Ecotoxicology and Environmental Safety 290 (2025) 117519

Contents lists available at ScienceDirect

Ecotoxicology and Environmental Safety

Abnormal methylation of Mill1 gene regulates osteogenic differentiation

A R T I C L E I N F O A B S T R A C T

Keywords: Excessive fluoride intake can lead to skeletal fluorosis. Nutritional differences in the same fluoride-exposed
Skeletal fluorosis environment result in osteosclerosis, osteoporosis, and osteomalacia. DNA methylation has been found to be
Mill1 involved in skeletal fluorosis and is influenced by environment and nutrition. In a previous study, we screened
DNA methylation
eight genes with differential methylation associated with various phenotypes of skeletal fluorosis. By combining
methionine
gene functions, Mill1 gene was selected for subsequent experiments. First, we found that the Mill1 gene was
hypomethylated and upregulated in osteosclerosis skeletal fluorosis, whereas it was hypermethylated and
downregulated in osteoporosis/osteomalacia skeletal fluorosis. Similar results were obtained in the cell exper­
iments. Subsequently, we validated the regulation of Mill1 gene methylation using DNMT1 and TET2 enzyme
inhibitors. Furthermore, we knockdown and overexpression experiments confirmed its downregulation inhibited
osteogenic differentiation, whereas osteogenic differentiation was promoted by its overexpression. These find­
ings imply that abnormal methylation of the Mill1 gene triggered by fluoride under diverse nutritional condi­
tions, regulates its expression and participates in osteogenic differentiation, potentially resulting in various
phenotypes of skeletal fluorosis. Eventually, we use methionine for interventions both in vivo and in vitro. The
results indicated that under normal nutrition and fluoride exposure followed by methionine intervention, the
methylation levels of the Mill1 gene increased, whereas its high expression and enhanced osteogenic differen­
tiation were restrained. This study offers a theoretical foundation for understanding the mechanism behind the
various phenotypes of skeletal fluorosis through the perspective of DNA methylation and for employing nutrients
to intervene in skeletal fluorosis.

1. Introduction Veneri et al., 2023a). Fluoride has the potential to disrupt bone
remodeling, leading to various pathological changes, such as osteo­
As a highly reactive non-metal, fluorine mainly exists in natural sclerosis, osteoporosis and osteomalacia (Qin et al., 2009). Osteoporosis
compounds. An excessive intake of fluoride, typically through drinking and osteomalacia often coexist and are collectively referred to as
water, air, or ingested food, can lead to the development of fluorosis osteoporosis/osteomalacia. Furthermore, the researches has indicated
(Qiao et al., 2021; Peckham and Awofeso, 2014). Prolonged exposure to the abnormal activity of osteoblasts plays a crucial role alongside an
fluoride may lead to detrimental effects on various organs and body imbalance in bone remodeling during the progression of skeletal fluo­
systems, with particular vulnerability observed in the skeletal system rosis (Guan et al., 2017; Sun et al., 2014). These characteristics not only
(Zhou et al., 2023; Taher et al., 2024; Ameeramja and Perumal, 2017; demonstrate the typical pathological changes associated with skeletal

Abbreviations: NC, normal control; MC, monophagia control; OS, osteosclerosis skeletal fluorsis; OP, osteoporosis/osteomalacia skeletal fluorsis; DNMT1, DNA
methyltransferases 1; TET2, ten-eleven translocation 2; TBS, targeted bisulfite sequencing; rBMSCs, rat of bone marrow mesenchymal stem cells; N, normal nutrition;
NF, normal nutrition and fluoride exposure; L, low nutrition; LF, low nutrition and fluoride exposure; Met, methionine; qRT-PCR, quantitative real-time reverse
transcription polymerase chain reaction; ALP, Alkaline phosphatase staining; ARS, Alizarin Red S staining.
* Corresponding author.
E-mail address: [email protected] (X. Pan).
1
Niannian Chen and Jing Zhang contributed equally to this work.

https://doi.org/10.1016/j.ecoenv.2024.117519
Received 29 September 2024; Received in revised form 2 December 2024; Accepted 8 December 2024
Available online 13 December 2024
0147-6513/© 2024 The Author(s). Published by Elsevier Inc. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-
nc-nd/4.0/).
N. Chen et al. Ecotoxicology and Environmental Safety 290 (2025) 117519

