BIOL2103

Biological Sciences
Laboratory Course

Dr. W. Y. Lui (6 lectures + 3 practical sessions)

Course co-ordinator
Office: Rm4N09 KBSB
Email: [email protected]
(use BIOL2103 as subject when email me)
 Biological Sciences Laboratory Course

Topics to be covered in 6 lectures and 3 practical sessions

DNA sequencing
DNA electrophoresis
Restriction enzyme digestion and DNA mapping
Isolation of nucleic acids and spectrophotometry

Each lab manual consists of:

Part A: Experiment
Part B: Basic technique

2
 Biological Sciences Laboratory Course

Learning outcomes:
Through the studies, you should be able to
(i) Explain the principles of the basic techniques
(ii) Apply the knowledge to answer simple scientific questions
(iii) Master some basic research techniques

3
 Biological Sciences Laboratory Course

History of DNA sequencing

1977 Maxam and Gilbert - chemical method
Sanger – dideoxy method

1986 Automated cycle sequencing with dye terminators

(commonly used for routine sequencing in general research labs)

Recently Next generation sequencing:

Pyrosequencing
Solexa sequencing
SOLiD

4
 Biological Sciences Laboratory Course

Maxam and Gilbert

“Chemical method”
Step 2. Label the single-
stranded DNA at the 5’ end
with 32P

Step 3. Cleavage by base- “G” reaction “A+G” “T+C” “C” reaction

reaction reaction
specific chemical reaction. Preferentially Preferentially
After cleaved the DNA at at A at T
specific nucleotides, the
cleaved DNA fragments
without the 5’-end 32P-label
are removed.

Step 4. The 5’-end 32P labeled

DNA fragments per reaction
are separated by
electrophoresis according to
their size

Step 5. Develop the X-ray film

and read the sequence from 5
there
 Biological Sciences Laboratory Course

Deoxyribonucleotides (A, T, C, G)
BASES
Purine

7 5 1
9

NH2

Pyrimidine

1
3 3

6
 Biological Sciences Laboratory Course

Linkage between nucleotides

Nucleotides are joined together by a

phosphodiester linkage between 5’ and
3’ carbon atoms

The 3’ hydroxyl group (purple ellipse)

is essential for the DNA strand
extension
3

7
 Biological Sciences Laboratory Course

Sanger “Dideoxy method”

- A method is based on in vitro DNA synthesis performed in the presence of

modified nucleotides (dideoxyribonucleotides)
“Normal” “Modified”

8
 Biological Sciences Laboratory Course

Sanger “Dideoxy method”

- Four separate reactions are required to sequence a DNA sample
- Each reaction contains the following components:
(i) DNA sample (e.g. single-stranded DNA) = DNA template
(ii) 32P-labeled primer
(iii) DNA polymerase
(iv) normal four deoxyribonucleotides, dNTPs (dATP, dTTP, dCTP and dGTP)
(v) small amount of one dideoxyribonucleotide (ddATP, ddTTP, ddCTP or ddGTP)
- Reaction: DNA sample as the template for in vitro synthesis

To sequence a DNA sample:

Reaction A T C G

Components: (i-iv)
+ ddATP + ddTTP + ddCTP + ddGTP

9
 Biological Sciences Laboratory Course

Sanger “Dideoxy method”

Reaction A as an example
(iv) dNTPs (v) ddATP

(ii)
(iii)

(i)

A set of
partial DNA replicas

- A set of partial DNA replicas will be synthesized

- The replicas are all beginning at the same place (labeled primer), but terminating at
different points along the DNA template where the ddATP is incorporated
Since ddATP lacks a 3’ hydroxyl group, it blocks the addition of the next nucleotide
10
 Biological Sciences Laboratory Course

Sanger “Dideoxy method”

- To determine the DNA
sequence, four reactions
(A, T, C, G) are needed
- Four sets of reaction
products are analyzed in
four parallel lanes of a
polyacrylamide gel by
electrophoresis
- DNA sequence can be
determined from the x-ray
film

11
 Biological Sciences Laboratory Course

Sanger “Dideoxy method”

It’s great, but…………………..

Drawbacks:
1. Require handling radioactive substance
(P32 primer labeling)
2. Four different reactions for a DNA sample
3. Manual sequence read from the x-ray film

Would it be better if
1. Fluorescent dye could be used
2. Everything ran in a single tube (single reaction)
3. Sequence read could be done automatically

Is it possible????

