical extrusion of single cells, which are shed into the trigger the rapid assembly of host cell actin filaments at one
intestinal lumen without disrupting barrier function (Knodler pole of the bacterium (Stevens et al., 2006). The pushing

Developmental Cell 56, 443–460, February 22, 2021 ª 2021 Elsevier Inc. 443
 ll
Article

Figure 1. Formation of infection mounds is accompannied by changes in the kinematics of L.m.-infected epithelial cell monolayers
(A and B) Orthogonal views of uninfected or L.m.-infected MDCK cells 24 hpi (host nuclei, yellow; L.m., black). In (B) a mound is shown.
(C) Barplots of L.m. mound volume for MDCK (n = 77), A431D (n = 5), and human ileal enteroid-derived cells (n = 9) 24 hpi (mean ± SD).
(D and E) 3D displacements of MDCK cell nuclei from uninfected (D) or L.m.-infected well (E, field of view centered in mound). Nuclei tracked 24–44 hpi.
Trajectories colored by time.
(F) Violin plot of mean nuclear speed of MDCK cells from uninfected or L.m.-infected wells centered in mounds ( n = 271 ± 65 tracks/experiment for 5 independent
experiments).
(G and H) Plots of weighted average for each time delay of all MSD curves of MDCK nuclei shown in examples in (D and E) (gray, weighted SD over all MSD curves;
error bars, SEM; red line, weighted mean MSD curve from which diffusion coefficient D is calculated; see STAR methods). Fit made in first 500 min. (G) shows
zoomed inset.
(I and J) Same as (F) for the average D (I) and scaling exponent a (J). (F, I, and J) dashed line, median; dotted lines, 25% and 75% quartiles of all tracks. For each of
the 5 independent experiments the average value over the field of view and time shown as triangle (mean ± SD, USTT: *p < 0.01). See also Figure S1; Video S1.

444 Developmental Cell 56, 443–460, February 22, 2021

 ll
Article

Figure 2. MDCK cells in L.m.-infected wells alter their morphology, orientation and cytoskeletal organization
(A) MDCK cells from uninfected and L.m.-infected wells 24 hpi. Columns, brightfield image; L.m., fluorescence, cells color coded by area, and radial alignment q
(see STAR methods). Purple circle surrounds mound. 4th column shows zoomed-in view.

(legend continued on next page)

Developmental Cell 56, 443–460, February 22, 2021 445

 ll
Article

forces generated by the actin network assembly propel the propose that coordinated mechanical forces may be a mech-
bacteria through the host cell cytoplasm and into membrane- anism employed by host epithelial cells to eliminate bacterial
bound protrusions at the host cell surface (Tilney and Portnoy, infection.
1989). In an epithelial monolayer, these protrusions facilitate
bacterial intercellular spread without causing lysis of the orig- RESULTS
inally infected cell (Lamason and Welch, 2017). Actin-driven
spread of L.m. in epithelia gives rise to infected foci Infection with Listeria monocytogenes (L.m.) alters the
comprising hundreds of cells within <24 h after the initial inva- organization and kinematics of host epithelial cells to
sion of a single cell (Ortega et al., 2019). In this situation, extru- form large multicellular mounds
sion of single infected cells using a ‘‘purse string’’ might be To study the effects of infection on the kinematics of host cells,
insufficient to limit infection. we used epithelial Madin-Darby canine kidney (MDCK) cells.
Infection of epithelial cells by many pathogens triggers acti- They form polarized monolayers in culture and are often
vation of the transcription factor, NF-kB (Dev et al., 2011). In used to study L.m. infection (Ortega et al., 2019; Pentecost
cells at rest, NF-kB is inactive and retained within the cyto- et al., 2006; Robbins et al., 1999). We grew MDCK cells to
plasm. During infection, pathogen-associated molecular pat- confluence and infected them with L.m. such that fewer than
terns initiate signal transduction cascades that lead to NF-kB 1 in 103 host cells were invaded. Cells were maintained with
activation and translocation into the nucleus. There, it induces gentamicin so that L.m. could only spread from cell to cell.
expression of genes encoding cytokines and adhesion mole- Over a period of 24–48 h, infected cell foci grew to include
cules, promoting the recruitment of immune cells to the infec- hundreds of host cells. MDCK cells in uninfected monolayers
tion site (Jiang et al., 2011). For several intracellular bacterial exhibited regularly spaced nuclei confined to a single layer
pathogens, including L.m., infection of epithelial cells in a (Figure 1A). In contrast, L.m.-infected foci formed mounds of
monolayer triggers NF-kB activation and cytokine production infected host cells, which piled on top of one another to form
not only in the infected cells but also in nearby uninfected structures
50 mm tall, with a volume of
1.7 3 105 mm3 (Fig-
bystander cells (Dolowschiak et al., 2010; Kasper et al., ures 1B, 1C, and S1A–S1C). We also observed the formation of
2010). The bystanders may play a role in the innate immune mounds in monolayers of human epithelial A431D cells ex-
response to infection by amplifying alarm signals produced pressing E-cadherin and untransformed human enteroid-
by infected cells. derived cells (Figures 1C, S1D, and S1E). Thus, infection
To determine whether epithelial monolayers alter their mound formation may be a widely conserved phenomenon
biomechanics in order to limit pathogen spread, we used for mammalian epithelial monolayers, including both cell lines
time-lapse microscopy to monitor individual infected cell foci and untransformed cells.
for several days after exposure to L.m. or R.p. For both path- Mounds arose due to directional movement of the host cells,
ogens, uninfected neighbor cells undergo a dramatic behav- as evidenced by monitoring the movement of their nuclei via
ioral change reminiscent of the epithelial-to-mesenchymal time-lapse microscopy from 24 h post-infection (hpi) onward.
transition (EMT) and act collectively to squeeze and force the Cells from uninfected wells moved randomly at low speed and
extrusion of large infected cell domains, forming ‘‘mounds.’’ appeared to be confined by their neighbors (Figure 1D). In
Mounds arise due to changes in the mechanics of two battling contrast, L.m.-infected cells within foci and their uninfected
populations—the uninfected ‘‘surrounders’’ and the infected neighbors moved rapidly and persistently toward the center of
‘‘mounders.’’ Innate immune signals, and specifically NF-kB the focus and infected cells also moved upward to form the
activation, are major drivers in this mechanical competition. 3D mound (Figure 1E; Video S1). Net speeds inside and near
Importantly, cells infected with wild-type (WT) R.p. do not acti- L.m.-infected foci increased by 3-fold relative to uninfected
vate NF-kB or form mounds whereas R.p. mutants lacking the monolayers and cell tracks became straighter (Figures 1F and
outer membrane protein B (OmpB), activate NF-kB and do S1F). Over an observation period of 16 h, the average mean
form mounds. Our results demonstrate that the mechanical squared displacement (MSD) for cells from an uninfected well re-
changes in epithelial cells leading to mounds are not simply mained under 50 mm2 (
7 mm net displacement). Movement was
a result of cytoskeletal remodeling associated with infection constrained, with the MSD reaching a plateau rather than
but are triggered by innate immune signals. Moreover, our increasing linearly with time as in unconstrained, random move-
findings connect EMT, a conserved cell behavioral transforma- ment (Figure 1G). In contrast, the average MSD for cells in and
tion critical in development and pathologies (e.g., fibrosis and near L.m. foci grew to over 1,000 mm2 over the same time frame
cancer), with innate immune mechanisms. They also underline and increased superdiffusively, indicative of directed motion
the dynamic remodeling capability of epithelia and lead us to (Figures 1H–1J). Thus, cells undergo a behavioral phase

(B) Sketch showing that radial alignment is the angle q between the direction of the cell’s major axis and the axis between the cell centroid and the mound center.
(C) Mean q versus distance from the center of the field of view of cells from uninfected or L.m.-infected wells for the example shown in (A) (solid line, median;
shaded areas, 40, 60 percentiles).
(D) Violin plot of aspect ratio of cells from uninfected wells (n = 5,817), uninfected surrounders (n = 5,163, considered up to ~200 mm away from mound), and
infected mounders (n = 1,248). Dashed line, median; dotted lines, 25%, 75% quartiles. For each of the 3 independent experiments the average value over the field
of view is shown as triangle (mean ± SD, USTT: *p < 0.05).
(E) Orthogonal views of MDCK cells from uninfected or L.m.-infected wells 24 hpi (host nuclei, yellow; L.m., black) and corresponding F-actin or vimentin
localization. See also Figure S2.

446 Developmental Cell 56, 443–460, February 22, 2021

 ll
Article

A Phase contrast L.m. B Phase contrast L.m.

cell competition

no competition
20% infection

100% infection
C Phase contrast L.m. √ux2+uy2 (μm) Stresses (Pa) towards u (μm) away from Overlay of
center r center
0 0.5 1 0 100 200 -1 0 1 ur and L.m.
t=4 hpi

50 μm
t=8 hpi
t=12 hpi
t=16 hpi
t=20 hpi
t=24 hpi

D Mean radial ur (μm) Mean L.m. fluorescence E 60 F *

-0.4 0 0.4 0 2000 * * *
2.0
Fold increase in infected

Cellular stiffness (kPa)

10
cells relative to 8 hpi

20 40 1.5
Time (hpi)

30 *
40
50 1.0
60 20
70 0.5
80
90
0 100 200 300 0 100 200 300 0 0
in ers
ed

nd d
s

Distance from center (μm) time (hpi) 24 24 48 48

ou te
er
d
ct

un

m c
fe

washes - + - +
f
in

rro
un

su

(legend on next page)

Developmental Cell 56, 443–460, February 22, 2021 447

 ll
Article

transition, switching from a caged state to a highly motile state at Video S2). In contrast, the radial deformations, ur, of surround-
late stages of infection. ers at the edge of the mound were large, indicative of them
Changes in kinematics were accompanied by alterations in grabbing the ECM and pulling it away from the mound as
cell morphology. In uninfected monolayers, MDCK cells formed they move directionally toward it. This traction stress orienta-
randomly oriented regularly packed polygons (Figures 2A and tion is not consistent with extrusion generated by a ‘‘purse
S2A). In infected monolayers, infected cells at the mounds’ string’’ but is consistent with lamellipodial protrusion and
base (mounders) had smaller z-projected areas than uninfected directed cell migration (Kocgozlu et al., 2016). Thus, mounds
cells (surrounders), up to 200 mm away from the mounds or cells are not caused by contraction of infected cells but rather by
from uninfected wells (Figures 2A and S2C). Strikingly, the orien- active crawling of uninfected surrounders that migrate toward
tation of the long axis of surrounders pointed toward the mound the focus, squeezing and extruding the infected cells. Kymo-
center, and this persisted over 150 mm away from the mound graphs of ur and L.m. fluorescence as a function of radial dis-
(Figures 2A–2C). Surrounders showed alignment of their long tance from the mound’s center further confirmed that the
axes parallel to that of their immediate neighbors, indicative of largest ur coincided with the edge of the infection focus (Fig-
local nematic order in the monolayer (Figure S2B). The aspect ures 3D, S3A, and S3B). This behavior persisted up to
ratio and shape factor q (perimeter divided by square root of 54 hpi, with the peak of forces moving outward as the infection
area), dimensionless numbers used to characterize cell shapes focus grew. After 54 hpi the peak L.m. fluorescence started to
in EMT (Mitchel et al., 2019), were also increased in cells from decay. This could be due to the extrusion of infected cells and
infected wells relative to uninfected wells (Figures 2D and the inability of the bacteria they carry to spread to new unin-
S2D). To determine whether these changes are due to cytoskel- fected cells in the basal cell layer. To explore this further, we
etal rearrangements associated with infection, we performed infected cells with fluorescent L.m. and measured the effect
immunostaining (Figure 2E). While F-actin localized pericellu- of repetitive washes (to get rid of extruded cells) on the recov-
larly for cells in uninfected wells, in infected wells, cells con- ery of infected cells from the monolayer. We found that late in
tained less pericellular actin. Actin tails were visible in infected infection, half of the infected cells had been extruded into
cells and surrounders showed prominent stress fibers. Microtu- mounds (Figure 3E).
bules were disrupted in infected cells at the mounds’ base, as Infected cells might generate reduced traction because of
were intermediate filaments, vimentin and cytokeratin (Figures secreted L.m. virulence factors that weaken cellular tension,
2E, S2E, and S2F). The cytoskeletal changes of mounders such as the internalins C (InlC) (Rajabian et al., 2009) and P
versus surrounders are consistent with the display of distinct (InlP) (Faralla et al., 2018). To test this, we infected MDCK
mechanical properties of these cells that could contribute to with DinlC or DinlP L.m. but found no difference in resulting
mounding. Alternatively, these changes could be the result of mound volumes (Figures S3C–S3E). Since the listeriolysin O
mounders being squeezed and extruded and not the cause of toxin (LLO) could also modulate mechanotransduction, we in-
mounding. fected cells with LLOG486D L.m. (Rengarajan et al., 2016). This
led to formation of smaller mounds; however, the total L.m.
Mechanical cellular competition drives infected cell load was also decreased comparably to the degree of mound
extrusion en masse volume reduction. These results suggest that the functions of
To test whether mounding requires competition between two known secreted bacterial virulence factors do not drive the
cell populations, we compared MDCK cells infected with cellular changes that lead to mechanical competition and
low (
20% infected at 24 hpi) and high (
100% infected at mounds.
24 hpi) multiplicity of infection (MOI). Although mounds were The weakening in mounders’ tractions could be due to
visible at low MOI, they were absent in wells infected at high changes in their cytoskeletal integrity, resulting in a reduced
MOI (Figures 3A and 3B). This suggests that mounding may ability to transmit forces. To determine whether cell stiffness
not be a consequence of the loss of cell mechanical integrity changes during infection, we used atomic force microscopy
by infected cells but instead may require the involvement of (AFM). We found that surrounders’ stiffness was 4-fold higher
uninfected surrounders in a form of mechanical competition. than that of mounders (Figure 3F). As compared with cells
To test this, we used traction force microscopy (TFM) to mea- from uninfected wells, surrounders were 2.5-fold stiffer and
sure the forces exerted by cells on a soft 3 kPa hydrogel. We mounders 1.6-fold softer, consistent with the cytoskeletal
found that, as the infection focus grew, infected cells imparted disruption of infected cells at the mounds’ base noted in Fig-
reduced deformations and stresses onto their ECM (Figure 3C; ure 2D. In summary, we found that infected cells became softer

Figure 3. Infection with low bacterial dosage elicits a mechanical competition between uninfected and L.m.-infected cells
(A and B) Phase contrast images 24 hpi of MDCK cells and corresponding L.m. fluorescence for wells that are 20% or 100% infected.
(C) TFM on MDCK cells adherent on 3 kPa hydrogel and infected at low MOI with L.m. Columns, phase contrast image, L.m. fluorescence, deformations (mm),
traction stresses (Pa), radial deformations (ur: positive values indicate deformations pointing away from the focus center), and overlay of ur and L.m. fluorescence.
Rows, p.i. time.
(D) Kymograph of mean ur and radial L.m. fluorescence as a function of time. The infection focus center is considered the center of the polar coordinate system.
(E) Boxplots of fold increase relative to 8 hpi in % of L.m.-infected MDCK cells (flow cytometry). Cells were washed (or not) to get rid of extruded cells (n = 6
samples, mean ± SD, WRST, *p < 0.01).
(F) Violin plots of cell stiffness (kPa) for MDCK cells from uninfected wells (n = 68), surrounders (n = 126), and mounders (n = 130). Cells were indented 2–8 times.
Dashed line: median, dotted lines: 25% and 75% quartiles. For each cell, its average stiffness is shown as triangle (mean ± SD, WRST: * p < 0.01). See also
Figure S3; Video S2.