fluorosis but also significantly contribute to the onset and progression of et al., 2008; Mochizuki et al., 2012). The Mill1 gene has not been re­
various phenotypes of skeletal fluorosis ported in the study of bone-related diseases but its family member,
Previous studies have indicated that the occurrence and advance­ MICA, has been reported to be participated in the advancement of
ment in skeletal fluorosis are significantly influenced by nutritional bone-related diseases, such as osteosarcoma and multiple myeloma
factors (Shankar et al., 2021; Simon et al., 2014). In regions with better (Yamada et al., 2012; Tahri et al., 2024; Liu et al., 2024; Markides et al.,
nutrition but high rates of fluoride poisoning, patients with fluorosis 2018; Kosta et al., 2022; Kim et al., 2024 Jan 8). This study builds upon
often manifest characteristics indicative of skeletal sclerosis (Choubisa our previous screening results and aims to determine whether the Mill1
et al., 2009; Tefera et al., 2022). Conversely, in areas characterized by gene plays a role in various phenotypes of skeletal fluorosis.
poor nutrition and fluoride poisoning, individuals are more susceptible Based on the aforementioned evidence, we first observed the
to osteoporosis/osteomalacic skeletal fluorosis (Mulualem et al., 2022). methylation level and expression of Mill1 in animal and cell models and
This phenomenon has also been observed in animal models (Li, 2004; verified whether its expression was regulated by the methylation level.
Iwaniec and Turner, 2008). However, previous studies have not yet Furthermore, the effect of abnormal expression of the Mill1 gene on
clarified the relation between nutritional components and the underly­ osteogenic differentiation was explored by overexpressed or knocked
ing mechanisms controlling the different forms of skeletal fluorosis. down Mill1 expression. Finally, methionine was added in vitro and in
DNA methylation refers to the process by which the methyl donor S- vivo, and the effect of methionine on the abnormal methylation of Mill1
adenosylmethionine provides a methyl group, which is then transferred gene and osteogenic differentiation was observed. This study offers
by DNA methyltransferases to the fifth carbon atom of cytosine in CpG novel perspectives into the pathogenesis of various phenotypes of skel­
dinucleotides within the genome, leading to the formation of 5-methyl­ etal fluorosis through the methylation of Mill1 and the intervention of
cytosine. Methylation levels of CpG islands have a close relation with skeletal fluorosis from nutrients.
gene expression (Liu et al., 2023; Zeng and Chen, 2019; Bakulski et al.,
2023; Duran-Ferrer and Martín-Subero, 2024). This methylation process 2. Materials and methods
is facilitated by DNA methyltransferases, specifically DNMT1, DNMT3A,
and DNMT3B. Among these, DNMT1 is particularly important because it 2.1. Establishment of various phenotypes of skeletal fluorosis rat model
maintains the stability of the methylating enzymes and preferentially
acts on hemimethylated CpG sites to maintain their methylation status We have built various phenotypes of skeletal fluorosis in rats, with
(Li et al., 2018; Lyko, 2018). Owing to its reversible nature, 5-methylcy­ comprehensive details documented in our previous study (Ding et al.,
tosine can be converted to 5-hydroxymethylcytosine through the action 2023). Briefly, we acquired forty SPF-class Sprague-Dawley rats (four
of ten-eleven translocation enzymes (TETs), resulting in DNA deme­ weeks old), from Changsha Tianqin Biotechnology Co., Ltd. The rats
thylation (Li and Xu, 2019). TET1, TET2 and TET3 in the TET family, were randomly allocated into four groups, with each group including ten
which are participated in this conversion, with TET2 being particularly rats and an equal number of males and females.
important for maintaining the unmethylated pattern of DNA, controlling The standard maintenance diet was provided to the normal control
gene silencing induced by methylation, and thus regulating gene (NC) group and osteosclerosis skeletal fluorosis (OS) group, whereas the
expression (Cong et al., 2021). Our research and other reserches have monophagia control (MC) group and osteoporosis/osteomalacia skeletal
shown that the advancement of skeletal fluorosis is influenced by DNA fluorosis (OP) group were fed diet of low calcium and low protein.
methylation (Delgado-Calle and Riancho, 2012; Veneri et al., 2023b; During the experiment, we administered 20 mg/kg.bw NaF solution by
Pan et al., 2020; Wu et al., 2019). As research on the influence of gavage in OS and OP groups, whereas the NC and MC groups were
nutrition and DNA methylation deepens, it will become possible to administrated equal volumes of deionized water by gavage. The selec­
explore various phenotypes of skeletal fluorosis through the lens of DNA tion of the exposure dose of 20 mg/kg.bw was based on the literature
methylation. and our preliminary experimental results (Fan et al., 2006; Zhang et al.,
Methionine (Met) is a vital amino acid requied by the human body, 2015). Gavage administration was conducted for 6 d per week for a total
however it lacks the ability to be produced internally and thus must be experimental period of 5 months. The Ethics Committee on Laboratory
acquired through dietary sources (Mahmoud and Ali, 2019). Addition­ Animals of Guizhou Medical University granted approval for all exper­
ally, it protects tissues and organs affected by fluoride (Błaszczyk et al., imental procedures and techniques mentioned in this study (approval
2010). Furthermore, within the body, a one-carbon unit (methyl group) number: 1900201). At the end of the experiment, we observed the for­
combines with 5-methyltetrahydrofolate to synthesize methionine. This mation of dental fluorosis, tested urine, serum, and bone fluoride
is converted into S-adenosylmethionine, which participates in the DNA exposure levels, measured bone metabolism markers in serum, and used
methylation processes (Mentch and Locasale, 2016). Therefore, methi­ micro-CT and HE staining to examine changes in skeletal tissue imaging
onine mediates this process by maintaining or altering DNA methylation and pathology. The results showed that rats in OS group exhibited
levels. Based on the literature and previous research, we propose the osteosclerosis, whereas those in OP group displayed osteoporosis (Ding
following scientific hypothesis. Under different nutritional conditions, et al., 2023). This confirmed the successful establishment of a rat model
fluoride induces abnormal gene methylation of key genes involved in for skeletal fluorosis in which the present study employed bone tissue of
bone formation or resorption processes, leading to changes in their rats as the experimental material.
expression levels and subsequently triggering the manifestation of
different phenotypes associated with skeletal fluorosis. 2.2. Cells culture and treatment
In previous study, we referred to the literature to successfully
established the various phenotypes of skeletal fluorosis rat model by Osteoblasts, which are key cells in the process of bone formation,
feeding standard maintenance diet or diet of low calcium and low pro­ originate from mesenchymal stem cells found within bone marrow. We
tein, all with fluoride exposures. Additionally, mRNA-seq combined successfully isolated and identified rat bone marrow mesenchymal stem
with targeted bisulfite sequencing (TBS) was used to screen eight cells（rBMSCs）from six-week-old SD rats using the methods described
differentially methylated genes (Ostn, Siglec15, Cthrc1, Slc9b2, Mill1, in our previous study (Ding et al., 2023). Based on the results of pre­
Serpinh1, Dhh, Atp6v0a4) in the skeletal tissue of rats (Ding et al., 2023). liminary experiments and the serum fluoride levels in the ratmodel, we
Among them, the Mill1 gene is a member in the major histocompatibility choose the fluoride dose of 300 μmol/L NaF (Ding et al., 2023). The
complex class I-related protein family. In addition to participate in im­ rBMSCs were cultured and induced to undergo osteogenic differentia­
mune defence and nutrient metabolism, it has been found that its tion under various nutritional conditions and fluoride exposure levels,
methylation state and expression may have an impact on primordial simulating various phenotypes of skeletal fluorosis in rat model. The
germ cells (Watanabe et al., 2004; Kasahara et al., 2002; Rabinovich experimental groups included the normal nutrition (N) group, the

2
N. Chen et al. Ecotoxicology and Environmental Safety 290 (2025) 117519

normal nutrition and fluoride exposure (NF) group, the low nutrition (L) were randomly allocated into five groups of eight rats, with an equal
group, and the low nutrition and fluoride exposure (LF) group. The cell distribution of males and females. A standard maintenance diet was
culture medium for the N and NF groups consisted of normal nutritional provided to the NC and OS groups, whereas the OP group was fed diet of
α-MEM medium (Gibco, USA), which contained 200 mg/L CaCl2 and low calcium and low protein. The methionine intervention OS (Met+OS)
15 mg/L L-methionine. The L and LF groups utilized customized low group was given a standard diet supplemented with 10 mg/kg of
nutritional α-MEM medium (iCell Bioscience, China), containing methionine, OP (Met+OP) group was fed diet of low calcium and low
100 mg/L CaCl2 and 7.5 mg/L L-methionine. The rBMSCs (1 ×105) were protein, and supplemented with 10 mg/kg of methionine. The NC group
respectively seeded into either normal nutrient medium or customized received an equivalent volume of deionized water by gavage, whereas
low nutritional medium and incubated in a humidified environment at the other groups were treated with a NaF solution at a exposure dose of
37℃ with 5 % CO2. When the cell density reached 60 %, rBMSCs were 20 mg/kg.bw via gavage, 6 d a week, for 5 months. The Ethics Com­
induced into osteogenic differentiation by osteogenic differentiation mittee on Laboratory Animals of Guizhou Medical University granted
solution containing NaF (0, 300 μmol/L) for 7 d. Osteogenic differenti­ approval for all experimental procedures and techniques mentioned in
ation medium contained 50 μg/mL L-ascorbic acid-2-phosphate, this study (approval no: 1900201).
5 mmol/L β-glycerophosphoric acid, and 100 nmol/L dexamethasone
(all reagents were purchased from Sigma-Aldrich, USA). 2.6. Targeted bisulfite sequencing (TBS)
To validate the regulatory function of methylation levels at the Mill1
gene promoter on its expression, rBMSCs exposed to fluoride were TBS was evaluate the methylation levels of Mill1 gene in both bone
treated with a TET2-specific inhibitor (TFMB-(S)-2-HG, MedChemEx­ tissue and cellular samples. Sequencing was performed by the Shenzhen
press, USA), at the concentration of 200 μmol/L, under normal nutrition. Ace Gene Company for the purpose of detection. The specific primer
Furthermore, rBMSCs exposed to fluoride were administered with a sequences for the Mill1 gene are as follows: forward primer: 5′-
DNMT1-specific inhibitor (procainamide, MedChemExpress, USA) at a AGGAAGTTTATTTATGAGAAGGTAAAGT-3′; and reverse primer: 5′-
concentration of 500 μmol/L under low nutrition. CTTTAATCTTACTCCACTAATACCTC-3′.