12
 Biological Sciences Laboratory Course

Automated cycle sequencing with

dye-terminators
- Single reaction for a DNA sample
- Reaction contains the following components:
(i) DNA sample (e.g. single-stranded DNA)
(ii) Primer
(iii) DNA polymerase
(iv) normal dNTPs (dATP, dTTP, dCTP and dGTP)
(v) small amount of four fluorescently-labeled ddNTPs
(green-ddATP, red-ddTTP, blue-ddCTP and yellow-ddGTP)
- Use the DNA template for in vitro synthesis by repeating reaction cycle (cycle
sequencing)

DNA Template 3’ T G G C A T A 5’
13
 Biological Sciences Laboratory Course

Automated cycle sequencing with dye-terminators

- A capillary (+ve pole) and negative pole are immersed into the cycle sequencing products
- Apply voltage à negatively charged DNA migrates into the capillary
- Laser beams through the detection cell
- Computer-connected detector receives the signals and the signals are then converted to
meaningful output (chromatogram)
capillary -ve pole

Detection cell

14
Detection cell
 Biological Sciences Laboratory Course

Automated cycle sequencing with dye-terminators

Meaningful output - Chromatogram

15
 Biological Sciences Laboratory Course

Next generation sequencing….

Pyrosequencing
Illumina (Solexa) sequencing
SOLiD sequencing (Sequencing by ligation)
Nature 2005 437:376-380

16
 Biological Sciences Laboratory Course

Pyrosequencing
- High throughput DNA sequencing
- By detecting light produced whenever a nucleotide is incorporated
- Sequencing by synthesis

Reaction requires DNA template, dNTP, adenosine 5’ phosphosulfate (APS), luciferin,

sequencing primer and four enzymes including (a) DNA polymerase, (b) ATP sulfurylase,
and (c) luciferase, and (d) apyrase
Overview:
Pre-set dNTP loading sequence:
e.g. G -> C -> T -> A
CGTCCGGCGTCCGGTATGCA

GCAGGCCG

(a)
dNTPs PPi
A peak seen
dNTPs
(Unincorporated & APS (b) in Pyrogram
Unmatched) ATP
(d) (c)
Degraded Luciferin Oxyluciferin + light

17
 Biological Sciences Laboratory Course
Pyrosequencing
Steps 1:
- Sequencing primer hybridizes to a single-stranded DNA that serves as a template
- dGTP, dCTP, dTTP and dATP are dispensed into the system in a pre-set loading sequence
- dGTP is dispensed first (e.g. loading sequence: G, C, T, A)
- DNA polymerase catalyzes the incorporation into the DNA strand if that
deoxyribonucleotide (e.g. dGTP) is complementary to the base in the template strand
- Incorporation of nucleotide to the DNA strand accompany with the release of
pyrophosphate (PPi) in the presence of (a) DNA polymerase
- PPi release is in a quantity equimolar to the amount of nucleotides incorporated
 Biological Sciences Laboratory Course

Pyrosequencing
Steps 2-3:
- (b) ATP sulfurylase converts newly synthesized PPi to ATP in the presence of APS
- ATP drives (c) luciferase-mediated conversion of luciferin to oxyluciferin and generates
visible light
- The amount of light generated is proportional to the amount of ATP
- Light is detected by a charge couple device (CCD) chip and seen as a peak in pyrogram
- Height of the peak is proportional to the amount of nucleotides incorporated in the
reaction (step 1)

19
 Biological Sciences Laboratory Course

Pyrosequencing
Step 4:
- Unincorporated nucleotide (e.g. excess dGTP) are degraded by (d) apyrase
Apyrase
dNTP dNDP + dNMP + phosphate
Unincorporated nucleotide (excess)

Step 5:
- When degradation is complete, another nucleotide (e.g. dCTP) is dispensed
- If newly dispensed nucleotide is complementary, steps 1-4 repeat accordingly
- If the nucleotide is not complementary to the template strand, the unmatched
nucleotide will be degraded by apyrase