448 Developmental Cell 56, 443–460, February 22, 2021

 ll
Article

A B C *
* Nuclei L.m. Nuclei L.m. /Y-27632 3
* *

Relative mound volume

Relative mound volume

* 40 μm
2 19 μm
2

1
1

0 0
in
2

eb 52
l

D O
l
tro

M cad
tro
63

at

K
M at K
1

C
st
on

27

on

K
-1

KD E-
D
bi

C
H
C

c
Y-

αE
Bl

D E
Nuclei L.m. αEcat KO nuclei, L.m. 200 ns

Fold increase in infected

36 μm 26 μm

cells relative to 8 hpi

150

100
ns

50

0
time (hpi) 24 24 48 48
washes - + - +
F Phase contrast L.m. √ux2+uy2 (μm) Stresses (Pa) towards ur (μm) away from Overlay of
center center
αEcat KO MDCK 0 0.05 0.1 0 25 50 -0.1 0 0.1 ur and L.m.
t=4 hpi
t=12 hpi
t=20 hpi
t=28 hpi

Figure 4. Actomyosin contractility and cell-cell adhesions contribute to mound formation

(A) Barplots of relative L.m. mound volume 24 hpi for MDCK cells treated with 30 mM of Y27632, 1 mM of H1152, or 50 mM of blebbistatin. For each experiment,
values are normalized relative to the control mound volume (mean ± SD, WRST, * p < 0.01).
(legend continued on next page)
Developmental Cell 56, 443–460, February 22, 2021 449
 ll
Article

and less contractile than cells in uninfected monolayers. MDCK cells expressing E-cadherin-RFP (to distinguish popu-
Concurrently, nearby uninfected cells became stiffer and direc- lations) in varying ratios. When 75% of host cells were WT,
tionally polarized, gripped the substrate, and actively pulled on mounds resembled 100% WT monolayers. In contrast, when
it to move themselves directionally toward the focus. This 75% of cells were aEcat KO, mounds were reduced and
competition resulted in infected cells being squeezed and resembled 100% aEcat KO monolayers (data not shown).
ejected from the monolayer plane. Intriguingly, the higher the percentage of aEcat KO in the in-
fected monolayer the lower the correlation length of movement
Cell-cell adhesions and actomyosin contractility between neighboring cells, suggesting that lack of coordi-
contribute to infection mounds nated cell movement may inhibit mounding (Figure S4J). Inter-
As mounders and surrounders differ in their biomechanics, we estingly, when cells were mixed 1:1, we only observed
hypothesized that perturbations of cellular forces should inhibit mounds in foci where infected mounders and immediate
mounds. When L.m.-infected MDCK cells were treated with surrounders were predominately WT, while cells further away
ROCK inhibitors, Y-27632 and H1152, or the myosin II inhibitor, from the mound were of either lineage (Figure S4K). This
blebbistatin, to decrease actomyosin contractility and cellular result, further explored below through simulations, suggests
tractions, we found a reduction in mound volume (Figures 4A, that the presence of functional E-cadherin-based junctions,
4B, and S4A). We then examined the role of intercellular forces at least in the infected mounders and the uninfected cells
by infecting MDCK cells deleted for aEcatenin (aEcat KO) (Or- immediately surrounding the mound, is necessary for mounds
tega et al., 2017) or knocked down for E-cadherin, with L.m. and to emerge.
found a dramatic reduction in mound volume (Figures 4C, 4D,
and S4B). Compared to WT MDCK, the speed of aEcat KO cells Simulations suggest that cell stiffness, contractility and
was increased but directional persistence and neighbor coordi- intercellular adhesions are critical for mound formation
nation were decreased (Figure S4C), suggesting that coordina- To explore the mechanism whereby changes in cell mechanics
tion of movement of neighboring cells through robust contacts lead to the collective extrusion of infected cells, we followed a
is important for mounding. Moreover, we found that, as the infec- computational approach that formulated the problem in 3D. In
tion focus grew, differences in traction of infected versus unin- our simplified model, infected versus uninfected cells can have
fected cells were abrogated in aEcat KO MDCK cells (Figure 4F; distinct mechanical properties, but infection is fixed (bacteria
Video S3). These findings confirm that cell-cell and cell-ECM do not spread/replicate). Cells are hexagonal, can deform in all
forces are tightly coupled and that a difference in force transduc- directions, are divided into 3 domains (contractile, adhesive,
tion between the two populations is important for mounds to protruding), and have both a passive stiffness arising from the
emerge. cytoskeleton and an active contractility associated with the acto-
Interestingly, L.m. infection foci for aEcat KO cells myosin contractile apparatus (Figures 5A and S5A–S5C; Sunyer
(compared with WT MDCK) were larger and had increased to- et al., 2016). Cell-ECM interactions are considered through
tal L.m. fluorescence but were less dense in fluorescence in- contact interactions and cell-cell adhesions as a continuous
tensity (Figures S4D–S4F). Consistently, we found that the material, following the mechanism depicted in Figure S5A. If
fold increase in L.m.-infected aEcat KO cells 24 and 48 hpi cell-ECM displacements are large when cells contract, new
relative to 8 hpi was higher as compared with infected WT cell-ECM adhesions are formed. If cell-ECM displacements are
MDCK, and vigorous washing of the L.m.-infected aEcat KO small and there is tensional asymmetry, new protrusions form
monolayers did not reduce the percentage of infected cells at the edge of the cells that are experiencing minimum stress, fol-
(compare Figures 3E and 4E), further supporting the conclu- lowed by another round of cell contraction. If there is no tensional
sion that bacterial spread through the monolayer is more effi- asymmetry, there is no protrusion and the given cell just
cient when mounds cannot form. To confirm the role of adhe- contracts.
rens junctions in L.m. spread and mounds, we infected human We assumed that infected cells decrease their passive stiff-
A431D cells, which mostly do not express E-cadherin, with ness and active contractility, based on our experimental results,
L.m. and found a similar inhibition of mound formation (Figures and examined 4 different cases (Figures 5A and S5D–S5F). In
S4G–S4H). case 1, all cells were uninfected, so during the contraction phase
To examine the organization of cell-cell adhesions in moun- cell displacements and principal stresses were symmetrical and
ders and surrounders, we performed immunostaining for E- thus cells did not create protrusions. However, in case 2, where a
cadherin and ZO-1 to localize adherens and tight junctions. cluster of 7 cells was infected, uninfected cells in close proximity
We found more fluorescent puncta of E-cadherin and moder- developed tensional asymmetry but as they were unable to form
ate disruption of ZO-1 for infected cells at the mounds’ base new cell-ECM adhesions they became displaced away from the
(Figure S4I). To explore the relative contributions of cell-cell focus’s center, which was opposite to what observed in our ex-
junctions in mounders versus surrounders, we then conducted periments. In contrast, in case 3, where we allowed uninfected
infections in monolayers of aEcat KO MDCK mixed with WT cells to form new cell-ECM adhesions during the protrusion

(B) Orthogonal views of L.m.-infected MDCK cells treated with vehicle control or 30 mM of Y27632 24 hpi (host nuclei, yellow; L.m., black).
(C) Barplots of relative L.m. mound volume same as (A) but for WT MDCK, aEcat KO MDCK or MDCK cells treated with siRNA against E-cadherin.
(D) Orthogonal views of WT or aEcat KO MDCK cells infected with L.m. 24 hpi.
(E) Boxplots same as in Figure 3E but for L.m.-infected aEcat KO MDCK cells (n = 6 samples).
(F) Same as Figure 3C but for L.m.-infected aEcat KO MDCK cells. See also Figure S4; Video S3.

450 Developmental Cell 56, 443–460, February 22, 2021

 ll
Article

(legend on next page)

Developmental Cell 56, 443–460, February 22, 2021 451

 ll
Article

phase, we found that uninfected cells in close proximity to in- fected cells (Figures 5B–5D). Surrounders performed less recoil
fected cells developed tensional asymmetry and were displaced than infected mounders on the opposite side of the wound.
toward the infection focus. This led to squeezing of the infected Active crawling to close the wound was observed in both in-
cells and an increase in their height. Finally, in case 4, where fected and uninfected cells. We also used our computational
intercellular adhesions were absent, there was no tensional model to examine predicted responses, which were consistent
asymmetry and thus no protrusions. Cases 3 and 4 were consis- with our experiments (Figure S5I). These findings first show that
tent with our experiments and suggest that surrounders need to the infected cells are capable of mounting a wound-healing
form protrusions and cell-ECM adhesions toward the infection response and that they move away from the focus center to-
focus for mounds to form, and that the lack of intercellular adhe- ward the wound margin. This reinforces that cell kinematics
sions prevents mounding. associated with mounding are specifically due to mechanical
We also examined what would happen if only one of the me- competition between surrounders and mounders, where
chanical parameters was altered in infected cells and found surrounders are stronger, even though mounders retain their
that, for mounds to arise, it is necessary for infected cells to normal ability to mount a directional wound-healing response
decrease their passive stiffness and/or active contractility while despite their infected status. Second, surrounders exhibit
forming robust cell-cell adhesions (Figures 5A and S5G, cases reduced intercellular tension relative to cells from uninfected
5 and 6). We also found that if only infected mounders and monolayers.
surrounders immediately adjacent to them (immediate surround-
ers) form cell-cell adhesions but uninfected cells further away do RNA sequencing reveals distinct transcriptional profiles
not, that is also sufficient to drive mounding (Figure S5H). How- among uninfected cells, infected mounders and
ever, in the opposite case where infected mounders and imme- surrounders
diate surrounders do not form cell-cell adhesions but uninfected To explore how signaling regulates the mechanical changes
cells further away do, mounding is stalled (Figure S5H). In both associated with mounding, we followed a transcriptomics
cases, cells that are unable to form intercellular adhesions create approach. L.m.-infected MDCK cells were flow sorted into
stronger cell-ECM adhesions and tensional asymmetry arises mounders (L.m.-positive) and surrounders (L.m.-negative),
when cells contract. However, the levels of stress and asymme- 24 hpi (Figure 6A). RNA sequencing revealed significant
try are different; thus, when protrusion takes place, mounds numbers of differentially expressed genes (DEGs) when
occur only in the first scenario. Therefore, cell-cell adhesions comparing these two groups to each other and to cells origi-
specifically for mounders and immediate surrounders are crit- nating from uninfected wells (Figures 6B and 6C; Table S1).
ical, since a lack of such adhesions inhibits mounding, consis- Compared to cells not exposed to infection, both mounders
tent with our experiments. and surrounders downregulated genes related to intercellular
and focal adhesions and to the regulation of the actin cytoskel-
Laser ablation demonstrates alterations in tension at eton (Figure 6D; Table S1). Genes whose changes in expres-
cell-cell junctions for infected epithelial monolayers sion are associated with EMT were differentially regulated for
Because simulations indicated the importance of tensional both populations originating from infected wells compared
asymmetries at junctions between infected cells and their unin- with cells not exposed to bacteria (e.g., MMP1, VIM, SNAI1,
fected neighbors, we sought to confirm these predictions by and SNAI2). Surprisingly, mounders showed upregulation in
performing laser ablation (Fernandez-Gonzalez et al., 2009; genes associated with DNA replication and ferroptosis, hinting
Joshi et al., 2010; Kiehart et al., 2000; Kong et al., 2019; at a stress response or death-related process that infected
Smutny et al., 2015). When we ablated rows of cells in unin- cells might undergo, which could be linked to mounding.
fected monolayers, we observed rapid, symmetric recoil of Indeed, using several approaches (see STAR methods) we
cells away from the wound on both sides, over the first few mi- confirmed that cells in mounds undergo death, which rein-
nutes after wounding (Figures 5B–5D). This response is indica- forces the idea that this process is beneficial for the host, since
tive of pre-existing cell-cell tension throughout the monolayer infected cells are being cleared out of the monolayer (Figures
and was followed by active crawling of cells to close the S6A–S6E) and which raises the question of whether cell death
wound. However, the magnitude of the immediate recoil in precedes or follows extrusion.
response to the ablation for cells at the margin of L.m.-mounds Surrounders and to a lesser degree mounders showed upre-
was markedly asymmetric and substantially less than for unin- gulation of genes associated with the IL-17, NF-kB, and TNF

Figure 5. Simulations reveal that changes in cell stiffness, contractility, and intercellular forces drive mound formation, and laser wounding
reveals that tension is reduced in infection
(A) Cases: (1) all cells uninfected, (2–3) infected cells (denoted with asterisk) are softer and uninfected cells cannot (2) or can (3) create new cell-ECM adhesions, (4)
infected cells are softer but cell-cell adhesions are disrupted, (5–6) infected cells reduce only their contractility (5) or passive stiffness (6) and uninfected cells form
new ECM adhesions. Plots show cell displacements in the vertical (Z) direction in two views.
(B) Laser wounding response for MDCK cells from uninfected (top) or L.m.-infected wells (bottom) 24 hpi. Columns, brightfield image superimposed with L.m.
fluorescence (green); corresponding E-cadherin localization prior to wounding (t = 0 min); E-cadherin localization immediately after 1 min of laser illumination
(t = 1 min); cell displacement vectors u (50-fold larger); average uy at t = 1 min (positive/negative values point toward/away from wound); average uy over the time
period 30–40 min.
(C) Kymographs of the average, with respect to the wound, uy as a function of time, t and vertical position, y for the examples in (B) (see single and double crosses).
(C) Barplots of the mean uy (along a distance of 100 mm away from the wound, calculated immediately after ablation) for cells originating from uninfected wells,
surrounders and infected mounders (results from 3 independent experiments, mean ± SD, USTT: *p < 0.01). See also Figure S5; Video S4.

452 Developmental Cell 56, 443–460, February 22, 2021

 ll
Article

(legend on next page)

Developmental Cell 56, 443–460, February 22, 2021 453

 ll
Article

innate immune signaling pathways, and NF-kB activation in have been implicated in the regulation of EMT genes such as
infection was further confirmed through western blotting (Fig- SNAI1 (Li et al., 2017; Pires et al., 2017; Strippoli et al.,
ure S6F). This indicates that, although surrounders are not them- 2008; Tian et al., 2018; Weichhart et al., 2015) and given the
selves infected with L.m., their distinct mechanical behavior 6- and 9-fold increase in SNAI1 expression in surrounders
might arise from cytokines released in infection, which influence and mounders, respectively, as compared with cells from unin-
their phenotype, gene expression, and mechanics. Indeed, we fected cultures, we also knocked down SNAI1 in MDCK cells
found that the supernatant of cells infected for 24 h with L.m. (Figure S7F) and found a
50% decrease in mound volume
had enriched GM-CSF, IL-8, and MCP-1 compared with the su- (Figures 7D, 7E, and S7F). Since reactive oxygen species
pernatant of uninfected cells (Figure 6E). Interestingly, gene (ROS) and nitric oxide species (NOS) could be generated in
expression of these cytokines was upregulated to a greater cells in L.m.-infected wells and trigger NF-kB activation (Gouin
extent in surrounders compared with mounders (Figure 6F; Table et al., 2019; McFarland et al., 2018; Morgan and Liu, 2011), we
S1). All three cytokines are associated with NF-kB signaling, treated cells with diphenyleneiodonium (DPI) and L-NIL that
either being NF-kB activators or expressed and secreted in inhibit ROS and NOS generation, respectively, and found a sig-
response to it, or both (Hoesel and Schmid, 2013; Kang et al., nificant reduction in mound volume only for cells where ROS
2007; Manna and Ramesh, 2005). To assess whether cytokine production was inhibited (Figures S7G and S7H). We also
signaling alone, without actual infection, can induce changes in used the DCFHA assay to assess ROS generation and found
cell polarization and nematic order as observed in surrounders, a small increase in DCF fluorescence, indicative of ROS gener-
we exposed MDCK cells to conditioned media from L.m.-in- ation, for cells originating from L.m.-infected wells compared
fected wells for 24 h and found that the area and aspect ratio with uninfected wells (Figure S7I). Overall, these results sug-
of these cells were both greater than that of control cells (Figures gest that innate immune signaling through NF-kB activation,
S6G and S6H). Thus, at least part of the response and collective possibly driven by ROS production, and the subsequent cyto-
behavioral change of the surrounders is due to paracrine kine signaling play a role in promoting mounds, contributing to
signaling. loss of mechanical stiffness in mounders, and triggering cell
shape changes and motility responses similar to EMT in
Apoptosis inhibition does not attenuate mounds, but surrounders.
perturbations in NF-kB signaling do If our conclusion that NF-kB activation contributes to
Given that infected cells undergo cell death, we tested whether mounds is correct, then we would also observe mounds if we
this was required for mounding by treating infected monolayers were to infect MDCK cells with a different intracellular bacterial
with either Z-VAD-FMK or GSK0 872 3, which inhibit apoptosis pathogen that activates NF-kB. To test this, we infected MDCK
or necroptosis, respectively, associated with L.m. infection cells with WT R.p. or the ompB mutant (Figures 7F and 7G).
(Zhang and Balachandran, 2019). We found that mounds OmpB protects the rickettsial surface from ubiquitination in
were similar in volume to control mounds (Figures 7A and the cytoplasm of infected host cells (Engström et al., 2019),
7B), suggesting that cell death occurs after infected cell extru- and when S.Tm. become ubiquitinated, NF-kB is activated
sion and not before. (Noad et al., 2017). We thus hypothesized that ompB R.p.
Since NF-kB-related pathways were upregulated in cells would trigger NF-kB activation, whereas WT R.p. would not.
originating from infected wells, we tested whether inhibiting Observation of NF-kB nuclear translocation and RT-PCR on
NF-kB with the NF-kB essential modulator (NEMO)-binding NF-kB target genes confirmed this hypothesis (Figures 7H,
peptide would affect mound volume, and found a
25% S7A, and S7B). Importantly, host cells infected with ompB
reduction compared with control mounds (Figures 7C and R.p. formed mounds, while those infected with WT R.p. did
7E). Inhibition of NF-kB was confirmed through western blot- not, and ompB R.p. mounds were inhibited by treatment
ting and immunostaining (Figures S6F, S7A, and S7B). More- with the NEMO-binding peptide (Figures 7F and 7G). Similar
over, treatment of infected cells with the NEMO-binding pep- to L.m. mounds, we found that ZO-1 localization was perturbed
tide suppressed the loss of vimentin from the cells at the for ompB R.p. mounds but not for WT R.p.-infected MDCK
mound’s base, to a comparable extent as the loss of cell-cell cells which resembled cells from uninfected wells (Figure S7J).
junctions (Figures S7C–S7E). This is consistent with the idea Also, similar to L.m.-infected MDCK cells, the supernatant
that cytoskeletal changes associated with the decrease in pas- coming from ompB R.p.-infected MDCK was 2-fold richer in
sive stiffness of infected cells might be downstream conse- MCP-1 compared with supernatant from WT R.p.-infected
quences of NF-kB activation. As both MCP-1 and NF-kB MDCK and uninfected cells (Figure 7K). Together, these results