2.3. Cell transfection 2.7. Quantitative real-time reverse transcription PCR (qRT-PCR)

We artificially increased or decreased the expression of Mill1 in The TRIzol reagent (Invitrogen, USA) was utilized to extract total
rBMSCs. Lentiviral particles that containing the Mill1 overexpression RNA in skeletal tissues and cells. The concentration of the extracted RNA
vector and shRNA-Mill1 vector, and their respective negative controls was quantified utilizing the NanoDrop 2000 spectrophotometer
were acquired from GeneChem (Shanghai GeneChem Co., Ltd., China). (Thermo Fisher Scientific, USA), and cDNA was synthesized through a
The lentiviral vector for shRNA-Mill1 was GV493-hU6-MCS-CBh-gcGFP- reverse transcription reaction with the PrimeScript TM RT reagent Kit
IRES-puromycin, with the target sequence of shRNA-Mill1 being 5′- (TaKaRa, Japan). The specific primers used were as follows:
GGTGTCCATTTGGGTTCTTCC-3′ (NM_001011931). The Mill1 over­ Mill1-F: 5’-CGTCTAGAGCAGCACGAACACC-3′.
expression vector was GV492-Ubi-MCS-3FLAG-CBh-gcGFP-IRES- Mill1-R: 5’-GAGCCTGATGTGAATCTGTTGTGAA-3′.
puromycin, and the primers used to extend Mill1 were 5′-AGGTC­ β-actin-F: 5′-TGTCACCAACTGGGACGATA-3′.
GACTCTAGAGGATCCCGCCACCATGATGTTGTCCAGGGACCTCA GAG- β-actin-R: 5′-GGGGTGTTGAAGGTCTCAAA-3′.
3′ (forward) and 5′-TCCTTGTAGTCCATACCGGTGACGAGGGTCAGAA The qRT-PCR was conducted in the CFX96 Real-Time Fluorescence
CTGCCAACAC-3′ (reverse). Lentiviral particles enclosing the Mill1 Quantification System (Bio-Rad, USA) with the TB Green®Fast qPCR
downregulation (sh-Mill1) or upregulation (oe-Mill1) constructs were Mix (TaKaRa, Japan). The expression of the Mill1 gene was normalized
effectively transfected into rBMSCs. Empty vectors or nonsense se­ to the levels of β-actin and the relative expression in each sample was
quences served as controls. Following lentiviral administration, puro­ calculated using the 2-ΔΔCT method.
mycin at the dose of 5 μg/mL was applied to select rBMSCs that had been
successfully transfected for 48 h. The determination of transfection ef­ 2.8. Western blot
ficiency was conducted through the utilization of qRT-PCR and western
blot analysis. To extract the total protein in bone tissue and cells, an efficient tis­
sue/cell RIPA lysis buffer (Beyotime, Shanghai) was used, and a protein
2.4. Methionine intervention in vitro quantification kit (Beyotime, Shanghai) was used to quantification. A
10 % SDS-PAGE gel was prepared according to the molecular weight of
To evaluate the influence of methionine supplementation on the the protein, and 10 μg protein was loaded onto the gel. Electrophoresis
methylation levels and expression of the Mill1 gene, along with osteo­ was performed to separate the proteins, which were then transferred
genic differentiation under fluoride exposure and various nutrition, we onto polyvinylidene fluoride membranes (Millipore, USA). The mem­
performed methionine intervention in vitro experiment. The cells that brane was blocked with 5 % (w/v) nonfat skim milk at room tempera­
were cultured and induced into osteogenic differentiation by osteogenic ture for 2 h, followed by washing with TBST. Overnight incubation at
differentiation solution, which including either 0 or 300 μmol/L NaF, 4℃ was then carried out using the following primary antibodies: anti-
and were treated with a solution of 60 μmol/L methionine for 7 d. The MILL1 antibody (Absin, Shanghai) at a dilution of 1:1000, anti-OPN
experimental groups were classified as follows, the normal nutrition (N) antibody (provided by Wanleibio, Shenyang) at a dilution of 1:1000,
group, the normal nutrition and fluoride exposure (NF) group, the anti-osteocalcin antibody (Wanleibio, Shenyang) at a dilution of 1:500,
normal nutrition and fluoride exposure and methionine supplement and anti-α-tubulin antibody (Proteintech, Wuhan) at a dilution of
(Met + NF) group, the low nutrition (L) group, the low nutrition and 1:2000. After another TBST wash, the membranes were incubated with
fluoride exposure (LF) group, the low nutrition and fluoride exposure the corresponding horseradish peroxidase-conjugated secondary anti­
and methionine supplement (Met + LF) group. bodies diluted to 1:10000 at room temperature for 1 hour. The poly­
vinylidene fluoride membranes were evenly coated with enhanced
2.5. Methionine intervention in vivo chemiluminescent reagents. The protein bands were scanned using the
ChemiDoc™XRS+ Gel Imaging System (manufactured by Bio-Rad,
We have established a rat model that explores the effect of methio­ USA), and the grayscale values of the protein bands were analyzed
nine on various phenotypes of skeletal fluorosis, with findings being using Image J software (with the α-tubulin protein band serving as a
disseminated currently. SPF-class Sprague-Dawley rats (four weeks old) reference).

3
N. Chen et al. Ecotoxicology and Environmental Safety 290 (2025) 117519

2.9. Alkaline phosphatase (ALP) and alizarin red S staining (ARS) the methylation levelsin a CpG island of the Mill1 gene promoter region
in rats of skeletal tissue from each experimental group (Fig. 1A), fol­
After a 7 d culture period, the cells were stained for ALP using the lowed by observation of its expression via qRT-PCR and western blot.
BCIP/NBT kit (Beyotime, Shanghai). At the 14 d mark of the culture, the These findings showed that compared with the NC group, there was a
cells were fixed with 70 % ethanol and then incubated in a solution of decrease in methylation levels at two CG sites (cg79630429 and
40 mmol/L alizarin red (pH 4.2) (Solarbio, Beijing). Nonspecific binding cg79630539) in the OS group, concomitant with an upregulation in
was eliminated by washing with PBS, and the alizarin red staining was expression (P < 0.05); Nonetheless, the MC group did not exhibit any
observed under a microscope. Subsequently, the Alizarin Red was sol­ significant changes in both the methylation levels and expression of the
ubilized with 10 % cetylpyridinium (Sigma-Aldrich, USA) for 1 h at Mill1 gene. (P＞0.05) (Fig. 1B-D). In contrast to the MC group, the OP
room temperature, and the activity of Alizarin Red was determined group displayed enhanced methylation level at one site (cg79630429),
spectrophotometrically at a wavelength of 562 nm. which was associated with a reduction in both mRNA and protein
expression (P < 0.05) (Fig. 1B-D). Additionally, in contrast to the OS
group, the OP group exhibited an increase in methylation levels at two
2.10. Statistical analysis sites (cg79630429 and cg79630539), which was paralleled by a
decrease in the expression of mRNA and protein (P < 0.05) (Fig. 1B-D).
Statistical analysis was performed using SPSS version 26.0, and Previously, we examined the expression of osteogenic differentiation
GraphPad Prism 9 was used to creat the visual graphics. The data that markers in skeletal tissue from rats with various phenotypes of skeletal
pertained to quantities were represented in the form of mean values fluorosis. Our results indicated that the expression of Runx2, Osterix,
along with their standard deviations (χ ± S). To assess the disparities ALP, and Col1α1 was higher in the OS group compared to both the NC
among the various sets of quantitative data, a one-way analysis of and OP groups. However, there were significant disparities observed
variance (One-ANOVA) was utilized. For the purpose of multiple com­ between the OP and MC groups. Additionally, no significant correlation
parisons, Tukey’s honestly significant difference (HSD) test was used. were found between the NC and MC groups (Ding et al., 2023).
Additionally, the Spearman correlation coefficient method was We examined the interplay between Mill1 gene methylation levels,
employed for the analysis of correlations, with the significance level set expression, and osteogenic differentiation markers. The findings
at α= 0.05. revealed that methylation levels at two sites (cg79630429 and
cg79630539) within the Mill1 gene promoter exhibited an inverse
3. Results relationship with mRNA and protein expression in both OS and OP
groups (Fig. 1E-F). Additionally, the levels of Mill1 mRNA and protein
3.1. Mill1 gene methylation levels and expression in various phenotypes of expression were notably associated with the expression of ALP and
skeletal fluorosis Col1α1 (Fig. 1E-F). These observations indicate that the Mill1 gene
might regulate its transcriptional activity through modified methylation
We aimed to observe the methylation levels of CG sites in the Mill1 patterns, potentially affecting the formation of various phenotypes of
gene promoter region and evaluate its expression from each group rats skeletal fluorosis by participating in osteogenic differentiation.
of skeletal tissue. To accomplish it, we applied a TBS assay to measure