Video clip:
https://www.youtube.com/watch?v=bNKEhOGvcaI

20
 Biological Sciences Laboratory Course

A large-scale parallel pyrosequencing system is capable of sequencing roughly 400-600

megabases of DNA per 10-hour run

1. Genomic DNA is isolated, fragmented, ligated

to adapters and separated into single strands
2. 1 fragment/bead (yellow) is captured in oil droplet of a PCR-reaction-mixture-in-oil emulsion
3. PCR amplification occurs within each droplet à beads each carrying 10 million copies of a
unique DNA template
4. Beads carrying single-stranded DNA clones are deposited into wells of fibre-optic slide
5. Smaller beads (orange) carrying immobilized enzymes for pyrosequencing are deposited into
each well à subject to pyrosequencing
21
 Biological Sciences Laboratory Course

Explore further if you have interest in Next Generation Sequencing

Illumina (Solexa) sequencing

http://www.illumina.com/technology/sequencing_technology.ilmn

SOLiD
http://www.appliedbiosystems.com/absite/us/en/home/applications-technologies/solid-next-generation-
sequencing.html

Applications of NGS
http://www.genengnews.com/gen-articles/ngs-ready-for-clinical-oncology-testing/5271/
http://www.fda.gov/NewsEvents/Newsroom/PressAnnouncements/ucm375742.htm

22
 Biological Sciences Laboratory Course

Comparison of next-generation sequencing methods

Sequencing by
Pyrosequencing Sequencing by Chain termination
Method ligation (SOLiD
(454) synthesis (Illumina) (Sanger sequencing)
sequencing)

Read length 700 bp 50 to 250 bp 50+35 or 50+50 bp 400 to 900 bp

Accuracy 99.9% 98% 99.9% 99.9%

Reads per run 1 million up to 3 billion 1.2 to 1.4 billion N/A

1 to 10 days,
depending upon
Time per run 24 hours sequencer and 1 to 2 weeks 20 minutes to 3 hours
specified read
length[41]
Cost per 1 million
$10 $0.05 to $0.15 $0.13 $2400
bases (in US$)

Potential for high

sequence yield, Long individual reads.
Advantages Long read size. Fast. depending upon Low cost per base. Useful for many
sequencer model and applications.
desired application.

More expensive and

Runs are expensive. Equipment can be Slower than other
Disadvantages impractical for larger
Homopolymer errors. very expensive. methods.
sequencing projects.
Biological Sciences Laboratory Course

About Practical Session…

24
 Biological Sciences Laboratory Course

Basic Laboratory Safety Rules

n Work in the lab only when the demonstrator is present
n Wear lab coat
n Sandals and shorts are not permitted in the lab
n Food, drink and gum are prohibited in the lab
n Never taste any material in the lab
n Never smell the material in a test tube or flask directly
n Never add water to concentrated acid solutions

n Report all accidents to your demonstrator regardless of how minor they are
e.g. Immediately notify the demonstrator of any chemical spill
n For minor skin burns, immediately plunge the burned area into cold water and
notify the demonstrator.
n If you get any chemical in your eye, immediately wash the eye with the eye-
wash fountain and notify the demonstrator

n Use equipment only as directed

n Read the label on chemical bottles at least twice before using the chemical.
Many chemicals have names that are easily confused
n Strictly follow the instruction from the demonstrator
n Read lab manual before attending the practical session and be familiar with
the experimental procedures 25
 Biological Sciences Laboratory Course

Practical 1 (Part A): DNA sequencing and analysis

You will set up your own cycle sequencing reaction.

DNA template: Double-stranded DNA plasmid (pcDNA vector containing the coding
region of a gene) Unknown DNA insert

Information Provided: Sequence of multiple cloning site of the pcDNA vector

Sequencing primer (forward)
What you have to do:
1. Sequencing the plasmid
2. Blast the sequencing result
3. Determine the identity of the gene in the pcDNA vector 26
 Biological Sciences Laboratory Course

Practical 1 (Part A): DNA sequencing and analysis

Data analysis
Use your favorite browser software to access the BLAST site at the National Center
for Biotechnology Information:
http://www.ncbi.nlm.nih.gov/BLAST

For more information about the gene that you have sequenced
http://www.ncbi.nlm.nih.gov/pubmed

Remember
1. Please download the software (Chromas Lite) to your laptop before attending
practical 1
http://www.softpedia.com/get/Science-CAD/Chromas-Lite.shtml
2. Bring your laptop computer when you attend the practical 1