Figure 6. Infected mounders, surrounders, and cells from uninfected wells display distinct transcriptional profiles
(A) Sketch of the RNA-sequenced MDCK cell populations (n = 4 replicates): cells from uninfected well, L.m.-positive and L.m.-negative cells from infected well.
(B) Volcano plots of DEGs. The log10 p values are plotted against the average log2-fold changes in expression. For each pair of conditions compared, upre-
gulated genes of each group are shown in the corresponding color.
(C) PCA on top genes that have ANOVA p value % 0.05 on FPKM abundance estimations. PC1 versus PC3.
(D) Pathway enrichment analysis. Infected mounders or surrounders are compared with uninfected cells based on their enrichment score (log10p).
(E) Barplots of cytokine concentration in the supernatant of cells originating from an uninfected or L.m.-infected well 4 or 24 hpi (n = 8 samples originating from
2 independent experiments, mean ± SD, WRST: *p < 0.01).
(F) Barplots of gene expression of CSF2, CXCL8, and CCL2 for infected mounders or surrounders compared with cells from uninfected wells (n = 4, mean ± SD,
WRST: *p < 0.01). See also Figure S6.

454 Developmental Cell 56, 443–460, February 22, 2021

 ll
Article

A ns B Nuclei L.m. Nuclei L.m. /GKS'872 Nuclei L.m. /Z-VAD-FMK

ns
Relative mound volume

3 33 μm 30 μm 30 μm

0
72
l

K
tro

M
'8
on

-F

30 μm
KS

D
C

VA
Z-

C D E Nuclei L.m.
NEMO binding peptide SNAI1 KD nuclei L.m.
*
Relative mound volume

Relative mound volume

2.0 * 3
20 μm 19 μm

1.5
2
1.0
1
0.5

0.0 0
g

C KD
pe O b ol

l
id din

tro
tr
EM on

M AI1

30 μm
on
pt n

K
i
e
C

SN
D
N

F Nuclei ompB- R.p. G

Nuclei WT R.p. 15
ns
Relative mound volume
28 μm
*
12 μm
ns
10 *

0
R.p. WT ompB- WT ompB-
15 μm NEMO-binding
- - + +
peptide

H NFKBIA ICAM1 CXCL8 SNAI1 SNAI2

4 2.0 * * 4
*
Relative expression

* 80 2.0
* *
* 3 *
3 * 1.5 * 1.5
* 60
ns ns ns
2 1.0 2 * 1.0
40 * *
ns *
1 0.5 20 1 0.5
ns
0 0.0 0 0 0.0
bacteria - L.m. - R.p. ompB- - L.m. - R.p. ompB- - L.m. - R.p. ompB -
- L.m. - R.p. ompB- - L.m. - R.p. ompB-
time (hpi) 24 72 24 72 24 72 24 72 24 72

Figure 7. NF-kB activation contributes to mounding for two unrelated bacterial pathogens
(A) Barplots of L.m. mound volume 24 hpi for MDCK cells treated with 5 mM GSK0 872, or 100 mM Z-VAD-FMK relative to control mound volumes (mean ± SD,
WRST: *p < 0.01).
(B) Orthogonal views of L.m.-infected MDCK cells treated with vehicle control, 5 mM GSK0 872, or 100 mM Z-VAD-FMK (host nuclei, yellow; L.m., black).

(legend continued on next page)

Developmental Cell 56, 443–460, February 22, 2021 455

 ll
Article

support that cellular changes in mechanics associated with nessed in the context of bacterial infection to contribute to
mounds are not simply a result of cytoskeletal alterations clearance of infected cells and re-epithelization. Mechanical
driven by pathogens such as L.m. and R.p. that use actin competition between two cell populations, where one of
comet tails for intercellular spread. Rather, NF-kB signaling is them loses and gets eliminated, have been studied during
key to eliciting the mechanical competition between infected oncogenesis and various processes are thought to lead to
and uninfected cells that leads to mounds and collective clear- the elimination of the losers (Matamoro-Vidal and Levayer,
ance of infected cells in epithelial monolayers. 2019)Hogan et al. (2009); Wagstaff et al. (2016). Here, we
found that paracrine signaling that arises due to infection is a
DISCUSSION major driver, consistent with previous studies on viral infection
of epithelia (Abaitua et al., 2013; Beerli et al., 2019). Differential
Mechanical forces drive the remodeling of tissues during sensitivity to mechanical stress is also key, since both cell stiff-
morphogenesis and homeostasis (Ohsawa et al., 2018). In ness and tractions are dramatically different between moun-
the epithelium, these forces promote cell extrusion to prevent ders and surrounders. Notably though, mounders remain
accumulation of excess or unfit cells (Grieve and Rabouille, capable of initiating a migratory wound-healing response,
2014; Gudipaty and Rosenblatt, 2017). Infection of epithelial demonstrating that they are not mechanically passive but
monolayers with intracellular bacterial pathogens also triggers rather that they cannot resist the coordinated onslaught by
extrusion of single infected cells, which represents an innate surrounders. Other signals may also contribute to coordinated
immune protective mechanism of the host (Knodler et al., behavior of surrounders. For example, the MEK-ERK axis has
2014; Sellin et al., 2014), although in some cases it contributes been implicated in the collective extrusion of UV-treated cells
to bacterial spread (Knodler et al., 2010). Here, we describe a (Aikin et al., 2019) and of virally infected cells (Beerli
collective mechanical response of epithelial monolayers, et al., 2019).
actively forming mounds that can contribute to the clearance In this work, we are intrigued by the central role of NF-kB in
of domains comprising hundreds of infected cells. We argue mound formation for both L.m. and R.p. because of its involve-
that this is beneficial for the host, since bacteria carried by ment in the host’s innate immune response to infection by many
extruded cells cannot spread along the basal monolayer, pathogens (Dev et al., 2011). Studies have shown that L.m.
limiting the growth of the infection focus. Additionally, extruded infection of certain cell types leads to NF-kB activation (Rahman
cells undergo death, probably due to their forcible separation and McFadden, 2011), although the specific trigger(s) from the
from survival signals communicated to normal epithelia by bacterial side may vary (Drolia et al., 2018; Gouin et al., 2010;
direct contact with their basement membrane. In the geometry Mansell et al., 2000). ROS promotes intercellular communica-
associated with the primary site of L.m. infection in mammalian tion in infection (Dolowschiak et al., 2010) and signaling that
hosts, the small intestine, the extrusion of infected cells would leads to NF-kB activation in L.m.-infected cells (Herb et al.,
drive their shedding into the intestinal lumen, where they could 2019). We found that ROS are involved in L.m.-mounding but
be eliminated from the body via the fecal route. Intriguingly, whether they act upstream of NF-kB is yet to be determined.
bacterial infections in the intestine of Drosophila melanogaster, In our experiments, we did not observe NF-kB activation in
a model for human intestinal infection (Apidianakis and Rahme, MDCK cells infected with WT R.p., which correlated with lack
2011), trigger massive remodeling of the intestinal epithelium, of mounds, in contrast to L.m.- and ompB R.p.-infected cells.
featuring elimination of infected cells and replacement of This provides one rationale as to why many pathogens,
damaged tissue by remodeling (Buchon et al., 2010). Likewise, including viruses, that are highly adapted to an intracellular life-
infection of epithelia with intracellular viral pathogens increases style and specifically those that are capable of non-lytic intercel-
polarization and motility of uninfected cells, leading to mounds lular spread, may have evolved mechanisms to suppress activa-
of infected cells in vitro and in vivo (Abaitua et al., 2013; Beerli tion of immune signaling pathways that otherwise would lead
et al., 2019). to mounds (Rahman and McFadden, 2011; Reddick and
In our system, mound extrusion depends on active crawling Alto, 2014).
of uninfected cells surrounding the infection focus, with those Our discovery underscores the importance of mechanics in
uninfected cells becoming morphologically polarized and nem- regulating infection and the relationship between innate im-
atically ordered. Both the softer and less contractile infected mune signals and cellular biomechanics, specifically EMT.
cells of the mound and their uninfected neighbors undergo a Intriguingly, NF-kB activation is linked to EMT in contexts not
biomechanical transition reminiscent of EMT (compare Yang involving infection (Strippoli et al., 2008; Tian et al., 2018).
et al., 2020), suggesting that EMT can be specifically har- Studying the dynamics of these signals using live-cell

(C) Barplots similar to (A) of relative L.m. mound volume for cells treated with 50 mM of NEMO-binding peptide.
(D) Barplots similar to (A) of relative L.m. mound volume for MDCK cells treated with siRNA against SNAI1 compared to control non-targeting siRNA.
(E) Orthogonal views of L.m.-infected MDCK cells treated with 50 mM of NEMO-binding peptide (left) or siRNA against SNAI1 (right).
(F) Orthogonal views of WT R.p.- or ompB R.p.-infected MDCK cells 72 hpi.
(G) Barplots of mound volume 72 hpi for MDCK cells infected with WT R.p. or ompB R.p. (n = 2 experiments) treated (or not) with the NEMO-binding peptide
relative to control mound volume (n = 1 experiment) (mean ± SD, WRST, *p < 0.01).
(H) Boxplots of relative levels of NF-kB target genes obtained by RT-qPCR for MDCK cells originating from uninfected or infected wells with L.m., WT R.p., or
ompB R.p. For infection with L.m. or R.p, expression levels are normalized relative to expression of control uninfected cells (n = 4, mean ± SD, t test: *p < 0.01).
See also Figure S7.

456 Developmental Cell 56, 443–460, February 22, 2021

 ll
Article

biosensors will further reveal the spatiotemporal crosstalk be- SUPPLEMENTAL INFORMATION
tween innate immunity and cell biomechanics. In this work, we
Supplemental Information can be found online at https://doi.org/10.1016/j.
propose a general cooperative epithelial extrusion mechanism,
devcel.2021.01.012.
that could quickly help limit the local spread of infection in
epithelia, particularly in the vulnerable surfaces of the lung
ACKNOWLEDGMENTS
and intestine, common sites of pathogen invasion where the
outside is separated from the inside of the body by a single We are grateful to Nigel Orme and Matthew Footer for preparation of the
epithelial monolayer. Whether these results can be recapitu- graphical abstract. We thank M. Footer, M. Walkiewicz, K. Kirkegaard, D. Kie-
lated in vivo in the presence of additional cells, varying ECM hart, J. Woodward, and members of the Theriot Lab for discussions and exper-
topography, and mechanical cues has not yet been explored. imental support. We thank A. Hayer for sharing code. We thank the Stanford
Continued investigation using more complex assays will un- Cell Sciences Imaging Facility for use of the Atomic Force Microscope as
well as National Center for Research Resources (NCRR), award number
cover the precise biomechanical signals that regulate infection
1S10OD021514-01. This research was supported by the Cell Analysis Facility
and how host cells modulate those by orchestrating an innate Flow Cytometry and Imaging Core in the Department of Immunology at the
immune response to clear infection. University of Washington. RNA-seq and RT-qPCR were performed by Arrays-
tar Inc. and multiplex immunoassay by PBL Assay Sciences. This work was
supported in part by NIH R01AI036929 (J.A.T.), NIH R01AI109044 (M.D.W),
STAR+METHODS
NIH R01AI104920 (J.G.S.), HHMI (J.A.T.), Spanish Government, award num-
ber RTI2018- 094494-B-C21 (J.G.A. and M.G.B.), and the American Heart As-
Detailed methods are provided in the online version of this paper sociation, award number: 18CDA34070047 (E.E.B.).
and include the following:
AUTHOR CONTRIBUTIONS
d KEY RESOURCES TABLE
d RESOURCE AVAILABILITY Conceptualization, E.E.B. and J.A.T.; methodology, E.E.B., J.A.T., M.D.W.,
B Lead contact P.E., M.G.B., F.S.-A., P.R., J.M.G.-A., M.S.O., and J.G.S.; software,
E.E.B., F.S.-A., and P.R.; investigation, E.E.B., P.E., M.J.G.-B., F.S.-A., P.R.,
B Materials availability
Y.-T.Y., and M.S.O.; writing–original draft, E.E.B., J.A.T., M.J.G.-B., F.S.A.,
B Data and code availability
and J.M.G.-A.; writing–review & editing, E.E.B., J.A.T., M.D.W., P.E.,
d EXPERIMENTAL MODEL AND SUBJECT DETAILS M.J.G.-B., F.S.-A., P.R., J.M.G.-A., M.S.O., J.G.S., and Y.-T.Y.; resources,
B Cell culture J.A.T., J.M.G.-A., M.D.W., and J.G.S.; supervision, J.A.T., J.M.G.-A.,
B Human ileal enteroid cells M.D.W., and J.G.S.
B Bacterial strains used in this study
d METHOD DETAILS DECLARATIONS OF INTEREST
B Bacterial growth conditions and infections
The authors declare no competing interests.
B Flow cytometry of MDCK epithelial cells infected with
L.m. Received: June 15, 2020
B MDCK cell transfection with siRNA Revised: November 2, 2020
B RT-PCR Accepted: January 20, 2021
B Fabrication of polyacrylamide hydrogels and traction Published: February 22, 2021
force microscopy (TFM)
B Atomic Force Microscopy (AFM) for determination of REFERENCES
cell stiffness
Abaitua, F., Zia, F.R., Hollinshead, M., and O’Hare, P. (2013). Polarized cell
B RNA isolation and RNA sequencing
migration during cell-to-cell transmission of herpes simplex virus in human
B Principal component analysis (PCA) and mRNA func- skin keratinocytes. J. Virol. 87, 7921–7932.
tion enrichment analysis Aigouy, B., Umetsu, D., and Eaton, S. (2016). Segmentation and quantitative
B Immunofluorescence microscopy analysis of epithelial tissues. Methods Mol. Biol. 1478, 227–239.
B Multiplexed magnetic Luminex cytokine immunoassay Aikin, T.J., Peterson, A.F., Pokrass, M.J., Clark, H.R., and Regot, S. (2019).
and data analysis Collective MAPK signaling dynamics coordinates epithelial homeostasis.
B Western blotting bioRxiv https://www.biorxiv.org/content/10.1101/826917v1#:
:text=ABST
B Measurement of reactive oxygen species (ROS) pro- RACT,decisions%20while%20maintaining%20barrier%20function.
duction &text=Overall%2C%20we%20show%20that%20the,behaviors%20to%
20maintain%20tissue%20homeostasis.
B Nuclear segmentation, tracking and characterization of
Apidianakis, Y., and Rahme, L.G. (2011). Drosophila melanogaster as a model
dynamics of motion
for human intestinal infection and pathology. Dis. Model. Mech. 4, 21–30.
B Cell segmentation and extraction of cell shape charac-
Bastounis, E., Meili, R., Álvarez-González, B., Francois, J., del Álamo, J.C.,
teristics
Firtel, R.A., and Lasheras, J.C. (2014). Both contractile axial and lateral traction
B Characterization of mound volume and infection
force dynamics drive amoeboid cell motility. J. Cell Biol. 204, 1045–1061.
focus area
Bastounis, E.E., Ortega, F.E., Serrano, R., and Theriot, J.A. (2018). A multi-
B Live/dead staining, TUNEL and BrdU assays well format polyacrylamide-based assay for studying the effect of extracel-
B Laser ablation experiments lular matrix stiffness on the bacterial infection of adherent cells. J. Vis.
B Computational modeling of cell monolayers during Exp. 137, 57361.
infection €schner, G., Mu
Beerli, C., Yakimovich, A., Kilcher, S., Reynoso, G.V., Fla €ller,
d QUANTIFICATION AND STATISTICAL ANALYSIS D.J., Hickman, H.D., and Mercer, J. (2019). Vaccinia virus hijacks EGFR

Developmental Cell 56, 443–460, February 22, 2021 457

 ll
Article
signalling to enhance virus spread through rapid and directed infected cell Hayer, A., Shao, L., Chung, M., Joubert, L.M., Yang, H.W., Tsai, F.C., Bisaria,
motility. Nat. Microbiol. 4, 216–225. A., Betzig, E., and Meyer, T. (2016). Engulfed cadherin fingers are polarized
Borau, C., Kamm, R.D., and Garcı́a-Aznar, J.M. (2011). Mechano-sensing and junctional structures between collectively migrating endothelial cells. Nat.
cell migration: a 3D model approach. Phys. Biol. 8, 066008. Cell Biol. 18, 1311–1323.