Fig. 1. Mill1 gene methylation levels and expression in various phenotypes of skeletal fluorosis. (A) Predicted map of CpG island in the promoter region of the
Mill1 gene; (B) Methylation levels of CG sites in a CpG island of the Mill1 gene (n = 8); (C-D) Results of Mill1 gene mRNA and protein expression in rats (n = 10); (E)
Correlation between methylation levels of CG sites in the CpG island of the Mill1 gene, its expression, and osteogenic differentiation markers in the OS group; (F)
Correlation between methylation levels of CG sites in a CpG island of the Mill1 gene, its expression, and osteogenic differentiation markers in the OP group;
*P ≤ 0.05,**P ≤ 0.01,***P ≤ 0.001,****P ≤ 0.0001.

4
N. Chen et al. Ecotoxicology and Environmental Safety 290 (2025) 117519

3.2. Mill1 gene methylation levels and expression in osteoblasts under 2-HG group exhibited elevated methylation levels at three sites
various nutrition and fluoride exposure (cg79630429, cg79630526, and cg79630539) (P < 0.05) (Fig. 3A).
Conversely, when comparing the LF group to the LF+Procainamide
We detected the methylation levels and expression of the Mill1 gene group, a decrease in methylation levels at four sites (cg79630429,
through in vitro experiments. TBS assay revealed that, compared with cg79630451, cg79630493, cg79630539) was observed (P＜0.05)
the N group, the NF group indicated decreased methylation levels at two (Fig. 3A). Subsequent analyses by qRT-PCR and western blot indicated
CG sites, namely cg79630429 and cg79630539 (P < 0.05) (Fig. 2A), that treatment with TFMB-(S)-2-HG led to a significant reduction in
whereas the L group showed a decrease in methylation level at one CG Mill1 mRNA and protein expression (P < 0.05) (Fig. 3B-D), whereas
site, cg79630539 (P < 0.05) (Fig. 2A). In contrast to the L group, the LF treatment with procainamide resulted in a significant increase in Mill1
group showed increased methylation levels at four CG sites: mRNA and protein expression (P < 0.05) (Fig. 3B-D). The above findings
cg79630451, cg79630493, cg79630526, and cg79630539 (P < 0.05) suggested that the expression of the Mill1 gene was regulated by its
(Fig. 2A). Furthermore, when the LF group was compared to the NF methylation level.
group, a significant upsurge in methylation levels was observed at five
CG sites, including cg79630429, cg79630451, cg79630493,
3.4. Effects of abnormal expression of the Mill1 gene on the
cg79630526, and cg79630539 (P < 0.05) (Fig. 2A).
differentiation of osteoblasts under various nutrition and fluoride exposure
Subsequently, we used qRT-PCR and western blot to evaluate the
transcription and protein expression of Mill1. The findings showed that
To elucidate the effect of aberrant expression of Mill1 gene on oste­
compared with the N group, the NF group exhibited significantly higher
ogenic differentiation under various nutrition and fluoride exposure, we
levels of Mill1 mRNA and protein expression (P < 0.05) (Fig. 3B-C),
used lentiviral vectors to stably knockdown or overexpress Mill1 in
whereas no significant differences were observed in the L group.
rBMSCs, and its expression was verified through qRT-PCR and western
Furthermore, the LF group demonstrated reduced Mill1 mRNA and
blot (Fig. 4A-C). Based on the alterations observed in the expression of
protein expression compared with the NF and L groups (P < 0.05)
Mill1, it was noted that under normal nutrition combined with fluoride
(Fig. 3B-C). In addition, the LF group exhibited lower levels of Mill1
exposure, the knockdown of Mill1 resulted in a decrease in the expres­
mRNA and protein expression when compared with the NF group. These
sion of osteogenic differentiation markers, such as OCN and OPN.
results indicate that Mill1 gene is hypomethylated and upregulated
Additionally, both ALP and ARS staining showed signs of weakening,
under normal nutrition and fluoride exposure, whereas under low
suggesting suppression of osteogenic differentiation (Fig. 4D-I). Under
nutrition with fluoride exposure, the Mill1 gene is hypermethylated and
low nutrition and fluoride exposure, overexpression of Mill1 led to
downregulated. These observations are consistent with the alterations in
increased expression of OCN and OPN, and ALP and ARS staining were
rats of bone tissue with various phenotypes of skeletal fluorosis.
enhanced, promoting osteogenic differentiation (Fig. 4D-I). In conclu­
sion, under normal nutrition and fluoride exposure, the differentiation
of osteoblasts was inhibited by knockdown of the Mill1 gene; under low
3.3. Effects of inhibiting TET2 and DNMT1 enzymes on the methylation
nutrition and fluoride exposure, the differentiation of osteoblasts was
levels and expression of the Mill1 gene in osteoblasts under various
promoted by the overexpression of the Mill1 gene.
nutrition and fluoride exposure

We previously detected the expression of DNMT1, DNMT3A, 3.5. Effects of methionine on the Mill1 gene and osteogenic differentiation
DNMT3B, TET1, TET2 and TET3 in vitro, and found that only the in osteoblasts under various nutrition and fluoride exposure
expression of DNMT1 and TET2 showed statistically significant in re­
sults. Thus, to explore whether changes in the methylation level of the As an important nutrient involved in DNA methylation, methionine
Mill1 gene regulate its expression, rBMSCs exposed to fluoride with has a protective effect in individuals with fluorosis (Chen et al., 2021).
normal nutrition were treated with a TET2 enzymean inhibitor (TFMB- To investigate the effect of methionine on the methylation level,
(S)-2-HG), whereas those exposed to fluoride under low nutrition were expression of the Mill1 gene and osteogenic differentiation under
treated with a DNMT1 enzyme inhibitor (procainamide). The rBMSCs various nutrition and fluoride exposure, we employed a 60 μmol/L
were then induced to osteogenic differentiate for a period of 7 d. TBS methionine solution as an intervention in vitro. The findings indicated
analysis revealed that, compared with the NF group, the NF+TFMB-(S)- that the methylation level of one site (cg79630429) was increased in the

Fig. 2. Mill1 gene methylation levels and expression in osteoblasts under various nutrition and fluoride exposure. (A) Methylation levels of CG sites in a CpG
island of the Mill1 gene (n = 3); (B-C) Results of Mill1 mRNA and protein expression in osteoblasts (n = 3); *P ≤ 0.05,**P ≤ 0.01,***P ≤ 0.001,****P ≤ 0.0001.

5
N. Chen et al. Ecotoxicology and Environmental Safety 290 (2025) 117519

Fig. 3. Effects of inhibiting TET2 and DNMT1 enzymes on the methylation levels and expression of the Mill1 gene in osteoblasts under various nutrition
and fluoride exposure. (A) Methylation levels of CG sites in the CpG island of the Mill1 gene (n = 3); (B-D) Results of Mill1 mRNA and protein expression in
osteoblasts (n = 3); *P ≤ 0.05,**P ≤ 0.01,***P ≤ 0.001, ****P ≤ 0.0001.