27
 Biological Sciences Laboratory Course

Practical 1 (Part B): Working with liquid

Measuring and dispensing liquids
(A)Pasteur pipettes
(B)Measuring cylinders and volumetric flasks
(C)Plastic pipettes
(D)Weighting
(E) Pipettors

28
 Biological Sciences Laboratory Course

Important Points
1. Be punctual and bring your lab coat
2. You must seek the approval first for the absence of practical session (including
early leave)
3. You must attend each laboratory session. Failure to attend laboratory session
and/or submit the lab report will result in an automatic zero for that laboratory
performance and lab report. You must provide valid medical certificate if you
can’t attend practical session due to medical reason.
4. You must pass the laboratory portion of the course to pass the class. A failing
grade in the laboratory portion of the course will result in a failing grade no
matter what your average grade is at the end of the course.
5. You cannot attend another laboratory session if you miss yours without the
approval by the module coordinator.
6. There are no extensions to due dates for assignments. Grade deduction will be
made for any late submission without exception.
7. You must hand in the hard copy of lab reports to the demonstrator.

29
 Biological Sciences Laboratory Course

Guidelines for writing lab reports

1. All reports must be typed using a word processor and submitted in hard copy.
2. Lab partners (if any) are encouraged to discuss the lab result, but each student must
write a COMPLETELY INDEPENDENT report.
3. The laboratory report should be precise and concise. The key is completeness and
consistency in format.
4. Lab reports must follow the format outlined below
Title
Summary
Introduction
Materials and Methods
Results and discussions
References

30
 Biological Sciences Laboratory Course

How to write a good lab report:

Title
The title can be a statement, a phase or a sentence that is related to your study.

Summary
The summary (or abstract) is a brief statement describing the problem tackled,
the method used, experimental finding and conclusion. The summary is difficult
to write. Even though it appears first in the report, it is highly recommended that
it is written after you have finished writing the rest of the report.

Introduction
This section should include some background information and a clear statement
of the problem being investigated. Be sure to reference all information that is not
original. Only include information related to your experiment.

31
 Biological Sciences Laboratory Course

Materials and Methods

This section is to describe the experimental procedures in sufficient detail for
someone to replicate your experiment.
Sentences should be written in the third person passive voice. For example,
Incorrect: “We/I centrifuged the bacterial cells for 20 min. at 4°C."
Correct: “The bacterial cells were centrifuged for 20 min. at 4°C."
Define new terms in the text and identify new abbreviations. e.g. "polymerase
chain reaction (PCR) was performed."

To save your time, we won’t request you to write the detailed procedures.
You can write down a sentence such as “Please refer to the lab manual” if there is
no amendment in the experimental procedures or “Please refer to the lab
manual with amendments on step X”. Remember write down the details of the
amended step X in this section.

32
 Biological Sciences Laboratory Course

Results and discussions

Raw data should be processed.
There are two sub-sections of the Results:

Tables and Figures

Use graph and/or table to present quantitative data. Graphs should be drawn
neatly and clearly. The ordinates and abscissas should be labeled. Each graph
must have a legend describing what is illustrated. Each table must have a title at
the top. Each graph and table should be numbered, e.g. Table 1 or Figure 1.

Description of data
This is a paragraph-typed description of the data. Describe the key features and
trends that you perceive in the data presented in the tables and figures
For the discussion, explain what the results mean or why the results occurred.
Point out the assumption that was made and the factor that limited the
interpretation. Explain the possible reasons for the failure of your experimental
studies if needed. Describe future application or significance of your study if
any. You should include a conclusion. Any fact/idea this is not your own must be
acknowledged.

33
Biological Sciences Laboratory Course

References
Sources should not be directly quoted in a lab report.
ALL facts/idea not from your own should be acknowledged in your report.
You must cite the sources of information and ideas that you express in your
own words.
Citations are finally pointed to 'references' listed in lab report.
The format of the reference list can be varied among journals.
You can refer to any scientific journals for the formatting.
The key is consistency in format.

34
 Biological Sciences Laboratory Course

Assessment
60% Continuous assessment (7 lab sessions)
40% Examination (1 hr)

For continuous assessment

5 marks@Lab performance
10 marks@Lab report (2 lab reports plus a worksheet per module)

35