Buchon, N., Broderick, N.A., Kuraishi, T., and Lemaitre, B. (2010). Herb, M., Gluschko, A., Wiegmann, K., Farid, A., Wolf, A., Utermöhlen, O.,
DrosophilaEGFR pathway coordinates stem cell proliferation and gut remod- Krut, O., Krönke, M., and Schramm, M. (2019). Mitochondrial reactive oxygen
eling following infection. BMC Biol. 8, 152. species enable proinflammatory signaling through disulfide linkage of NEMO.
Sci. Signal. 12, eaar5926.
Co, J.Y., Margalef-Català, M., Li, X., Mah, A.T., Kuo, C.J., Monack, D.M., and
Amieva, M.R. (2019). Controlling epithelial polarity: a human enteroid model for Hoesel, B., and Schmid, J.A. (2013). The complexity of NF-kB signaling in
host-pathogen interactions. Cell Rep. 26, 2509–2520.e4. inflammation and cancer. Mol. Cancer 12, 86.

Crane, A.M., and Bhattacharya, S.K. (2013). The use of bromodeoxyuridine Hogan, C., Dupré-Crochet, S., Norman, M., Kajita, M., Zimmermann, C.,
incorporation assays to assess corneal stem cell proliferation. Methods Mol. Pelling, A.E., Piddini, E., Baena-López, L.A., Vincent, J.P., Itoh, Y., et al.
Biol. 1014, 65–70. (2009). Characterization of the interface between normal and transformed
epithelial cells. Nat. Cell Biol. 11, 460–467.
Darzynkiewicz, Z., and Zhao, H. (2011). Detection of DNA strand breaks in
apoptotic cells by flow- and image-cytometry. Methods Mol. Biol. Holly, M.K., and Smith, J.G. (2018). Adenovirus infection of human enteroids
682, 91–101. reveals interferon sensitivity and preferential infection of goblet cells. J. Virol.
92, e00250–00218.
del Álamo, J.C., Meili, R., Alonso-Latorre, B., Rodrı́guez-Rodrı́guez, J.,
Aliseda, A., Firtel, R.A., and Lasheras, J.C. (2007). Spatio-temporal analysis Jiang, T., Grabiner, B., Zhu, Y., Jiang, C., Li, H., You, Y., Lang, J., Hung, M.C.,
of eukaryotic cell motility by improved force cytometry. Proc. Natl. Acad. and Lin, X. (2011). CARMA3 is crucial for EGFR-Induced activation of NF-kB
Sci. USA 104, 13343–13348. and tumor progression. Cancer Res. 71, 2183–2192.

Dev, A., Iyer, S., Razani, B., and Cheng, G. (2011). NF-kB and innate immunity. Joshi, S.D., von Dassow, M., and Davidson, L.A. (2010). Experimental control
Curr. Top. Microbiol. Immunol. 349, 115–143. of excitable embryonic tissues: three stimuli induce rapid epithelial contrac-
tion. Exp. Cell Res. 316, 103–114.
Dolowschiak, T., Chassin, C., Ben Mkaddem, S., Fuchs, T.M., Weiss, S.,
Vandewalle, A., and Hornef, M.W. (2010). Potentiation of epithelial innate Kang, H.B., Kim, Y.E., Kwon, H.J., Sok, D.E., and Lee, Y. (2007). Enhancement
host responses by intercellular communication. PLoS Pathog. 6, of NF-kappaB expression and activity upon differentiation of human embry-
e1001194. onic stem cell line SNUhES3. Stem Cells Dev. 16, 615–623.
Drolia, R., Tenguria, S., Durkes, A.C., Turner, J.R., and Bhunia, A.K. (2018). Kasper, C.A., Sorg, I., Schmutz, C., Tschon, T., Wischnewski, H., Kim, M.L.,
Listeria adhesion protein induces intestinal epithelial barrier dysfunction for and Arrieumerlou, C. (2010). Cell-cell propagation of NF-kB transcription fac-
bacterial translocation. Cell Host Microbe 23, 470–484.e7. tor and MAP kinase activation amplifies innate immunity against bacterial
infection. Immunity 33, 804–816.
Edelstein, A.D., Tsuchida, M.A., Amodaj, N., Pinkard, H., Vale, R.D., and
Stuurman, N. (2014). Advanced methods of microscope control using Kiehart, D.P., Galbraith, C.G., Edwards, K.A., Rickoll, W.L., and Montague,
mManager software. J. Biol. Methods 1, e10. R.A. (2000). Multiple forces contribute to cell sheet morphogenesis for dorsal
closure in Drosophila. J. Cell Biol. 149, 471–490.
Engström, P., Burke, T.P., Mitchell, G., Ingabire, N., Mark, K.G., Golovkine, G.,
Iavarone, A.T., Rape, M., Cox, J.S., and Welch, M.D. (2019). Evasion of auto- Kim, D., Langmead, B., and Salzberg, S.L. (2015). HISAT: a fast spliced aligner
phagy mediated by Rickettsia surface protein OmpB is critical for virulence. with low memory requirements. Nat. Methods 12, 357–360.
Nat. Microbiol. 4, 2538–2551. Kim, M., Ogawa, M., Fujita, Y., Yoshikawa, Y., Nagai, T., Koyama, T., Nagai, S.,
Escribano, J., Chen, M.B., Moeendarbary, E., Cao, X., Shenoy, V., Garcia- €ssler, R., and Sasakawa, C. (2009). Bacteria hijack integrin-linked
Lange, A., Fa
Aznar, J.M., Kamm, R.D., and Spill, F. (2019). Balance of mechanical forces kinase to stabilize focal adhesions and block cell detachment. Nature 459,
drives endothelial gap formation and may facilitate cancer and immune-cell 578–582.
extravasation. PLoS Comp. Biol. 15, e1006395. Knodler, L.A., Crowley, S.M., Sham, H.P., Yang, H., Wrande, M., Ma, C.,
Escribano, J., Sunyer, R., Sánchez, M.T., Trepat, X., Roca-Cusachs, P., and Ernst, R.K., Steele-Mortimer, O., Celli, J., and Vallance, B.A. (2014).
Garcı́a-Aznar, J.M. (2018). A hybrid computational model for collective cell Noncanonical inflammasome activation of caspase-4/caspase-11 mediates
durotaxis. Biomech. Model. Mechanobiol. 17, 1037–1052. epithelial defenses against enteric bacterial pathogens. Cell Host Microbe
16, 249–256.
Faralla, C., Bastounis, E.E., Ortega, F.E., Light, S.H., Rizzuto, G., Gao, L.,
Marciano, D.K., Nocadello, S., Anderson, W.F., Robbins, J.R., et al. (2018). Knodler, L.A., Vallance, B.A., Celli, J., Winfree, S., Hansen, B., Montero, M.,
Listeria monocytogenes InlP interacts with afadin and facilitates basement and Steele-Mortimer, O. (2010). Dissemination of invasive Salmonella via bac-
membrane crossing. PLoS Pathog. 14, e1007094. terial-induced extrusion of mucosal epithelia. Proc. Natl. Acad. Sci. USA 107,
Fernandez-Gonzalez, R., Simoes, Sde M., Röper, J.C., Eaton, S., and Zallen, 17733–17738.
J.A. (2009). Myosin II dynamics are regulated by tension in intercalating cells. Kocgozlu, L., Saw, T.B., Le, A.P., Yow, I., Shagirov, M., Wong, E., Mège, R.M.,
Dev. Cell 17, 736–743. Lim, C.T., Toyama, Y., and Ladoux, B. (2016). Epithelial cell packing induces
Gouin, E., Adib-Conquy, M., Balestrino, D., Nahori, M.A., Villiers, V., Colland, distinct modes of cell extrusions. Curr. Biol. 26, 2942–2950.
F., Dramsi, S., Dussurget, O., and Cossart, P. (2010). The Listeria monocyto- Kong, W., Loison, O., Chavadimane Shivakumar, P., Chan, E.H., Saadaoui,
genes InlC protein interferes with innate immune responses by targeting the M., Collinet, C., Lenne, P.F., and Clément, R. (2019). Experimental valida-
I{kappa}B kinase subunit IKK{alpha}. Proc. Natl. Acad. Sci. USA 107, tion of force inference in epithelia from cell to tissue scale. Sci. Rep.
17333–17338. 9, 14647.
Gouin, E., Balestrino, D., Rasid, O., Nahori, M.-A., Villiers, V., Impens, F., Kuipers, D., Mehonic, A., Kajita, M., Peter, L., Fujita, Y., Duke, T., Charras, G.,
Volant, S., Vogl, T., Jacob, Y., Dussurget, O., and Cossart, P. (2019). and Gale, J.E. (2014). Epithelial repair is a two-stage process driven first by
Ubiquitination of Listeria virulence factor InlC contributes to the host response dying cells and then by their neighbours. J. Cell Sci. 127, 1229–1241.
to infection. mBio 10, e02778–19. Lamason, R.L., Bastounis, E., Kafai, N.M., Serrano, R., Del Álamo, J.C.,
Grieve, A.G., and Rabouille, C. (2014). Extracellular cleavage of E-cadherin Theriot, J.A., and Welch, M.D. (2016). Rickettsia Sca4 reduces vinculin-medi-
promotes epithelial cell extrusion. J. Cell Sci. 127, 3331–3346. ated intercellular tension to promote spread. Cell 167, 670–683.e10.
Gudipaty, S.A., and Rosenblatt, J. (2017). Epithelial cell extrusion: pathways Lamason, R.L., and Welch, M.D. (2017). Actin-based motility and cell-to-cell
and pathologies. Semin. Cell Dev. Biol. 67, 132–140. spread of bacterial pathogens. Curr. Opin. Microbiol. 35, 48–57.