Met+NF group (P < 0.05) (Fig. 5A), and a notable reduction in the fluorosis remains an important concern for public health. The study
expression of Mill1 mRNA and protein(P < 0.05), and OCN and OPN reported that fluoride can lead to aberrant alterations in the density of
expression were inhibited (Fig. 5B-F). ALP and ARS staining were skeletal tissue, causing osteosclerosis or osteoporosis (Qin et al., 2009).
weakened, but calcium mineralization changes were not obvious (P＞ Studies have shown that both genetic and epigenetic factors can influ­
0.05) (Fig. 5G-I). The methylation levels of the two sites (cg79630429 ence the development of skeletal fluorosis (Mousny et al., 2006).
and cg79630451) were reduced in the Met+LF group (P < 0.05), Additionally, extensive evidence suggests that DNA methylation plays a
(Fig. 5A), the expression of Mill1 mRNA and protein were increased crucial role in skeletal advancement and osteoblast activity. DNA
(P < 0.05) (Fig. 5B-F), but the expression of OCN、OPN were inhibited methylation may be involved in the development of various
(P < 0.05) (Fig. 5B-F). ALP and ARS staining were weakened, but bone-related diseases, such as arthritis and rheumatoid arthritis,
changes in calcium mineralization were not statistically significant (P＞ through its impact on the levels of methylation in growth factors, dif­
0.05). ferentiation factors, inflammatory factors, and reactive oxygen
species-related stress factors (Webster et al., 2018; Tong et al., 2022;
Humphries et al., 2023; Visconti et al., 2021). However, the mechanisms
3.6. Effects of methionine on the Mill1 gene and osteogenic differentiation of various phenotypes of skeletal fluorosis is not fully understood, and
in various phenotypes of skeletal fluorosis there are no targeted drug therapies and effective treatments for this
disease.
Subsequently, we further observed the effects of methionine inter­ Previous research indicated that variations in nutrition are significant
vention in vivo. The methylation levels of three sites (cg79630429, contributors to the development of various phenotypes of skeletal fluo­
cg79630526 and cg79630539) have shown an increase in the OS group rosis. Moreover, DNA methylation, an epigenetic modification, is sus­
(P < 0.05) (Fig. 6A). As methylation levels increased, Mill1 mRNA and ceptible to environmental and nutritional influences and could be a
protein expression were decreased, OCN and OPN expression were critical factor in the progression of distinct skeletal fluorosis phenotypes
inhibited (P < 0.05) (Fig. 6B-F). However, there were no significant (Ding et al., 2023). Therefore, we screened eight genes with differential
disparities in methylation and expression levels in the OP group, and no methylation from various phenotypes of skeletal fluorosis and we focused
obvious changes in osteogenic differentiation were observed (P＞0.05) on the role of Mill1 in this study. Currently, there are few studies on the
(Fig. 6A-F). The experimental results suggest that methionine can Mill1 gene. Animal studies have shown that in mouse bone marrow,
reverse the hypomethylation of Mill1 gene and inhibit its expression and MILLs preferentially bind to low-differentiation/high-proliferation cells
osteogenic differentiation in osteosclerosis of skeletal fluorosis. that have high nutritional requirements and may play an important role
in nutritional metabolism through iron metabolism (Watanabe et al.,
4. Dicussion 2004; Kasahara et al., 2002; Rabinovich et al., 2008). Its family member
MICA gene is commonly found in osteosarcoma, multiple myeloma, acute
Elevated levels of fluoride contamination in the environment pose myeloid leukemia, and other diseases (Alkhayer et al., 2023; Chen and
significant health risks to individuals across numerous countries and Gyllensten, 2014; Kyrysyuk and Wucherpfennig, 2023; Nwangwu et al.,
regions (Srivastava and Flora, 2020). Research exploring the effects of 2017; Sun et al., 2011). Therefore, based on the differential methylation
fluoride on skeletal health has been ongoing for over fifty years. Skeletal

6
N. Chen et al. Ecotoxicology and Environmental Safety 290 (2025) 117519

Fig. 4. Effects of abnormal expression of the Mill1 gene on the differentiation of osteoblasts under various nutrition and fluoride exposure. (A-C)
Knockdown or overexpression of Mill1 was confirmed through qRT-PCR and western blot (n = 3); (D-F) Results of osteogenic differentiation markers expression in
osteoblasts (n = 3); (G) Alkaline phosphatase staining of osteoblasts (7 d); (H-I) Alizarin red staining of osteoblasts (14 d) (50 μm) and semi-quantitative bar chart;
*P ≤ 0.05,**P ≤ 0.01,***P ≤ 0.001,****P ≤ 0.0001.

degree (top 5) and the gene function that Mill1 might have, we selected it that Mill1 gene methylation regulates its transcription and expression.
for follow-up studies. Among the five CG sites of Mill1 being observed, only the methylation
We observed the differential methylation levels and expression of changes in cg79630429 have consistently shown statistical significance,
Mill1 gene in rats from various phenotypes of skeletal fluorosis. These which suggests that cg79630429 may be a key locus involved in its
findings indicated that the Mill1 gene showed hypomethylation and high transcriptional regulation.
expression in OS groups, hypermethylation and low expression in OP To elucidate the effect of abnormal expression of the Mill1 gene on
groups. Additional correlation analysis revealed, a negative association the osteogenic differentiation of osteoblasts in various nutritional con­
between the methylation levels of the Mill1 gene and its transcription ditions and fluoride exposure, we used lentiviral vectors to repress or
expression. Furthermore, MILL1 exhibits a positive relation with the augment Mill1 in these cells. We found that reducing Mill1 levels
expression of markers for osteogenic differentiation in rats of bone tissue inhibited osteogenic differentiation in the presence of fluoride under
exhibiting various phenotypes of skeletal fluorosis. These findings normal nutrition, whereas its overexpression promoted osteogenic dif­
indicate that aberrant methylation of this gene could potentially affect ferentiation under low nutrition in the presence of fluoride. Our previ­
the process of osteogenic differentiation and play a role in the ous study also found that the Cthrc1 gene promotes osteogenic
advancement of various phenotypes of skeletal fluorosis by regulating of differentiation through low methylation and high expression under
transcriptional expression. normal nutrition and fluoride exposure, while inhibiting osteogenic
Subsequently, we performed in vitro experiments under various differentiation through high methylation and low expression under low
nutritional conditions with fluoride exposure to corroborate the results nutrition and fluoride exposure (Ding et al., 2023). Nonetheless, addi­
observed in animal model. The findings indicated that under normal tional study is required to clarify the effects of Mill1 on osteoclasts
nutrition and fluoride exposure led to reduce the methylation levels of differentiation.
the Mill1 gene and enhanced its expression. In an environment with low Beneficial effects of methionine in mitigating fluoride toxicity have
nutrition, increased methylation of the Mill1 gene was observed, which been reported (Chen et al., 2021), the precise mechanism behind this
was caused by fluoride and led to a reduction in its expression. The phenomenon remains unclear. In line with the theme of DNA methyl­
modification of this gene through methylation and the alterations in its ation in this study, we detected the effect of methionine supplementa­
expression corresponded to the findings observed in animal study. tion on gene methylation, and results in vitro showed that methionine
Furthermore, to demonstrate the impact of Mill1 gene methylation on its supplementation as a methyl donor may enhance hypomemethylation
transcriptional regulation, we used DNA methyltransferase and deme­ levels and decrease transcriptional expression of the Mill1 gene, leading
thylase inhibitors to inhibit DNMT1 and TET2 enzymes and confirmed to the inhibition of osteogenic differentiation under normal nutrition