458 Developmental Cell 56, 443–460, February 22, 2021

 ll
Article
Li, S., Lu, J., Chen, Y., Xiong, N., Li, L., Zhang, J., Yang, H., Wu, C., Zeng, H., Perez, T.D., Tamada, M., Sheetz, M.P., and Nelson, W.J. (2008). Immediate-
and Liu, Y. (2017). MCP-1-induced ERK/GSK-3b/Snail signaling facilitates the early signaling induced by E-cadherin engagement and adhesion. J. Biol.
epithelial-mesenchymal transition and promotes the migration of MCF-7 hu- Chem. 283, 5014–5022.
man breast carcinoma cells. Cell. Mol. Immunol. 14, 621–630. Pires, B.R., Mencalha, A.L., Ferreira, G.M., de Souza, W.F., Morgado-Dı́az,
Lord, S.J., Velle, K.B., Mullins, R.D., and Fritz-Laylin, L.K. (2020). SuperPlots: J.A., Maia, A.M., Corrêa, S., and Abdelhay, E.S. (2017). NF-kappaB is involved
communicating reproducibility and variability in cell biology. J. Cell Biol. 219, in the regulation of EMT genes in breast cancer cells. PLoS One 12, e0169622.
e202001064. Rahman, M.M., and McFadden, G. (2011). Modulation of NF-kB signalling by
Luo, W., Friedman, M.S., Shedden, K., Hankenson, K.D., and Woolf, P.J. microbial pathogens. Nat. Rev. Microbiol. 9, 291–306.
(2009). GAGE: generally applicable gene set enrichment for pathway analysis. Rajabian, T., Gavicherla, B., Heisig, M., Mu€ller-Altrock, S., Goebel, W., Gray-
BMC Bioinformatics 10, 161. Owen, S.D., and Ireton, K. (2009). The bacterial virulence factor InlC perturbs
Luo, W., Pant, G., Bhavnasi, Y.K., Blanchard, S.G., Jr., and Brouwer, C. (2017). apical cell junctions and promotes cell-to-cell spread of Listeria. Nat. Cell Biol.
Pathview web: user friendly pathway visualization and data integration. 11, 1212–1218.
Nucleic Acids Res. 45, W501–W508. Reddick, L.E., and Alto, N.M. (2014). Bacteria fighting back: how pathogens
Manna, S.K., and Ramesh, G.T. (2005). Interleukin-8 induces nuclear tran- target and subvert the host innate immune system. Mol. Cell 54, 321–328.
scription factor-kappaB through a TRAF6-dependent pathway. J. Biol. Rengarajan, M., Hayer, A., and Theriot, J.A. (2016). Endothelial cells use a for-
Chem. 280, 7010–7021. min-dependent phagocytosis-like process to internalize the bacterium Listeria
Mansell, A., Braun, L., Cossart, P., and O’Neill, L.A. (2000). A novel function of monocytogenes. PLoS Pathog. 12, e1005603.
InIB from Listeria monocytogenes: activation of NF-kappaB in J774 macro- Rincón, E., Rocha-Gregg, B.L., and Collins, S.R. (2018). A map of gene expres-
phages. Cell. Microbiol. 2, 127–136. sion in neutrophil-like cell lines. BMC Genomics 19, 573.
Martin, M. (2011). Cutadapt removes adapter sequences from high- Robbins, J.R., Barth, A.I., Marquis, H., de Hostos, E.L., Nelson, W.J., and
throughput sequencing reads. EMBnet J. 17, 10–12. Theriot, J.A. (1999). Listeria monocytogenes exploits normal host cell pro-
Matamoro-Vidal, A., and Levayer, R. (2019). Multiple influences of mechanical cesses to spread from cell to cell. J. Cell Biol. 146, 1333–1350.
forces on cell competition. Curr. Biol. 29, R762–R774. Rosenblatt, J., Raff, M.C., and Cramer, L.P. (2001). An epithelial cell destined
McEwen, A.E., Maher, M.T., Mo, R., and Gottardi, C.J. (2014). E-cadherin for apoptosis signals its neighbors to extrude it by an actin- and myosin-
phosphorylation occurs during its biosynthesis to promote its cell surface sta- dependent mechanism. Curr. Biol. 11, 1847–1857.
bility and adhesion. Mol. Biol. Cell 25, 2365–2374. Schmedt, T., Chen, Y., Nguyen, T.T., Li, S., Bonanno, J.A., and Jurkunas, U.V.
McFarland, A.P., Burke, T.P., Carletti, A.A., Glover, R.C., Tabakh, H., Welch, (2012). Telomerase immortalization of human corneal endothelial cells yields
M.D., and Woodward, J.J. (2018). RECON-dependent inflammation in hepato- functional hexagonal monolayers. PLoS One 7, e51427.
cytes enhances Listeria monocytogenes cell-to-cell spread. mBio 9, Schneider, C.A., Rasband, W.S., and Eliceiri, K.W. (2012). NIH Image to
e00526–00518. ImageJ: 25 years of image analysis. Nature Methods 9, 671–675.
Mitchel, J.A., Das, A., O’Sullivan, M.J., Stancil, I.T., DeCamp, S.J., Koehler, S., Sellin, M.E., Mu€ller, A.A., Felmy, B., Dolowschiak, T., Diard, M., Tardivel, A.,
Butler, J.P., Fredberg, J.J., Nieto, M.A., Bi, D., and Park, J.-H. (2019). The un- Maslowski, K.M., and Hardt, W.D. (2014). Epithelium-intrinsic NAIP/NLRC4 in-
jamming transition is distinct from the epithelial-to-mesenchymal transition. flammasome drives infected enterocyte expulsion to restrict Salmonella repli-
bioRxiv https://www.biorxiv.org/content/10.1101/665018v1. cation in the intestinal mucosa. Cell Host Microbe 16, 237–248.
Moreo, P., Garcı́a-Aznar, J.M., and Doblaré, M. (2008). Modeling mechano- Smutny, M., Behrndt, M., Campinho, P., Ruprecht, V., and Heisenberg, C.P.
sensing and its effect on the migration and proliferation of adherent cells. (2015). UV laser ablation to measure cell and tissue-generated forces in the ze-
Acta Biomater 4, 613–621. brafish embryo in vivo and ex vivo. Methods Mol Biol 1189, 219–235.
Morgan, M.J., and Liu, Z.G. (2011). Crosstalk of reactive oxygen species and Stevens, J.M., Galyov, E.E., and Stevens, M.P. (2006). Actin-dependent move-
NF-kB signaling. Cell Res. 21, 103–115. ment of bacterial pathogens. Nat. Rev. Microbiol. 4, 91–101.
€ller, T., Williams, D.J., and Liu, Y. (2014). Changes in the stiff-
Nikolaev, N.I., Mu Strippoli, R., Benedicto, I., Pérez Lozano, M.L., Cerezo, A., López-Cabrera, M.,
ness of human mesenchymal stem cells with the progress of cell death as and del Pozo, M.A. (2008). Epithelial-to-mesenchymal transition of peritoneal
measured by atomic force microscopy. J. Biomech. 47, 625–630. mesothelial cells is regulated by an ERK/NF-kappaB/Snail1 pathway. Dis.
Noad, J., von der Malsburg, A., Pathe, C., Michel, M.A., Komander, D., and Model Mech. 1, 264–274.
Randow, F. (2017). LUBAC-synthesized linear ubiquitin chains restrict Sunyer, R., Conte, V., Escribano, J., Elosegui-Artola, A., Labernadie, A., Valon,
cytosol-invading bacteria by activating autophagy and NF-kB. Nat. L., Navajas, D., Garcı́a-Aznar, J.M., Muñoz, J.J., Roca-Cusachs, P., and
Microbiol. 2, 17063. Trepat, X. (2016). Collective cell durotaxis emerges from long-range intercel-
O’Dea, R.D., and King, J.R. (2012). Continuum limits of pattern formation in lular force transmission. Science 353, 1157–1161.
hexagonal-cell monolayers. J. Math. Biol. 64, 579–610. Tamada, M., Perez, T.D., Nelson, W.J., and Sheetz, M.P. (2007). Two distinct
Ohsawa, S., Vaughen, J., and Igaki, T. (2018). Cell extrusion: a stress- modes of myosin assembly and dynamics during epithelial wound closure.
responsive force for good or evil in epithelial homeostasis. Dev. Cell 44, J. Cell Biol. 176, 27–33.
284–296. Tambe, D.T., Hardin, C.C., Angelini, T.E., Rajendran, K., Park, C.Y., Serra-
Ortega, F.E., Koslover, E.F., and Theriot, J.A. (2019). Listeria monocytogenes Picamal, X., Zhou, E.H., Zaman, M.H., Butler, J.P., Weitz, D.A., et al. (2011).
cell-to-cell spread in epithelia is heterogeneous and dominated by rare pioneer Collective cell guidance by cooperative intercellular forces. Nat. Mater. 10,
bacteria. eLife 8, e40032. 469–475.
Ortega, F.E., Rengarajan, M., Chavez, N., Radhakrishnan, P., Gloerich, M., Tarantino, N., Tinevez, J.Y., Crowell, E.F., Boisson, B., Henriques, R.,
Bianchini, J., Siemers, K., Luckett, W.S., Lauer, P., Nelson, W.J., and Mhlanga, M., Agou, F., Israe €l, A., and Laplantine, E. (2014). TNF and IL-1
Theriot, J.A. (2017). Adhesion to the host cell surface is sufficient to mediate exhibit distinct ubiquitin requirements for inducing NEMO–IKK supramolecular
Listeria monocytogenes entry into epithelial cells. Mol. Biol. Cell 28, structures. J. Cell Biol. 204, 231–245.
2945–2957. Tian, B., Widen, S.G., Yang, J., Wood, T.G., Kudlicki, A., Zhao, Y., and Brasier,
Pentecost, M., Otto, G., Theriot, J.A., and Amieva, M.R. (2006). Listeria mono- A.R. (2018). The NFkappa B subunit RELA is a master transcriptional regulator
cytogenes invades the epithelial junctions at sites of cell extrusion. PLoS of the committed epithelial-mesenchymal transition in airway epithelial cells.
Pathog 2, e3. J. Biol. Chem. 293, 16528–16545.

Developmental Cell 56, 443–460, February 22, 2021 459

 ll
Article
Tilney, L.G., and Portnoy, D.A. (1989). Actin filaments and the growth, move- €ger, M., and Linke, M. (2015). Regulation of innate
Weichhart, T., Hengstschla
ment, and spread of the intracellular bacterial parasite, Listeria monocyto- immune cell function by mTOR. Nat. Rev. Immunol. 15, 599–614.
genes. J. Cell Biol. 109, 1597–1608.
Yang, J., Antin, P., Berx, G., Blanpain, C., Brabletz, T., Bronner, M., Campbell,
Vileno, B., Lekka, M., Sienkiewicz, A., Jeney, S., Stoessel, G., Lekki, J., Forró,
K., Cano, A., Casanova, J., Christofori, G., et al. (2020). Guidelines and defini-
L., and Stachura, Z. (2007). Stiffness alterations of single cells induced by UV in
tions for research on epithelial–mesenchymal transition. Nat. Rev. Mol. Cell
the presence of nanoTiO2. Environ. Sci. Technol. 41, 5149–5153.
Biol. 21, 341–352.
Wagstaff, L., Goschorska, M., Kozyrska, K., Duclos, G., Kucinski, I., Chessel,
A., Hampton-O’Neil, L., Bradshaw, C.R., Allen, G.E., Rawlins, E.L., et al. Zhang, T., and Balachandran, S. (2019). Bayonets over bombs: RIPK3 and
(2016). Mechanical cell competition kills cells via induction of lethal p53 levels. MLKL restrict Listeria without triggering necroptosis. J. Cell Biol. 218,
Nat. Commun. 7, 11373. 1773–1775.

460 Developmental Cell 56, 443–460, February 22, 2021

 ll
Article

STAR+METHODS

KEY RESOURCES TABLE

REAGENT or RESOURCE SOURCE IDENTIFIER

Antibodies
Rabbit anti-Rickettsia I7205 Ted Hackstadt (NIH, RML) N/A
Mouse anti-vimentin Abcam Cat# ab8069; RRID: AB_306239
Mouse anti-pan cytokeratin Thermo Fisher Scientific Cat# 53-9003-80; RRID: AB_1834351
Rabbit anti-tubulin Abcam Cat# ab52866; RRID: AB_869989
Rabbit anti-E-cadherin Cell Signaling Cat# 3195; RRID: AB_2291471
Mouse anti-ZO-1 Thermo Fisher Scientific Cat# ZO1-1A12; RRID: AB_2533147
Rabbit anti-NF-kB Abcam Cat# ab190589; RRID: AB_2728800
Rabbit NF-kB p65 (D14E12) Cell Signaling Cat# 8242; RRID: AB_10859369
Rabbit phospho-NF-kB p65 (Ser536) (93H1) Cell Signaling Cat# 3033; RRID: AB_331284
Rabbit IkBa Cell Signaling Cat# 9242; RRID: N/A
Rabbit phospho-IkBa (Ser32) (14D4) Cell Signaling Cat# 2859; RRID: AB_561111
Rabbit GAPDH (14C10) Rabbit mAb Cell Signaling Cat# 2118; RRID: AB_561053
Biological Samples
Human ileal enteroids (HIE5) J. Smith (Holly and Smith, 2018) N/A
Chemicals, Peptides, and Recombinant Proteins
AlexaFluor488 phalloidin Thermo Fisher Scientific Cat# A12379
SulfoSanpah Thermo Fisher Scientific Cat# 22589
Collagen I Sigma Cat# C3867
Para-nitroblebbistatin Fisher Cat# NC1706059
Y-27632 Sigma Cat# 129830-38-2
Z-VAD-FMK MilliporeSigma Cat# 5.30389.0001
GSK’872 Fisher Cat# 64-921-0
H1152 Tocris Cat# 2414
Diphenyleneiodonium chloride (DPI) Sigma Cat# D2926
L-NIL dihydrochloride (L-NIL) SCBT Cat# 159190-45-1
NEMO binding peptide Fisher Cat# 480025
Critical Commercial Assays
QIAshredder Kit Qiagen Cat# 79656
RNeasy Plus Micro Kit Qiagen Cat# 74004
Canine Cytokine Magnetic Bead Panel 96- Millipore Sigma Cat# CCYTMG-90K-PX13
Well Plate Assay
DCFDA cellular ROS detection assay kit Abcam Cat# ab113851
Deposited Data
Raw RNA-seq data and analysis NCBI Gene Expression Omnibus GSE140626
Experimental Models: Cell Lines
MDCK II A. Bakardjiev (Faralla et al., 2018) N/A
a-catenin knockout MDCK II W. Nelson (Ortega et al., 2017) N/A
MDCK II E-cadherin-RFP W. Nelson (Perez et al., 2008) N/A
A431D C. Gottardi (McEwen et al., 2014) N/A
A431D expressing full length E-cadherin C. Gottardi (McEwen et al., 2014) N/A
Experimental Models: Organisms/Strains
L. monocytogenes: L.m.-ActAp::mTagRFP F. Ortega (Ortega et al., 2017) N/A
L. monocytogenes: L.m.-GFP F. Ortega (Ortega et al., 2017) N/A
(Continued on next page)

Developmental Cell 56, 443–460.e1–e11, February 22, 2021 e1

 ll
Article

Continued
REAGENT or RESOURCE SOURCE IDENTIFIER
L. monocytogenes: L.m.-DinlC F. Ortega (Ortega et al., 2017) N/A
ActAp::mTagRFP
L. monocytogenes: L.m.-DinlP A. Bakardjiev (Faralla et al., 2018) N/A
L. monocytogenes: L.m.-LLOG486D M. Rengarajan (Rengarajan et al., 2016) N/A
ActAp::mTagRFP
R. parkeri Portsmouth strain Chris Paddock N/A
R. parkeri: R.p.- ompBSTOP::tn P. Engstrom (Engström et al., 2019) N/A
L. monocytogenes: L.m.-Dhly M. Rengarajan (Rengarajan et al., 2016) N/A
Oligonucleotides
siRNA targeting sequence for CDH1: GE Healthcare Dharmacon, Inc. CTM-521910 and CTM-521911
Custom CDH1 duplex
siRNA targeting sequence for SNAi1: GE Healthcare Dharmacon, Inc. CTM-544153 and CTM-544153
Custom SNAI1 duplex
Forward Primer for CDH1 (forward: This paper N/A
5’ AGACCCAGTAACTAACGACGG 3’)
Reverse Primer for CDH1 (reverse: This paper N/A
5’ ACACCAAAGTCTTCAGGGATT 3’)
Forward Primer for SNAI1 (forward: This paper N/A
5’ CCCCCATTTGGCTGTGTTG 3’)
Reverse Primer for SNAI1 (reverse: This paper N/A
5’ ATCAGTCTGTCGGCTTTTATCCT 3’)
Forward Primer for b-actin (forward: This paper N/A
5’ CCCAGCACAATGAAGATCAAGAT 3’)
Reverse Primer for b-actin (reverse: This paper N/A
5’ CAAGAAAGGGTGTAACGCAACT 3’)
Forward Primer for SNAI2 (forward: This paper N/A
5’ GAAGCATTTCAACGCCTCC 3’)
Reverse Primer for SNAI2 (reverse: This paper N/A
5’ ACTCACTCGCCCCAAGGAT 3’)
Forward Primer for NFKBIA (forward: This paper N/A
5’ CACATTCCCTAGCCAGAAACATT 3’)
Reverse Primer for NFKBIA (reverse: This paper N/A
5’ TACACCTGGTTGTCACGCATC 3’)
Forward Primer for ICAM1 (forward: This paper N/A
5’ ACCGAGGGTTGGGATTGTT 3’)
Reverse Primer for ICAM1 (reverse: This paper N/A
5’ GTCTCTGGCAGGACAAAGGTT 3’)
Forward Primer for CXCL8 (forward: This paper N/A
5’ GAAAACTCAGAAATCATTGTAAAGC 3’)
Reverse Primer for CXCL8 (reverse: This paper N/A
5’ ATCTTGTTTCTCAGCCTTCTTTAG 3’)
Software and Algorithms
ImageJ Schneider et al., 2012 https://imagej.nih.gov/ij/
MicroManager Open Imaging https://www.micro-manager.org/
MATLAB MathWorks http://www.mathworks.com/products/
matlab/?requestedDomain=www.
mathworks.com
GraphPad Prism v6 GraphPad http://www.graphpad.com/scientific-
software/prism/
Hisat 2 (Kim et al., 2015) https://ccb.jhu.edu/software/hisat2/
index.shtml)
Cutadapt (Martin, 2011) https://cutadapt.readthedocs.io/en/stable/
(Continued on next page)

e2 Developmental Cell 56, 443–460.e1–e11, February 22, 2021

 ll
Article

Continued
REAGENT or RESOURCE SOURCE IDENTIFIER
R package GAGE (Luo et al., 2009) https://bioconductor.org/packages/
release/bioc/html/gage.html
R package ‘‘Pathview’’ (Luo et al., 2017) https://www.bioconductor.org/packages/
release/bioc/html/pathview.html
ABAQUS Dassault systèmes https://www.3ds.com/products-services/
simulia/products/abaqus/
Imaris Bitplane https://imaris.oxinst.com/

RESOURCE AVAILABILITY

Lead contact
Further information and requests for reagents may be directed to and will be fulfilled by the Lead Contact Julie Theriot jtheriot@uw.
edu (J.A.T.).

Materials availability
Materials developed in this study are available on request to the corresponding author.

Data and code availability

Data collected and computer codes are available on request to the corresponding authors. The accession number of the RNA
sequencing data (FASTq files) generated during this study and subsequent analysis reported in this paper are available from the
lead contact and on the NCBI Gene Expression Omnibus (GEO) archive (accession ID GEO: GSE140626.) All differential expression
analysis results of this study are included as supplementary tables in this article.

EXPERIMENTAL MODEL AND SUBJECT DETAILS

Cell culture
Type II MDCK cells (generous gift from the Bakardjiev lab, University of California, San Francisco) were cultured in high glucose
DMEM medium (Thermofisher; 11965092) containing 4.5 g/L glucose and supplemented with 10% fetal bovine serum (GemBio;
900-108) (Ortega et al., 2017). Passages were between P10-P40. MDCK cells expressing E-cadherin-RFP were a generous gift
from the Nelson lab, Stanford University (Perez et al., 2008). a-catenin knockout (aEcat KO) MDCK cells were also a generous gift
from the Nelson lab, Stanford University (Ortega et al., 2017). Human epithelial carcinoma A431D cells were a generous gift from
Cara Gottardi, Northwestern University and were grown in DMEM with high glucose (4.5 g/L) in the presence of 10% FBS and
1% penicillin-streptomycin. Transduced cell lines that express full length E-cadherin were cultured in media supplemented with
800 mg/mL geneticin and were generated as described previously (Ortega et al., 2017).

Human ileal enteroid cells

Human ileal enteroids (HIE5) were originally cultured from normal healthy ileal tissue obtained from surgical resection (Holly and
Smith, 2018). For continuous culture, human ileal enteroids were maintained in Matrigel domes (Corning, Growth Factor Reduced)
in human complete crypt culture medium (hCCCM). hCCCM medium is composed of 50% Wnt3a conditioned media (CM), 10%
R-spondin-1 CM, 10% Noggin CM, 1X B-27 supplement, 10 mM HEPES, 1X Glutamax, 1X antibiotic-antimycotic, 1X Non-Essential
Amino Acids Solution (Caisson Labs), 1 mM N-acetyl-L-cysteine (Sigma), 10 mM Y-27632 (Abcam), 50 ng/ml mouse epidermal growth
factor (EGF, Peprotech), 10 nM gastrin (Sigma), 50 ng/ml fibroblast growth factor-2/basic (Peprotech), 100 ng/ml insulin like growth
factor-1 (BioLegend), 500 nM A 83-01 (Tocris) and 10 mM nicotinamide in DMEM. CM production and quality control were performed
as described elsewhere (Holly and Smith, 2018). Medium components are from Thermo Fisher Scientific unless otherwise noted.
Monolayers of human ileal enteroid cells derived from human ileal enteroids were generated as described (Holly and Smith, 2018).
Briefly, human ileal enteroids were removed from Matrigel using cell recovery solution (Thermo Fisher Scientific), dissociated in
0.05% trypsin at 37 C for at least 6 min, quenched with DMEM containing 10% FBS, 10 mM HEPES, and 1X Glutamax, and mechan-
ically dissociated with a pipette. Cells were then passed through a 40 mm cell strainer, centrifuged at 400 x g for 5 min and then
resuspended in hCCCM lacking antibiotic-antimycotic and nicotinamide. 3.5 x 105 cells per well were plated onto 96-well thin
(
200 mm) polystyrene plates. The wells were first coated overnight at 37 C with 1 mg/mL human placental collagen, type IV
(Sigma-Aldrich) diluted 1:30 in sterile dH20 prior to adding the cells. The cultures were incubated for 7 days prior to L.m. infection,
with media changes at least every 2 days.

Bacterial strains used in this study

The Listeria monocytogenes (L.m.) strains used in this study are: JAT607 (Species: L.m. 1043S, Genotype/Description: ActAp::
mTagRFP) (Ortega et al., 2017), JAT605 (Species: L.m. 1043S, Genotype/Description: Constitutive GFP) (Ortega et al., 2017), DinlC

Developmental Cell 56, 443–460.e1–e11, February 22, 2021 e3

 ll
Article

(Species: L.m. 1043S, Genotype/Description: DinlC ActAp::mTagRFP), DinlP (Species: L.m. 1043S, Genotype/Description: DinlP,
obtained from the Bakardjiev lab) (Faralla et al., 2018), JAT983 (Species: L.m. 1043S, Genotype/Description: LLOG486D ActAp::
mTagRFP) (Rengarajan et al., 2016), Dhly (Species: L.m. 1043S, Genotype/Description: Dhly) (Rengarajan et al., 2016). Note that
we used the LLOG486D L.m. to test the role of LLO in induction of mounds and in activating signaling pathways that affect mechano-
transduction., LLOG486D L.m. is a strain that carries a point mutation in the gene encoding LLO and thus exhibits 100x less hemolytic
activity than the WT protein, permitting a moderate degree of bacterial proliferation and intercellular spread (unlike strains completely
lacking LLO which are unable to proliferate in host cells) (Rengarajan et al., 2016).
WT Rickettia parkeri (R.p.) strain Portsmouth was originally obtained from Dr. Chris Paddock (Center for Disease Control and Pre-
vention, NCBI accession no. NC_017044.1), and the ompB- mutant (ompBSTOP::tn) was isolated and validated in a recent study (Eng-
ström et al., 2019). R.p. propagation and purifications were from five T175 flasks of Vero cells growing in DMEM (Gibco, 11965) with
high glucose (4.5 g l-1) and 2% FBS (Benchmark) that after 5-6 days of infection were harvested in the media using a cell scraper.
Infected cells were then centrifuged 12000g for 15 min at 4  C, resuspended in cold K-36 buffer (0.05 M KH2PO4, 0.05 M
K2HPO4, pH 7, 100 mM KCl and 15 mM NaCl), and bacteria were then released using a dounce-homogenizer. The homogenate
was centrifuged at 200g for 5 min at 4  C and the supernatant was then overlaid onto cold 30% v/v MD-76R (Mallinckrodt Inc.,
1317-07) diluted in K-36, and centrifuged at 58300g for 20 min at 4  C in an SW-28 swinging-bucket rotor. The bacterial pellet
was resuspended in cold 1x BHI broth, aliquoted and frozen at -80  C.

METHOD DETAILS

Bacterial growth conditions and infections

MDCK or A431D cells seeded on glass or polyacrylamide collagen I-coated substrates were infected with L.m. as previously
described with the following modifications (Bastounis et al., 2018; Ortega et al., 2019). Briefly, three days before performing the infec-
tion assay, L.m. were streaked out from a frozen glycerol stock onto brain heart infusion (BHI, BD; 211059)) agar plates containing
200 mg/mL streptomycin and 7.5 mg/mL chloramphenicol and were placed at 37 C for 2 days. L.m. were then inoculated from plate
colonies and grown in 2 mL BHI liquid cultures containing 200 mg/mL streptomycin and 7.5 mg/mL chloramphenicol at room temper-
ature, in the dark for
16 h. The day prior to infection, host cells were seeded at a density of 2x105 cells/well for cells residing on wells
of 24-well plates and grown for 24 h. Flagellated overnight cultures of L.m. (OD600 approximately 0.8) were washed twice by centri-
fugation at 2000 x g in PBS to remove any soluble factors. Infections were then performed in normal MDCK growth media by adding
1 mL of L.m. to 15 mL of media and then adding 1 mL of the mixture per well. After 30 min of incubation at 37  C, samples were
washed 3 times in PBS and then media was replaced with media supplemented with 20 mg/mL gentamicin. Multiplicity of infection
(MOI) was determined by plating bacteria at different dilutions, on BHI agar plates with 200 mg/mL streptomycin and 7.5 mg/mL chlor-
amphenicol and measuring the number of colonies formed two days post-infection. The resulting MOI was
200 bacteria/cell. Similar
approach was followed when A431D cells were infected with L.m.
Flow cytometry experiments of infected host cells were performed 24 h after infection, unless otherwise stated. For drug exposure
experiments, unless otherwise indicated, media was removed from the cells and replaced with media containing either the drug or
vehicle control 4 hpi. Infection mounds were examined at 24 hpi. Pharmacological inhibitors used were: para-nitroblebbistatin (target:
Myosin II inhibitor, concentration: 50 mM, source: Fisher, NC1706059); Y-27632 (target: ROCK inhibitor, concentration: 30 mM,
source: Sigma, 129830-38-2); Z-VAD-FMK (target: pancaspace inhibitor, concentration: 100 mM, source: MilliporeSigma,
5.30389.0001); GSK’872 (target: RIPK1 and RIPK3 inhibitor, concentration: 5 mM, source: Fisher, 64-921-0); H1152 (target: ROCK
inhibitor, concentration: 1 mM, source: Tocris, 2414); Diphenyleneiodonium chloride (DPI) (target: NADPH oxidase, nitric oxide syn-
thase, ROS, concentration: 0.5 mM, source: Sigma, D2926); L-NIL dihydrochloride (target: inducible nitric oxide synthase, concen-
tration: 1 mM, source: SCBT, 159190-45-1); NEMO binding peptide (target: NF-kB inhibitor, concentration: 50 mM, source: Fisher,
480025).
For L.m. infection of human ileal enteroid-derived cells, prior to infection cells were incubated with 100 mL of 4 mg/mL Hoechst for
45 min to stain the host cell nuclei. L.m. infection was then performed similar to L.m. infection of epithelial cells described above. At
24 hpi confocal images of L.m. infection mounds of human ileal enteroid cells were obtained without fixation since fixation steps
detach extruded cells of the infection mounds. We acquired confocal images of the Hoechst-stained host cell nuclei and of the fluo-
rescent bacteria with 0.2 mm spacing using a spinning disk confocal with a 60x 1.4NA Plan Apo oil objective.
R.p. infections of epithelial cells were carried as previously described with the following modifications (Engström et al., 2019).
Briefly, 3.5x105 MDCK cells were seeded in 24-well plates with sterile circle 12-mm coverslips (Thermo Fisher Scientific, 12-545-
80)
24 h prior to infection. The following day, 3x103 purified WT or ompBSTOP::tn infectious R.p. were used to infect each well in
a 24-well plate. Diluted bacterial suspensions were centrifuged onto cells at 300 x g for 5 min at room temperature and subsequently
incubated at 33 C for 24, 48, 72 or 96 h as indicated, fixed for 10 min at room temperature in pre-warmed (37 C) 4% paraformalde-
hyde (Ted Pella Inc., 18505) diluted in PBS, pH 7.4, then washed 2 x with PBS and stored at 4 C prior to immunofluorescence
staining.

Flow cytometry of MDCK epithelial cells infected with L.m.

8, 24 or 48 hpi, MDCK cells infected with L.m. (JAT607, ActAp::mTagRFP) were detached from the substrate with 200 mL of 0.25%
trypsin-EDTA for 10 min. For removing extruded infected cells wells were washed three times in PBS prior to addition of trypsin-

e4 Developmental Cell 56, 443–460.e1–e11, February 22, 2021

 ll
Article

EDTA. Trypsin-EDTA solutions in each well were then pipetted up and down 6 times to ensure single cell suspensions and 200 mL of
complete media was added to inactivate trypsin in each well. Suspensions were transferred into 35-mm cell strainers, (Falcon,
352235) and spun through at 500 x g followed by fixation in 1% paraformaldehyde. Samples were then washed once in PBS and
stored in PBS with 1% BSA. Flow cytometry analysis was performed on a BD FACS Canto RUO analyzer (University of Washington
Cell Analysis Facility). 10,000-20,000 cells were analyzed per each replicate. To ensure analysis of single cells, the bulk of the dis-
tribution of cell counts was gated using the forward versus side scatter plot. This gating strategy ensures that single cells are analyzed
and debris or cell doublets or triplets are eliminated from the analysis. A second gating step was then performed to exclude cells that
autofluorescence by measuring the fluorescence of control uninfected cells and gating the population of infected cells to exclude
autofluorescence.

MDCK cell transfection with siRNA

For each well of a 24-well plate, 2x104 MDCK cells suspended in serum free media were reverse-transfected with siRNAs at 20 nM
final concentration using 0.25 mL lipofectamine RNAiMAX (Invitrogen 13778075). The transfection mix was replaced by full media 8 h
later. Synthetic siRNA pools (including 2 distinct siRNA sequences) to target CDH1 and SNAI1 were purchased from Dharmacon
(ON-TARGETplus Non-Targeting Pool, catalog number: D-001810-10; Custom CDH1 duplex, catalog number: CTM-521910 and
CTM-521911; Custom SNAI1 duplex, catalog number: CTM-544153 and CTM-544153). MDCK cells were treated with control
(non-targeting) or experimental siRNA in accordance to the manufacturer’s recommendations. Specifically, to demonstrate that
transfection performed was sufficient to get siRNAs into the cells, we transfected cells with synthetic siRNA, siGLO, that makes trans-
fected cells fluorescent 24 h post-transfection To track cell cycle phenotype and to verify that knockdown has occurred with our
protocol, we transfected cells with siKif11 which results in substantial cell death of transfected cells approximately 24-48 h post-
transfection and can be verified by microscopy using phase optics. Bacterial infections were performed approximately 72 h after
transfection.

RT-PCR
To confirm the knockdowns, MDCK cells treated with control (non-targeting) or experimental siRNA 72 h after transfection (approx-
imate cell concentration was 1.6x105 cells/well) were harvested and lyzed using the QIAshredder Kit (Qiagen, 79656). mRNA was
harvested using the RNeasy Plus Micro Kit (Qiagen, 74004) and eluted in 30 mL RNAase free water RNA concentrations were
measured spectrophotometrically (NanoDrop) and were comparable between conditions. cDNA was prepared using the Superscript
III First-strand Synthesis SuperMix (Invitrogen, 18080085). RT-qPCR was performed using the SYBR qPCR Master mix by Arraystar
Inc. Genes of interest were amplified using the appropriate primers: for CDH1 forward:5’ AGACCCAGTAACTAACGACGG 3’ and
reverse:5’ ACACCAAAGTCTTCAGGGATT 3’; for SNAI1 forward:5’ CCCCCATTTGGCTGTGTTG 3’ and reverse:5’ AT-
CAGTCTGTCGGCTTTTATCCT 3’; for b-actin forward:5’ CCCAGCACAATGAAGATCAAGAT 3’ and reverse:5’ CAAGAAAGGGTG-
TAACGCAACT 3’. Briefly the steps followed were: (1) perform RT-qPCR for each target gene and the housekeeping gene GAPDH;
(2) determine gene concentration using the standard curve with Rotor-Gene Real-Time Analysis Software 6.0; (3) calculate relative
amount of the target gene relative to GAPDH.
Similar procedure was followed to confirm expression of NF-kB target genes. MDCK cells were infected or not for 24 h with L.m..
MDCK cells were also infected or not or for 72 h with WT R.p. or the ompB- mutant. For each condition 4 replicates were prepared.
Cells were harvested and lyzed, and their mRNA was harvested as described above. RT-qPCR was performed as above. NF-kB
target genes tested were NFKBIA, CXCL8, ICAM1, SNAI1 and SNAI2. Genes of interest were amplified using the appropriate primers:
for NFKBIA forward:5’ CACATTCCCTAGCCAGAAACATT 3’ and reverse:5’ TACACCTGGTTGTCACGCATC 3’; for CXCL8 forward:5’
GAAAACTCAGAAATCATTGTAAAGC 3’ and reverse:5’ ATCTTGTTTCTCAGCCTTCTTTAG 3’; for ICAM1 forward:5’ AC-
CGAGGGTTGGGATTGTT 3’ and reverse:5’ GTCTCTGGCAGGACAAAGGTT 3’; for SNAI1 forward:5’ CCCCCATTTGGCTGTGTTG
3’ and reverse:5’ ATCAGTCTGTCGGCTTTTATCCT 3’; for SNAI2 forward:5’ GAAGCATTTCAACGCCTCC 3’ and reverse:5’ ACT-
CACTCGCCCCAAGGAT 3’; for b-actin forward:5’ CCCAGCACAATGAAGATCAAGAT 3’ and reverse:5’ CAAGAAAGGGTGTAACG-
CAACT 3’.

Fabrication of polyacrylamide hydrogels and traction force microscopy (TFM)

Polyacrylamide hydrogel fabrication was done as previously described (Bastounis et al., 2018). Briefly, glass-bottom plates with 24
wells (MatTek, P24G-1.5-13-F) were incubated for 1 h with 500 mL of 1 M NaOH, then rinsed with distilled water, and incubated with
500 mL of 2% 3-aminopropyltriethoxysilane (Sigma, 919-30-2) in 95% ethanol for 5 min. Following rinsing with water 500 mL of 0.5%
glutaraldehyde were added to each well for 30 min. Wells were rinsed with water again and dried at 60 C. To prepare polyacrylamide
hydrogels of 3 kPa, mixtures containing 5% acrylamide (Sigma, A4058) and 0.1% bis-acrylamide (Fisher, BP1404-250) were pre-
pared (Bastounis et al., 2018). Two mixtures were prepared, the second of which contained 0.2 mm fluorescent beads at 0.03% (In-
vitrogen, F8811) for TFM experiments. 0.06% ammonium persulfate and 0.43% TEMED were then added to the first solution to
initiate polymerization. First, 3.6 mL of the first mixture without the beads was added at the center of each well, capped with 12-
mm untreated circular glass coverslips, and allowed to polymerize for 20 min. After coverslip removal 2.4 mL of the mixture containing
tracer beads was added and sandwiched again with a 12-mm untreated circular glass coverslip and allowed to polymerize for 20 min.
Next, 50 mM HEPES at pH 7.5 was added to the wells, and coverslips were removed. Hydrogels were UV-sterilized for 1 h and then
activated by adding 200 mL of 0.5% weight/volume heterobifunctional cross-linker Sulfo-SANPAH (ProteoChem; c1111) in 1%

Developmental Cell 56, 443–460.e1–e11, February 22, 2021 e5

 ll
Article

dimethyl sulfoxide (DMSO) and 50 mM HEPES, pH 7.5, on the upper surface of the hydrogels and exposing them to UV light for
10 min. Hydrogels were washed with 50 mM HEPES at pH 7.5 and were coated with 200 mL of 0.25 mg/ml rat tail collagen I
(Sigma-Aldrich; C3867) in 50 mM HEPES at pH 7.5 overnight at room temperature. Next morning, the collagen coated surfaces
were washed with HEPES and gels were stored in HEPES.
TFM was performed as previously described (del Álamo et al., 2007; Lamason et al., 2016). Briefly, in TFM, cells actively pull on their
ECM depending on how well their focal adhesions are organized and connected to the underlying cytoskeleton, and cellular force
generation can be inferred from displacement of fluorescent tracer particles embedded in the deformable ECM (Bastounis et al.,
2014; del Álamo et al., 2007). Prior to seeding cells hydrogels were equilibrated with cell media for 30 min at 37 C. Cells were
then seeded to a concentration of 2x105 cells per well directly onto the hydrogels 24 h prior to infection. Cells are then either infected
or not with low dosage of L.m. and imaging started 4 hpi. Multi-channel time-lapse sequences of fluorescence (to image the beads
within the upper portion of the hydrogels) and phase contrast images (to image the cells) were acquired using an inverted Nikon
Eclipse Ti2 with an EMCCD camera (Andor Technologies) using a 40X 0.60NA Plan Fluor air objective or a 20x 0.75 NA Plan Apo
air objective and MicroManager software package (Edelstein et al., 2014). The microscope was surrounded by a box type incubator
(Haison) maintained at 37 C and 5% CO2. Images were acquired every 10 min for approximately 8 h. Subsequently, at each time
interval we measured the 2D deformation of the substrate at each point using an image correlation technique similar to particle image
velocimetry. We calculated the local deformation vector by performing image correlation between each image and an undeformed
reference image which we acquired by adding 10% SDS at the end of each recording to detach the cells from the hydrogels. We used
interrogation windows of 32 x 8 pixels (window size x overlap). Calculations of the two-dimensional traction stresses that cell mono-
layers exert on the hydrogel are described elsewhere (Bastounis et al., 2014; Lamason et al., 2016).