7
N. Chen et al. Ecotoxicology and Environmental Safety 290 (2025) 117519

Fig. 5. Effects of methionine on the Mill1 gene and osteogenic differentiation in osteoblasts under various nutrition and fluoride exposure. (A) Methylation
levels of CG sites in a CpG island of the Mill1 gene (n = 3); (B-F) Results of the expression of the Mill1 gene and osteogenic differentiation markers in osteoblasts
(n = 3); (G) Alkaline phosphatase staining of osteoblasts (7 d); (H-I) Alizarin red staining of osteoblasts (14 d) (50 μm) and semi-quantitative bar chart; *P ≤ 0.05,
**P ≤ 0.01,***P ≤ 0.001,****P ≤ 0.0001.

and fluoride exposure. Under low nutrition and fluoride exposure, it nutrition in this study, this suggests that, besides methionine, there may
suppresses hypermethylation of Mill1 and increases its transcriptional be other nutrients influencing the methylation status of this gene, which
expression. These findings are consistent with previous reports that warrants further investigation (Waterland and Jirtle, 2003; Bekdash,
methionine can affect DNA hypermethylation status by influencing the 2021).
activity of DNMT1 (Zhang, 2015). However, under low nutrition and In summary, considering the results from both in vivo and in vitro
fluoride exposure in vitro, increased expression of Mill1 gene after experiments, this study confirmed that hypomethylation and high
methionine supplementation did not result in significant changes in expression of Mill1 gene under normal nutrition and fluoride exposure
osteogenic differentiation. Subsequently, in animal experiments, it was promote osteogenic differentiation, which is the potential involvement
found that after intervention with methionine, the hypomethylation of this factor in the pathogenesis of osteosclerosis skeletal fluorosis.
level of Mill1 gene and high expression were reversed in OS group, and Conversely, the hypermethylation and low expression of Mill1 gene
osteogenic differentiation was inhibited, which is consistent with the under low nutrition and fluoride exposure inhibit osteogenic differen­
results of in vitro experiments. However, no significant were observed in tiation, potentially implicating it in the progress of osteoporosis or
the methylation levels and expression of Mill1 after intervention with osteomalacia skeletal fluorosis. Methionine can reverse the hypo­
methionine for OP group, and osteogenic differentiation was not sig­ methylation and high expression of Mill1 gene under normal nutrition
nificant as well. This finging is inconsistent with the results of in vitro and fluoride exposure, and osteogenic differentiation was inhibited.
experiments under low nutrition and fluoride exposure. We consider These results contribute to our understanding of the mechanisms un­
that this may be related to the difference in methionine metabolism derlying various phenotypes of skeletal fluorosis through nutrition and
between in vivo and in vitro under low nutrition, but the specific reasons DNA methylation. Simultaneously, the effects of methionine interven­
still need to be studied further. As for why the Mill1 gene is hypo­ tion may offer insights into prophylaxis and therapeutic strategies
methylated under normal nutrition but hypermethylated under low against skeletal fluorosis.

8
N. Chen et al. Ecotoxicology and Environmental Safety 290 (2025) 117519

Fig. 6. Effects of methionine on the Mill1 gene and osteogenic differentiation in various phenotypes of skeletal fluorosis. (A) Methylation levels of CG sites
in a CpG island of the Mill1 gene (n = 8);（B-F）Results of the expression of the Mill1 gene and osteogenic differentiation markers in rats (n = 8);
*P ≤ 0.05,**P ≤ 0.01,***P ≤ 0.001,****P ≤ 0.0001.

Funding information to sodium fluoride. Biol. Trace Elem. Res 133 (1), 60–70. https://doi.org/10.1007/
s12011-009-8412-z.
Chen, D., Gyllensten, U., 2014. MICA polymorphism: biology and importance in cancer.
This work was supported by the National Natural Science Foundation Carcinogenesis 35 (12), 2633–2642. https://doi.org/10.1093/carcin/bgu215.
of China (grant number: 81960575); and the Science and Technology Chen, T., Tao, N., Yang, S., Cao, D., Zhao, X., Wang, D., Liu, J., 2021. Association
Foundation of Guizhou Provincial Health Commission (grant number: between dietary intake of one-carbon metabolism-related nutrients and fluorosis in
Guizhou, China. Front Nutr. 8, 700726. https://doi.org/10.3389/fnut.2021.700726.
gzwkj2021–421). Choubisa S.L., Choubisa L., Choubisac D. Osteo-dental fluorosis in relation to nutritional
status, living habits, and occupation in rural tribal areas of Rajasthan, India.Fluoride,
2009, 42(3):210-215. https://doi.org/10.1016/j.etp.2008.10.004.
CRediT authorship contribution statement Cong, B., Zhang, Q., Cao, X., 2021. The function and regulation of TET2 in innate
immunity and inflammation. Protein Cell 12 (3), 165–173. https://doi.org/10.1007/
Niannian Chen: Data interpretation, Experiments performing, s13238-020-00796-6.
Delgado-Calle, J., Riancho, J.A., 2012. The role of DNA methylation in common skeletal
Writing - manuscript. Jing Zhang: Investigation, Writing – original disorders. Biol. (Basel) 1 (3), 698–713. https://doi.org/10.3390/biology1030698.
draft. Congyu Yin: Investigation. Yudan Liao: Investigation. Lei Song: Ding, H., Yin, C., Yang, M., Zhou, R., Wang, X., Pan, X., 2023. Screening of differentially
Validation. Ting Hu: Validation. Xueli Pan: Conceptualization, Super­ methylated genes in skeletal fluorosis of rats with different types and involvement of
aberrant methylation of Cthrc1. Environ. Pollut. 332, 121931. https://doi.org/
vision, Resources, Writing – review & editing, Project administration,
10.1016/j.envpol.2023.121931.
Funding acquisition. Duran-Ferrer, M., Martín-Subero, J.I., 2024. Epigenomic characterization of lymphoid
neoplasms. Annu Rev. Pathol. 19, 371–396. https://doi.org/10.1146/annurev-
pathmechdis-051122-100856.
Fan, W., Zhang, H., Yu, M., Zhou, L., Wei, Y., Xie, C., 2006. Replication of the animal
Declaration of Competing Interest
model of different style skeletal fluorosis caused by coal-burning. Mod. Prev. Med
33, 2100–2102. https://doi.org/10.3969/j.issn.1003-8507.2006.11.035.
The authors declare that they have no known competing financial Guan, Z.Z., Wang, L.H., Sun, D.J., 2017. Endemic fluorosis. In: Sun, D.J. (Ed.),
Endemiology. People’ s Medical Publishing House of China, Beijing.
interests or personal relationships that could have appeared to influence
Humphries, S., Bond, D.R., Germon, Z.P., Keely, S., Enjeti, A.K., Dun, M.D., Lee, H.J.,
the work reported in this paper. 2023. Crosstalk between DNA methylation and hypoxia in acute myeloid leukaemia.
Clin. Epigenetics 15 (1), 150. https://doi.org/10.1186/s13148-023-01566-x.
Data availability Iwaniec, U.T., Turner, R.T., 2008. Animal Models for Osteoporosis - ScienceDirec.
Osteoporos. (Third Ed. ) 985–1009. https://doi.org/10.1016/B978-012370544-
0.50041-0.
Data will be made available on request. Kasahara, M., Watanabe, Y., Sumasu, M., Nagata, T., 2002. A family of MHC class I-like
genes located in the vicinity of the mouse leukocyte receptor complex. Proc. Natl.
Acad. Sci. USA 99 (21), 13687–13692. https://doi.org/10.1073/pnas.212375299.
References Kim, S., Chung, H., Kwak, J.E., Kim, Y.R., Park, C.H., Kim, Y., Cheong, J.W., Wu, J.,
Shin, E.C., Cho, H., Kim, J.S., 2024 Jan 8. Clearing soluble MIC reverses the impaired
Alkhayer, R., Ponath, V., Frech, M., Adhikary, T., Graumann, J., Neubauer, A., von function of natural killer cells from patients with multiple myeloma. J. Immunother.
Strandmann, E.P., 2023. KLF4-mediated upregulation of the NKG2D ligand MICA in Cancer 12 (1), e007886. https://doi.org/10.1136/jitc-2023-007886.
acute myeloid leukemia: a novel therapeutic target identified by enChIP, 4 Cell Kosta, A., Mekhloufi, A., Lucantonio, L., Zingoni, A., Soriani, A., Cippitelli, M.,
Commun. Signal 21 (1), 94. https://doi.org/10.1186/s12964-023-01118-z. Gismondi, A., Fazio, F., Petrucci, M.T., Santoni, A., Stabile, H., Fionda, C., 2022.
Ameeramja, J., Perumal, E., 2017. Pulmonary fluorosis: a review. Environ. Sci. Pollut. GAS6/TAM signaling pathway controls MICA expression in multiple myeloma cells.
Res Int 24 (28), 22119–22132. https://doi.org/10.1007/s11356-017-9951-z. Front Immunol. 13, 942640. https://doi.org/10.3389/fimmu.2022.942640.
Bakulski, K.M., Blostein, F., London, S.J., 2023. Linking prenatal environmental Kyrysyuk, O., Wucherpfennig, K.W., 2023. Designing Cancer Immunotherapies That
exposures to lifetime health with epigenome-wide association studies: state-of-the- Engage T Cells and NK Cells. Annu Rev. Immunol. 41, 17–38. https://doi.org/
science review and future recommendations. Environ. Health Perspect. 131 (12), 10.1146/annurev-immunol-101921-044122.
126001. https://doi.org/10.1289/EHP12956. Li, G.S., 2004. Pathogenesis of Endemic Fluorosis: Beijing. Science Press.
Bekdash, R.A., 2021. Early life nutrition and mental health: the role of DNA methylation. Li, W., Xu, L., 2019. Epigenetic Function of TET Family, 5-Methylcytosine, and 5-
Nutrients 13 (9), 3111. https://doi.org/10.3390/nu13093111. Hydroxymethylcytosine in Hematologic Malignancies. Oncol. Res Treat. 42 (6),
Błaszczyk, I., Grucka-Mamczar, E., Kasperczyk, S., Birkner, E., 2010. Influence of 309–318. https://doi.org/10.1159/000498947.
methionine upon the activity of antioxidative enzymes in the kidney of rats exposed

9
N. Chen et al. Ecotoxicology and Environmental Safety 290 (2025) 117519

Li, Y., Zhang, Z., Chen, J., Liu, W., Lai, W., Liu, B., Li, X., Liu, L., Xu, S., Dong, Q., Sun, F., Li, X., Yang, C., Lv, P., Li, G., Xu, H., 2014. A role for PERK in the mechanism
Wang, M., Duan, X., Tan, J., Zheng, Y., Zhang, P., Fan, G., Wong, J., Xu, G.L., underlying fluoride-induced bone turnover. Toxicology 325, 52–66. https://doi.org/
Wang, Z., Wang, H., Gao, S., Zhu, B., 2018. Stella safeguards the oocyte methylome 10.1016/j.tox.2014.07.006.
by preventing de novo methylation mediated by DNMT1. Nature 564 (7734), Sun, D., Wang, X., Zhang, H., Deng, L., Zhang, Y., 2011. MMP9 mediates MICA shedding
136–140. https://doi.org/10.1038/s41586-018-0751-5. in human osteosarcomas. Cell Biol. Int 35 (6), 569–574. https://doi.org/10.1042/
Liu, C., Tang, H., Hu, N., Li, T., 2023. Methylomics and cancer: the current state of CBI20100431.
methylation profiling and marker development for clinical care. Cancer Cell Int 23 Taher, M.K., Momoli, F., Go, J., Hagiwara, S., Ramoju, S., Hu, X., Jensen, N., Terrell, R.,
(1), 242. https://doi.org/10.1186/s12935-023-03074-7. Hemmerich, A., Krewski, D., 2024. Systematic review of epidemiological and
Liu, Z., Wang, H., Liu, H., Ding, K., Shen, H., Zhao, X., Fu, R., 2024. Targeting NKG2D/ toxicological evidence on health effects of fluoride in drinking water. Crit. Rev.
NKG2DL axis in multiple myeloma therapy. Cytokine Growth Factor Rev. 76, 1–11. Toxicol. 54 (1), 2–34. https://doi.org/10.1080/10408444.2023.2295338.
https://doi.org/10.1016/j.cytogfr.2024.02.001. Tahri, S., Piccinelli, S., Su, N.K., Lampe, L.M., Dong, H., Vergara Cadavid, J.,
Lyko, F., 2018. The DNA methyltransferase family: a versatile toolkit for epigenetic Boiarsky, R., Papazian, N., Lightbody, E.D., Cao, A., Alberge, J.B., Ferrari de
regulation. Nat. Rev. Genet 19 (2), 81–92. https://doi.org/10.1038/nrg.2017.80. Andrade, L., Rahmat, M., Shen, Y., Blanco Fernández, L., Zabaleta, A.,
Mahmoud, A.M., Ali, M.M., 2019. Methyl Donor Micronutrients that Modify DNA Getz, Guenther A., Sonneveld, G., Cupedo, P., Wucherpfennig, T., Ghobrial, K.W.,
Methylation and Cancer Outcome. Nutrients 11 (3), 608. https://doi.org/10.3390/ Romee, I.M., 2024. R. Inhibition of MICA and MICB shedding enhances memory-like
nu11030608. NK cell-mediated cytotoxicity against multiple myeloma. Blood Adv. 8 (20),
Markides, H., McLaren, J.S., Telling, N.D., Alom, N., Al-Mutheffer, E.A., Oreffo, R.O.C., 5365–5370. https://doi.org/10.1182/bloodadvances.2023010869.
Zannettino, A., Scammell, B.E., White, L.J., El Haj, A.J., 2018. Translation of remote Tefera, N., Mulualem, D., Baye, K., Tessema, M., Woldeyohannes, M., Yehualashet, A.,
control regenerative technologies for bone repair. NPJ Regen. Med 3, 9. https://doi. Whiting, S.J., 2022. Association Between Dietary Fluoride and Calcium Intake of
org/10.1038/s41536-018-0048-1. School-Age Children With Symptoms of Dental and Skeletal Fluorosis in Halaba,
Mentch, S.J., Locasale, J.W., 2016. One-carbon metabolism and epigenetics: Southern Ethiopia. Front Oral. Health 3, 853719. https://doi.org/10.3389/
understanding the specifi city. Ann Ny Acad Sci, 91e8, 1363. https://doi.org/ froh.2022.853719.
10.1111/nyas.12956. Tong, L., Yu, H., Huang, X., Shen, J., Xiao, G., Chen, L., Wang, H., Xing, L., Chen, D.,
Mochizuki, K., Tachibana, M., Saitou, M., Tokitake, Y., Matsui, Y., 2012. Implication of 2022. Current understanding of osteoarthritis pathogenesis and relevant new
DNA demethylation and bivalent histone modification for selective gene regulation approaches. Bone Res 10 (1), 60. https://doi.org/10.1038/s41413-022-00226-9.
in mouse primordial germ cells. PLoS One 7 (9), e46036. https://doi.org/10.1371/ Veneri, F., Iamandii, I., Vinceti, M., Birnbaum, L.S., Generali, L., Consolo, U.,
journal.pone.0046036. Filippini, T., 2023b. Fluoride Exposure and Skeletal Fluorosis: a Systematic Review
Mousny, M., Banse, X., Wise, L., Everett, E.T., Hancock, R., Vieth, R., Devogelaer, J.P., and Dose-response Meta-analysis. Curr. Environ. Health Rep. 10 (4), 417–441.
Grynpas, M.D., 2006. The genetic influence on bone susceptibility to fluoride. Bone https://doi.org/10.1007/s40572-023-00412-9.
39 (6), 1283–1289. https://doi.org/10.1016/j.bone.2006.06.006. Veneri, F., Vinceti, M., Generali, L., Giannone, M.E., Mazzoleni, E., Birnbaum, L.S.,
Mulualem, D., Hailu, D., Tessema, M., Whiting, S.J., 2022. Association of Dietary Consolo, U., Filippini, T., 2023a. Fluoride exposure and cognitive
Calcium Intake with Dental, Skeletal and Non-Skeletal Fluorosis among Women in neurodevelopment: Systematic review and dose-response meta-analysis. Environ.
the Ethiopian Rift Valley. Int J. Environ. Res Public Health 19 (4), 2119. https://doi. Res 221, 115239. https://doi.org/10.1016/j.envres.2023.115239.