Atomic Force Microscopy (AFM) for determination of cell stiffness

A Bioscope Resolve AFM (Bruker, Santa Barbara) was used for MDCK cell stiffness measurements. The AFM operates with the
Nanoscope 9.4 software and the data was analyzed using Nanoscope Analysis 1.9 software. The AFM was integrated with an in-
verted optical microscope (Zeiss AXIO Observer Z1) to allow for correlation with fluorescence and light microscopy. Fluorescence
microscopy was used to position the AFM tip over the MDCK cells that resided on glass substrates and were immersed in PBS
and was critical for assessing which cells have internalized fluorescent bacteria.
First, we measured cell stiffness using the PFQNM-LC-A-CAL probe (Bruker) that has a conical shape (15 degrees half-cone angle)
terminated with 130 nm diameter sphere, and a spring constant 0.096 nN nm-1 (pre-calibrated by manufacturer using Laser Doppler
Vibrometer). We performed force-volume mapping using a ramp size of 4 mm, windows of 30 mm x 30 mm, 64 samples per line x 64
lines, ramp rate of 10 Hz, and a trigger force threshold of 600 pN. Since the indentation depth of >0.5 mm far exceeded the diameter of
the spherical tip apex (130 nm), data were analyzed using the Sneddon Model on the extend curves (no adhesion). A total of 5 different
windows were recorded for each condition.
We also probed cellular stiffness using colloidal probes with 5 mm diameter spheres on a pre-calibrated silicon nitride cantilever
purchased from Novascan (PT.Si02.SN.5.CAL). Spring constant was 0.16 Nm-1 (pre-calibrated by manufacturer). Force-distance
spectroscopy measurements were conducted with a ramp rate 0.2 Hz, trigger force threshold 1 nN, and ramp size 6 mm (to accom-
modate for increased adhesion due to larger contact area). At each field of view, we selected 4 cells and collected 10 measurements
per cell. A total of 4 different fields of view were selected for each condition, leading to 16 cells examined per condition. Data were
analyzed using the Hertz Model and the extend curves (no adhesion). Each AFM tip was used only for one experiment and then
discarded.

RNA isolation and RNA sequencing

Regarding sample preparation MDCK cells were cultured in high glucose DMEM medium (Thermofisher, 11965092) containing 4.5 g/
L glucose and supplemented with 10% FBS (GemBio, 900-108). To generate confluent cell monolayers, 24-well plates glass-bottom
for microscopy were coated with 50 mg/ml rat-tail collagen-I (diluted in 0.2 N acetic acid) for 1 h at 37 C, air-dried for 15 min, and UV-
sterilized for 30 min in a BSC. MDCK cells were seeded at a density of 2 3 105 cells/well for 24 h. 24 h post-seeding MDCK cells were
exposed to L.m. (MOI = 200) for 30 min. After washing out the bacteria three times with PBS, media containing 20 mg/mL gentamycin
was added to cells to kill extracellular bacteria. 24 hpi cells were trypsinized and either left in tubes or sorted into infected and un-
infected populations. All tubes containing cells for RNA extraction were treated in parallel (4 replicates per condition). Cells in solution
were spun down and lyzed using the QIAshredder Kit (Qiagen; 79656). mRNA was harvested using the RNeasy Plus Micro Kit (Qia-
gen; 74004) and eluted in 30 mL RNAase free water. A NanoDrop ND-1000 spectrophotometer was used to determine concentration
(abs 260) and purity (abs260/abs230) of total RNA samples. Agarose gel electrophoresis was used to check the integrality of total
RNA samples (performed by Arraystar Inc.).
For library preparation and RNA sequencing the procedure described below was followed. The total RNA was depleted of rRNAs
by Arraystar rRNA Removal Kit. We used Illumina kits for the RNA-seq library preparation, which included procedures of RNA frag-
mentation, random hexamer primed first strand cDNA synthesis, dUTP based second strand cDNA synthesis, end-repairing,
A-tailing, adaptor ligation and library PCR amplification. Finally, the prepared RNA-seq libraries were qualified using Agilent 2100
Bioanalyzer and quantified by qPCR absolute quantification method. The sequencing was performed using Illumina NovaSeq
6000 using the High-Output Kit with 2x150 read length. We had an average of 40 million reads per sample. The DNA fragments in
well mixed libraries were denatured with 0.1M NaOH to generate single-stranded DNA molecules, loaded onto channels of the

e6 Developmental Cell 56, 443–460.e1–e11, February 22, 2021

 ll
Article

flow cell at 8 pM concentration, and amplified in situ using TruSeq SR Cluster Kit v3-cBot-HS (#GD-401-3001, Illumina). Sequencing
was carried out using the Illumina X- ten/NovaSeq according to the manufacturer’s instructions. Sequencing was carried out by
running 150 cycles.
Raw sequencing data generated from Illumina X-ten/NovaSeq that pass the Illumina chastity filter were used for following analysis.
Trimmed reads (trimmed 5’, 3’-adaptor bases) were aligned to the reference genome (CanFam3). Based on alignment statistical
analysis (mapp.i.ng ratio, rRNA/mtRNA content, fragment sequence bias), we determined whether the results can be used for
subsequent data analysis. To examine the sequencing quality, the quality score plot of each sample was plotted. Quality score Q
is logarithmically related to the base calling error probability (P): Q = 10log10(P). For example, Q30 means the incorrect base calling
probability to be 0.001 or 99.9% base calling accuracy. After quality control, the fragments were 5’, 3’-adaptor trimmed and filtered
% 20 bp reads with Cutadapt software. The trimmed reads were aligned to the reference genome with Hisat 2 software. In a typical
experiment, it is possible to align 40
90% of the fragments to the reference genome. However, this percentage depends on multiple
factors, including sample quality, library quality and sequencing quality. Sequencing reads are classified into the following classes: (1)
Mapped : reads aligned to the reference genome (including mRNA, pre-mRNA, poly-A tailed lncRNA and pri-miRNA); (2) mtRNA and
rRNA: fragments aligned to rRNA, mtRNA; and (3) Unmapped: Reads that are not aligned.
Differentially expressed genes and differentially expressed transcripts are calculated. The novel genes and transcripts are also pre-
dicted. The expression level (fragments per kilobase of transcript per million mapped reads, FPKM) of known genes and transcripts
were calculated using ballgown through the transcript abundances estimated with StringTie. The number of identified genes
and transcripts per group was calculated based on the mean of FPKM in group R 0.5. FPKM is calculated with the formula:
FPMK = CL3N 3106
, where C is the number of fragments that map to a certain gene/ transcript, L is the length of the gene/transcript
in Kb and N is the fragments number that map to all genes/transcripts. Differentially expressed gene and transcript analyses were
performed with R package ballgown. Fold change (cutoff 1.5), p-value (% 0.05) and FPKM (R 0.5 mean in one group) were used
for filtering differentially expressed genes and transcripts.

Principal component analysis (PCA) and mRNA function enrichment analysis

Principal Component Analysis (PCA) and Hierarchical Clustering scatter plots and volcano plots were calculated for the differentially
expressed genes in R or Python environment for statistical computing and graphics. PCA was performed using the plotPCA function
in R with genes that have the ANOVA p value % 0.05 on FPKM abundance estimations (Not available for samples with no replicates).
Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analyses of the whole data set of DEG were performed using the R
package GAGE ‘‘Generally Acceptable Gene set Enrichment’’ (GAGE v.2.22.0) package implemented in R. The analysis allowed
us to determine whether the differentially expressed mRNAs are enriched in certain biological pathways. The p-values calculated
by Fisher’s exact test are used to estimate the statistical significance of the enrichment of the pathways between the two groups.
The R package ‘‘Pathview’’ v.1.12.0 and KEGGGraph v1.30.0 were used to visualize gene set expression data in the context of func-
tional pathways.

Immunofluorescence microscopy
Uninfected or L.m.-infected MDCK cells residing on glass substrates were incubated with 1 mg/mL Hoechst to stain the cells’ nuclei
for 10 min at 37 C prior to fixation. The following steps were carried out at room temperature. Cells were washed with PBS and fixed
with 4% EM grade formaldehyde in PBS for 10 min. Following a wash with PBS, samples were permeabilized for 5 min in 0.2% Triton
X-100 in PBS and washed again with PBS. Samples were then blocked for 30 min with 5% BSA in PBS and then incubated with pri-
mary antibodies (anti-vimentin: Abcam, ab8069; anti-pan cytokeratin: ThermoFisher, 53-9003-80; anti-tubulin: Abcam, ab52866;
anti-NF-kB: Abcam, ab190589; anti-E-cadherin: Cell Signaling, 3195; anti-ZO-1: Thermofisher, ZO1-1A12; anti-R.p., I7205 (gift
from Dr Ted Hackstadt, NIH Rocky Mountain Laboratories) diluted 1:100 in PBS containing 2% BSA for 1 h for all cases other
than anti-R.p. where dilution was 1:1000. Samples were washed in PBS three times and then incubated with the appropriate sec-
ondary fluorescent antibodies (Invitrogen) diluted 1:250 in PBS containing 2% BSA for 1 h. For actin staining we used 0.2 mM Alexa-
Fluor488 phalloidin (Thermo Fisher, A12379). Samples were washed three times in PBS and stored in 1 mL PBS for imaging. N > 8
mounds were analyzed per condition (N> 1200 cells). For epifluorescence imaging, we used an inverted Nikon Eclipse Ti2 with an
EMCCD camera (Andor Technologies) and a 40x 0.60NA Plan Fluor air or a 20x 0.75NA Plan Apo air objective and MicroManager
software. For confocal imaging we used a Yokogawa W1 Spinning Disk Confocal with Borealis upgrade on a Leica DMi6 inverted
microscope with a 50um Disk pattern, a 60x 1.4NA Plan Apo oil objective and MicroManager software.

Multiplexed magnetic Luminex cytokine immunoassay and data analysis

Samples were centrifuged at 8000 x g to remove debris and assayed immediately. The remaining samples were stored at -80 C. All
steps were performed at room temperature. 25 mL of each standard or control was added into the appropriate wells. 25 mL of assay
buffer was added for standard 0 (background). 25 mL of assay buffer was added to the sample wells. 25 mL of tissue culture media
solution was added to the background, standards, and control wells. 25 mL of sample supernatant was added into the appropriate
wells. The beads were vortexed briefly, and 25 mL of the mixed beads was added to each well. We used the Canine Cytokine Mag-
netic Bead Panel 96-Well Plate Assay (Millipore Sigma, # CCYTMG-90K-PX13). The plate was sealed, wrapped with foil and incu-
bated with agitation on a plate shaker over for 2 h. Following that, the well contents were gently removed, and the plate was washed
two times by manually adding and removing 200 mL wash buffer per well. Then, 25 mL of detection antibodies were added into each

Developmental Cell 56, 443–460.e1–e11, February 22, 2021 e7

 ll
Article

well. The plate was again sealed and covered with foil and incubated with agitation for 1 h. After incubation, 25 mL Streptavidin-
Phycoerythrin was added to each well containing the detection antibodies. (Plate was not washed after incubation with detection
antibodies as per manufacturer’s protocol). The plate was sealed and covered with foil and incubated with agitation for 30 min.
Then, well contents were gently aspirated out, and the plate was washed two times. Finally, 150 mL of sheath fluid was added to
all wells, and the beads were resuspended on a plate shaker for 5 min at room temperature. The plate was run on Bio-Plex 200
flow cytometer. Data analysis was performed using the Bio-Plex Manager 5.0. We used a 5-parameter log fit curve against the signal
intensities for the analytes present in the Canine Cytokine Magnetic bead Panel (GM-CSF, IFN-g, IL-2, IL-6, IL-7, IL-8, IL-15, IP-10,
KC-like, IL-10, IL-18, MCP-1, TNF-A) to generate a standard curve for the assay. Sample signal intensities were then back interpo-
lated to the standard curve to determine the analyte concentrations. The upper limit of quantitation (ULOQ) was determined as the
highest point at which the interpolated data of the standard curve are within 25% (±) of the expected recovery. ULOQ represents the
highest concentration of an analyte that can be accurately quantified. Similarly, the lower limit of quantitation (LLOQ) was determined
as the lowest point at which the interpolated data of the standard curve are within 25% (±) of the expected recovery. LLOQ represents
the lowest concentration of an analyte that can be accurately quantified.

Western blotting
To assess phosphorylation of the p65 subunit of NF-kB and expression levels of NF-kB, MDCK cells were seeded at a concentration
of 2 3 105 cells/well (24-well plates) for 24 h and then infected or not for 24 h with intracellular L.m. at a MOI
200 bacteria/cell. Cells
in infected wells were treated with vehicle control or the NEMO binding peptide (50 mM) starting 4 hpi. Cells were then lysed with a
buffer containing 0.5M Tris-HCl, pH 7.4, 1.5M NaCl, 2.5% deoxycholic acid, 10% NP-40, 10mM EDTA and a protease inhibitor
mixture (phenylmethylsulfonyl fluoride [PMSF], leupeptin, aprotinin, and sodium orthovanadate). The total cell lysate was separated
by SDS–PAGE (10% running, 4% stacking) and transferred onto a nitrocellulose membrane (Immobilon P, 0.45-mm pore size). The
membrane was then incubated with the designated antibodies. Immunodetection was performed using the Western-Light chemilu-
minescent detection system (Applied Biosystems). Membrane blots from 76 kDa to 52 kDa were imaged for phospho-p65 and p65
(65 kDa) and 52 kDa to 33 kDa were imaged for the corresponding b-actin (42 kDa) (Figure S6F).

Measurement of reactive oxygen species (ROS) production

The DCFDA cellular ROS detection assay kit (Abcam; ab113851) was used to measure ROS production. DCFDA is a cell permeable
fluorogenic dye that measures hydroxyl, peroxyl and other ROS activity within cells. Briefly, MDCK cells in monolayer were infected or
not with L.m. (JAT607, ActAp::mTagRFP) at low MOI. At 24 hpi cells were collected in tubes and then stained with 20 mM of DCFDA for
30 min at 37 C, as per manufacturer’s instructions. The dye was then washed out and the fluorescence signal per cell was measured
via flow cytometry. Positive controls were treated with 50 mM Tert-Butyl Hydrogen Peroxide (TBHP) for 1 h prior to conduction of
measurements.