org/10.3390/ijerph19042119. Visconti, V.V., Cariati, I., Fittipaldi, S., Iundusi, R., Gasbarra, E., Tarantino, U., Botta, A.,
Nwangwu, C.A., Weiher, H., Schmidt-Wolf, I.G.H., 2017. Increase of CIK cell efficacy by 2021. DNA Methylation Signatures of Bone Metabolism in Osteoporosis and
upregulating cell surface MICA and inhibition of NKG2D ligand shedding in multiple Osteoarthritis Aging-Related Diseases: An Updated Review. Int J. Mol. Sci. 22 (8),
myeloma. Hematol. Oncol. 35 (4), 719–725. https://doi.org/10.1002/hon.2326. 4244. https://doi.org/10.3390/ijms22084244.
Pan, X., Yan, W., Qiu, B., Liao, Y., Liao, Y., Wu, S., Ming, J., Zhang, A., 2020. Aberrant Watanabe, Y., Maruoka, T., Walter, L., Kasahara, M., 2004. Comparative genomics of the
DNA methylation of Cyclind-CDK4-p21 is associated with chronic fluoride Mill family: a rapidly evolving MHC class I gene family. Eur. J. Immunol. 34 (6),
poisoning. Chem. Biol. Inter. 315, 108875. https://doi.org/10.1016/j. 1597–1607. https://doi.org/10.1002/eji.200424919.
cbi.2019.108875. Waterland, R.A., Jirtle, R.L., 2003. Transposable elements: targets for early nutritional
Peckham, S., Awofeso, N., 2014. Water fluoridation: a critical review of the physiological effects on epigenetic gene regulation. Mol. Cell Biol. 23 (15), 5293–5300. https://
effects of ingested fluoride as a public health intervention. Sci. World J. 26 (2014), doi.org/10.1128/MCB.23.15.5293-5300.2003.
293019. https://doi.org/10.1155/2014/293019. Webster, A.P., Plant, D., Ecker, S., Zufferey, F., Bell, J.T., Feber, A., Paul, D.S., Beck, S.,
Qiao, L., Liu, X., He, Y., Zhang, J., Huang, H., Bian, W., Chilufya, M.M., Zhao, Y., Han, J., Barton, A., Williams, F.M.K., Worthington, J., 2018. Increased DNA methylation
2021. Progress of Signaling Pathways, Stress Pathways and Epigenetics in the variability in rheumatoid arthritis-discordant monozygotic twins. Genome Med 10
Pathogenesis of Skeletal Fluorosis, 3 Int J. Mol. Sci. 22 (21), 11932. https://doi.org/ (1), 64. https://doi.org/10.1186/s13073-018-0575-9.
10.3390/ijms222111932. Wu, S., Yan, W., Qiu, B., Liao, Y., Gu, J., Wei, S., Zhang, A., Pan, X., 2019. Aberrant
Qin, X., Wang, S., Yu, M., Zhang, L., Li, X., Zuo, Z., Zhang, X., Wang, L., 2009. Child methylation-induced dysfunction of p16 is associated with osteoblast activation
skeletal fluorosis from indoor burning of coal in southwestern China. J. Environ. caused by fluoride. Environ. Toxicol. 34 (1), 37–47. https://doi.org/10.1002/
Public Health 2009, 969764. https://doi.org/10.1155/2009/969764. tox.22655.
Rabinovich, B.A., Ketchem, R.R., Wolfson, M., Goldstein, L., Skelly, M., Cosman, D., Yamada, N., Yamanegi, K., Ohyama, H., Hata, M., Nakasho, K., Futani, H., Okamura, H.,
2008. A role for the MHC class I-like Mill molecules in nutrient metabolism and Terada, N., 2012. Hypoxia downregulates the expression of cell surface MICA
wound healing. Immunol. Cell Biol. 86 (6), 489–496. https://doi.org/10.1038/ without increasing soluble MICA in osteosarcoma cells in a HIF-1α-dependent
icb.2008.41. manner. Int J. Oncol. 41 (6), 2005–2012. https://doi.org/10.3892/ijo.2012.1630.
Shankar, P., Khandare, A.L., Validandi, V., Khandare, S., 2021. Supplementation of Zeng, Y., Chen, T., 2019. DNA Methylation Reprogramming during Mammalian
Calcium and Fluoride-Free Water Mitigates Skeletal Fluorosis in Fluoride-Intoxicated Development. Genes (Basel) 10 (4), 257. https://doi.org/10.3390/genes10040257.
Rats. Biol. Trace Elem. Res 199 (6), 2225–2237. https://doi.org/10.1007/s12011- Zhang, N., 2015. Epigenetic modulation of DNA methylation by nutrition and its
020-02326-1. mechanisms in animals. Anim. Nutr. 1 (3), 144–151. https://doi.org/10.1016/j.
Simon, M.J., Beil, F.T., Rüther, W., Busse, B., Koehne, T., Steiner, M., Pogoda, P., aninu.2015.09.002.
Ignatius, A., Amling, M., Oheim, R., 2014. High fluoride and low calcium levels in Zhang, X., Qin, X., Qin, M., Yu, M., 2015. Morphological changes of bone in progress of
drinking water is associated with low bone mass, reduced bone quality and fragility coal-burning fluorosis of rat. Chin. J. Public Health 31, 70–73. https://doi.org/
fractures in sheep. Osteoporos. Int 25 (7), 1891–1903. https://doi.org/10.1007/ 10.11847/zgggws2015-31-01-21.
s00198-014-2707-4. Zhou, J., Sun, D., Wei, W., 2023. Necessity to Pay Attention to the Effects of Low Fluoride
Srivastava, S., Flora, S.J.S., 2020. Fluoride in Drinking Water and Skeletal Fluorosis: a on Human Health: an Overview of Skeletal and Non-skeletal Damages in
Review of the Global Impact. Curr. Environ. Health Rep. 7 (2), 140–146. https://doi. Epidemiologic Investigations and Laboratory Studies. Biol. Trace Elem. Res 201 (4),
org/10.1007/s40572-020-00270-9. 1627–1638. https://doi.org/10.1007/s12011-022-03302-7.

10