Nuclear segmentation, tracking and characterization of dynamics of motion

We acquired time-lapse fluorescence confocal images of Hoechst-stained host epithelial cell nuclei and of the L.m. fluorescence us-
ing a spinning disk confocal with a 63x 1.2NA Plan Apo water objective at 30 min intervals (N=5 independent experiments for each
condition). For each time point, z stacks including the total height of the cell layer was also acquired with a z spacing of 0.7 mm. To
segment and track the host cell nuclei in 3D we used using IMARIS software (Bitplane) by first using the spot detection (segmentation)
and then the tracking modules. The x, y and z positions of all identified objects and tracks were exported for import into MATLAB
(MathWorks) for further analysis was performed to calculate cell displacements and speeds of migration. For each experimental
recording originating from an uninfected well or an infected well (centered around an infection mound) we followed the tracks of
n=271+/-65 tracks/experiment. The violin plots shown in Figure 1 show the median and the dotted lines the 25 and 75% quartiles
of all tracks considered. For each experiment (5 independent experiments) the average value over the entire field of view and
over time is shown as a triangle. For mean square displacement analysis (MSD) we used the @msdanalyzer MATLAB class (Tarantino
et al., 2014). We first computed for each cell its MSD as a function of time interval, Dt: MSDðDtÞ = C|ri(t + Dt)ri(t)|2D, where ri (t) in-
dicates the position of cell i at time t and C.D denotes the average over all time t. We then calculated the weighted average of all MSD
curves, where weights are taken to be the number of averaged delay in individual curves. In the average MSD plots the grayed area
represents the weighted standard deviation over all MSD curves and the errorbars the standard error of the mean. We estimated the
self-diffusion coefficient Ds = limDt/NMSD(Dt)/(4Dt) by linear weighted fir of the mean MSD curve on the first 500 min. In the plots
shown in Figures 1F and 1G the grayed area represents the weighted standard deviation over all MSD curves. The error bars
show the standard error of the mean which is approximated as the weighted standard deviation divided by the square root of the
number of degrees of freedom in the weighted mean. The red line represents the weighted mean MSD curve from which the diffusion
coefficient D is calculated. Finally, for analysis of the motion type of the objects (i.e. diffusive, subdiffusive or superdiffusive) we per-
formed log-log fitting and modeled the MSD curve by the following power law MSDðDtÞ = G 3 ta . For purely diffusive motion a=1, for
subdiffusive a<1 and for superdiffusive a>1. To determine the power law coefficient we take the logarithm of the power law so that it
turns linear: logðMSDÞ = a3logðtÞ + logðGÞ and by fitting log(MSD) versus log(t) we retrieve a. For more details please refer to @msda-
nalyzer MATLAB class (Tarantino et al., 2014).
2D tracking of L.m.-infected wild-type or aEcat KO MDCK cells was performed using epifluorescence microscopy following the
movement of Hoechst-stained host cell nuclei between 6 to 16 hpi 2D nuclear segmentation and tracking was performed using

e8 Developmental Cell 56, 443–460.e1–e11, February 22, 2021

 ll
Article

IMARIS software (Bitplane). The x, y and z positions of all identified objects and tracks were exported for import into MATLAB (Math-
Works) for further analysis of cellular speed, net/total distance travelled and coordination scores as described previously (Hayer et al.,
2016). Regarding coordination score calculation we considered a radius of 65 mm around each given cell for the calculation of the
pairwise velocity correlations (Hayer et al., 2016).
The correlation length shown in Figure S4J is calculated as previously documented (Tambe et al., 2011) and it is defined as in the
next equation:
P
j dðrj Þ$dðrj + RÞ
CðRÞ = P t;f
j dðrj Þ$dðrj Þ

where C is the correlation length for all vectors separated by a distance R, dðrj Þ is the modified displacement vector for a given po-
sition rj and the angle brackets signify an average over all directions and time. To avoid the dependence of the correlation value with
the absolute value of the displacement, we substrate the mean displacement of each frame (x) to the displacement vector (xðrj Þ),
dðrj Þ = xðrj Þ  x. We fit the correlation over the radius using the function CðRÞ = expð R =R0 Þ and determine the correlation length
as R0 .

Cell segmentation and extraction of cell shape characteristics

lMDCK cells were segmented based on pericellular E-cadherin localization using the Tissue Analyzer ImageJ plugin (Aigouy et al.,
2016). Masks of individual cells were exported and imported in MATLAB for further analysis. We used custom-made code for calcu-
pffiffiffiffiffiffiffiffiffiffi
lating the cell area, radial alignment angle q, aspect ratio and shape parameter q (perimeter= area). Radial alignment angle q is
defined as the angle between the radial direction (from the center of the field of view for uninfected cells or the center of the mound
for L.m.-infected wells) and the direction of the major axis of the cell (Figure 2A). If the angle is close to zero, cells are oriented radially
towards the center of the image (or the mound). If the orientation is close to 90 the orientation is circumferential. To quantify whether
there is any ordering in the orientation of cells, we also calculated for each cell how many of its 100 nearest neighbors share similar
orientation angles (Dq=+/-10o).

Characterization of mound volume and infection focus area

We acquired confocal images of Hoechst-stained host epithelial cell nuclei and of the fluorescent bacteria in fixed samples using a
spinning disk confocal with a 63x 1.2NA Plan Apo water objective. The z spacing used was 0.2 mm for MDCK cells and 0.7 mm for
A431D cells, since the field of view imaged for the latter was approximately 9-fold larger. The fields of view were selected so that
the infection mounds are approximately at the center of field of view. To quantify the volume of the cells extruded from the monolayer,
we first cropped out the lower z slices of each confocal image to exclude cells within the monolayer. We then segmented the channel
containing host cell nuclei to form binary images of each mound. An alpha radius of 50 was used to draw a tight boundary around the
segmented nuclei using the MATLAB (MathWorks) function alphaShape (Figures S1A–S1C). The area enclosed within this alpha
shape was calculated for each z slice. Lastly, we added up the area of each z slice, converted the area into mm2 and multiplied by
the increment between each z slice (0.2 mm for MDCK cells and 0.7 mm for A431D cells) to obtain the volume of the mound. An addi-
tional step was included in the analysis of aEcat KO MDCK cells and all mounds resulting from infection with R.p. As we observed
extrusion of uninfected cells in these cases, we binarized only infected nuclei using input from the bacterial channel. To do so, bac-
teria were segmented and then enlarged using the imdilate function in MATLAB (MathWorks). This image was applied as a mask to
the nuclei channel and only fluorescence within the mask was considered in the analysis. For each different experiment all values
were normalized relative to the corresponding values for infected WT MDCK cells treated with vehicle control. Unless indicated three
independent experiments were considered and N=13-19 infection mound volumes were calculated in total.
There is no standard metric in the field to measure the efficiency of L.m. cell-to-cell spread through a monolayer of host cells. To
characterize the area of the infection focus we chose to draw a convex hull, the smallest convex polygon that encompasses a set of
points, around the bacteria (Bastounis et al., 2018). This is a computationally inexpensive and consistent way to measure the effi-
ciency of L.m. spread.

Live/dead staining, TUNEL and BrdU assays

We used the NucRed Dead 647 ReadyProbes Reagent (Thermofisher, R37113), a cell impermeant stain that emits bright far-red fluo-
rescence when bound to DNA, for staining dead cells. This reagent stains the cells without plasma membrane integrity and was used
to measure cell viability. Briefly, one drop of this reagent was added in each well containing live cells and cells were incubated with
this reagent for 20 min before samples were imaged. The live-dead stain (Rincón et al., 2018) confirmed that many of the extruded
cells retain the stain (Figure S6E).
In addition, we used the TUNEL assay for DNA fragmentation (Abcam, ab66108) as a means to detect number of apoptotic cells.
For staining cells for DNA fragmentation, we followed the manufacturer’s instructions and quantified fluorescein-labeled DNA by flow
cytometry for cells at 24 hpi. The TUNEL assay performed to cells from uninfected and L.m.-infected wells showed that the latter
exhibited a 2-fold increase in TUNEL-positive cells (Figure S6D). We also used the BrdU staining kit for flow cytometry APC (eBio-
science; 8817-6600-42) to identify proliferating cells (Crane and Bhattacharya, 2013). However, BrdU can also stain apoptotic cells
due to the break-up of their genomic DNA by cellular nucleases (Darzynkiewicz and Zhao, 2011). For the BrdU assay we followed the

Developmental Cell 56, 443–460.e1–e11, February 22, 2021 e9

 ll
Article

manufacturer’s instructions and incubated cells at 24 h post-infection with 10 mm BrdU for 4 h at 37 C before harvesting the cells and
proceeding with the above protocol. We found that only 1% of cells from uninfected wells were BrdU-positive, as compared to 0.5%
of surrounders and 8% of mounders (Figure S6B). Interestingly, mounders that appeared BrdU-positive coincided with the infected
cells having the highest bacterial load (Figure S6C), suggesting that labeling under these conditions reflects apoptosis rather than
proliferation. Indeed, when we measured the number of cells collectively in uninfected versus infected wells, we found no differences
in the number of cells between the two conditions, suggesting that hyperproliferation in infection is probably not occurring
(Figure S6A).

Laser ablation experiments

Laser ablation experiments were performed on L.m.-infected MDCK cells at 24 hpi using the Firefly system (UGA-42 Firefly; Rapp
OptoElectronic) as per manufacturer’s instructions. The region of ablation was approximately 816 pixels in length and a 405 nm laser
traversed this region 270 times for a time period of 1 min passing through the entire height of the mound. During this time (immediately
before and after), we acquired confocal images of RFP-E-cadherin and the fluorescent bacteria using a spinning disk confocal with a
60x 1.4NA Plan Apo oil objective to determine relaxation of the system and subsequent wound healing. Images were every 1 min
immediately before and after laser ablation and with a z spacing of 0.7 mm. The E-cadherin channel was imaged using the
561 nm laser at full power with an exposure of 300 ms, the bacteria were imaged using the 488 nm laser at full power with an exposure
of 20 ms, and the brightfield image was taken with an exposure of 50 ms. The cells were imaged every minute for up to 1.5 h post-
ablation.
To analyze the displacements of cells upon laser ablation (recoil or relaxation) and their corresponding wound healing response, we
used the maximum intensity projections of E-cadherin images of cells and compared subsequent frames starting before laser abla-
tion and following cells every 1 min up to 1.5 h post-laser ablation using particle image velocimetry (PIV)-like technique (Bastounis
et al., 2014). For PIV, we used windows of 36 pixels with a 50% overlap. Using the component of the velocity that is perpendicular
to the laser ablated segment (uy) we then calculated for each instant of time the mean uy along the x-axis. Lining these means along
the x-axis over time, we obtained kymographs of mean displacements above and below the laser ablated line segment. In these ky-
mographs time, t (min) corresponds to the horizontal axis and position in the y-axis corresponds to the vertical axis (Figure 5C). This
representation allows for a detailed quantitative analysis of the recoil behavior of cells upon laser ablation (magnitude of recoil, spatial
location and temporal evolution). To quantitatively characterize recoil displacement based on the behavior of cells in response to
laser ablation for data originating from independent experiments, for each experiment we calculated the mean uy along the x-axis
but also along the y-axis considering in this case just the first 100 mm away from the ablated region.

Computational modeling of cell monolayers during infection

We assume the cells are arranged in the monolayer as regular hexagons with side length of 7 mm, the thickness of the monolayer is set
to 7 mm in the undeformed state following experimental observations and previous computational works (Escribano et al., 2019;
O’Dea and King, 2012; Schmedt et al., 2012). We model the mechanical behaviour of the cell distinguishing two main parts: active
and passive. The active part represents the actomyosin contractility motors and the passive one the rest of the cytoskeleton (Borau
et al., 2011; Moreo et al., 2008). In this way, both parts are assumed linear elastic material, where the total stiffness of each cell is the
sum of both (Ecell = Eactive + Epassive Þ. Following the experimental AFM measurements, the elastic modulus of uninfected cells is set in
1000 Pa and 250 Pa for the infected cells (Ecell ). As a first approach, we assume both parts of the cells are working in parallel, there-
fore, the active (Eactive ) and passive (Epassive ) elastic modulus are 500 Pa for uninfected cells and 125 Pa for infected cells. We assume
the passive part of the cell nearly incompressible, thus the Poisson ratio is set to 0.48 (Moreo et al., 2008). The active part of the cell is
mainly actomyosin contraction and we assume this contraction is not isotropic, it just occurs in the plane of the monolayer. Thus, the
Poisson ratio of the active part is assumed zero to uncouple effects in the monolayer plane and in the vertical direction for the active
part of the cell.
We model the substrate as a linear elastic material with elastic modulus of 3 kPa corresponding to collagen I-coated polyacryl-
amide hydrogels used in the TFM experiments. We consider in the model both cell-cell and cell-matrix interactions. We model
cell-cell interactions as a continuum and adopt a linear elastic model with elastic modulus of 1000 Pa and shear modulus of 500
Pa. When we simulate the inhibition of cell-cell adhesions we set these values close to zero, thus cells do not interact anymore me-
chanically with each other. Meanwhile, the cell-ECM interactions are simulated as cohesive contacts. We assume that cells adhere in
different ways to the substrate (Escribano et al., 2018; Sunyer et al., 2016) depending on whether there are cell-cell interactions or not.
If the cell-cell adhesions are active (cell monolayer behaves collectively), its adhesion to the substrate is weaker than if the cell-cell
adhesions are inhibited (cells forming the monolayer behave individually). The stiffness of the stiffer adhesion is assumed to be 1000
nN/mm3 per area of contact both in the normal and shear direction, and the weak one 10 nN/mm3 in the normal direction and negligible
in the shear direction. The total area of contact of each cell is 31.61 mm2 (6 zones of 5.268 mm2), thus, the total stiffness of the total
adhesion of each cell is 31608 nN/mm and 31.608 nN/mm for the high or low adhesion, respectively. We analyse a short period of time,
in which just one contraction and, if it occurs, one protrusion event are simulated. These events could be repeated in time and as a
result infection mounding would be more prominent.
To simulate cell ablation, we assume the cell loses its active part just considering the passive part of the cell (Nikolaev et al., 2014;
Vileno et al., 2007). Therefore, cell stiffness is reduced and, moreover, ablated cells cannot contract anymore. Cell-cell junctions
weaken due to ablation, thus the stiffness of cell-cell junctions in the ablated area is set close to zero during cell contraction and

e10 Developmental Cell 56, 443–460.e1–e11, February 22, 2021

 ll
Article

the cell-ECM adhesions are removed (stretching-based interactions). However, during cell protrusion cells are in contact with the
ablated area (compression-based contact).
To simulate how host cells behave when certain cells are able to form cell-cell adhesions while others not, and to better understand
in which scenarios an infection mound will be formed, we consider two cases. In the first one, all the infected cells and their immediate
surrounders are able to form cell-cell adhesions, but all the rest uninfected cells are not. In the second one, the infected cells and their
immediate surrounders are not able to form cell-cell adhesions, but uninfected cells far from the infection mound are able to. As in
previous simulations, when one edge of the cell cannot adhere to another cell’s edge, the cell-ECM interaction forces increase in
these edges of the cell. Thus, a cell without cell-cell adhesions in any direction would be an isolated cell with high cell-ECM traction
forces in all directions.
We implement the model into a commercial finite element model (FE-based) ABAQUS70. To simulate cells two meshes are over-
lapping sharing the nodes to represent the active and passive components of the cell. We discretise the model with tetrahedral and
hexahedral linear elements of average size 2 mm.

QUANTIFICATION AND STATISTICAL ANALYSIS

Statistical parameters and significance are reported in the Figures and the Figure Legends. Data are determined to be statistically
significant when p < 0.05 or p<0.01 by an unpaired Student’s T-Test (USTT), or Wilcoxon Rank Sum Test (WRST), where indicated.
As such, asterisk denotes statistical significance as compared to indicated controls. For statistical analysis of the kinematics and
shape morphometrics of large number of cells characterized in each experiment, we used violin plots considering all nuclei tracked
(Figures 1F, 1I, 1J, S4C, and S4J) or all cells characterized (Figures 2D, S2C, and S2D). In the violin plots dashed line represents the
median of the distribution and dotted lines the 25 and 75% quartiles considering data from all experiments. For each independent
experiment (replicate) the mean value was also calculated and indicated as a colored inverted triangle. Those means where then used
to calculate their average (horizontal bar) and standard deviation (vertical bars) and their p-value using an USTT (Lord et al., 2020). For
the rest of the data represented using barplots (e.g. relative infection mound volumes) midlines denote mean value and whiskers the
standard deviation (vertical bars). P-value was calculated using the non-parametric WRST and asterisk denotes p < 0.05. Statistical
analysis was performed in GraphPad PRISM 8.

Developmental Cell 56, 443–460.e1–e11, February 22, 2021 e11