Animal Feed Science and Technology 257 (2019) 114274

Contents lists available at ScienceDirect

Animal Feed Science and Technology

journal homepage: www.elsevier.com/locate/anifeedsci

Fermentation quality and in vitro digestibility of first and second

T
cut alfalfa (Medicago sativa L.) silages harvested at three stages of
maturity
G. Guo1, C. Shen1, Q. Liu, S.L. Zhang, C. Wang, L. Chen, Q.F. Xu, Y.X. Wang,
⁎
W.J. Huo
College of Animal Sciences and Veterinary Medicines, Shanxi Agricultural University, Taigu, Shanxi, China

A R T IC LE I N F O ABS TRA CT

Keywords: To investigate the suitable harvest stage of alfalfa for ensiling, first cut or second cut alfalfa were
Maturity stage harvested at the budding stage (BS), the initial flowering stage (IFS) and the full flowering stage
Cut number (FFS) in 2016 and 2017, and they were then ensiled for 45 days. The nutritional value and
Alfalfa silage fermentation characteristics were assessed; subsequent in vitro gas production, digestibility,
In vitro incubation
ruminal fermentation parameters, and cellulolytic bacteria populations and their activities per
alfalfa silage were also determined. The results showed that the silage dry matter (DM), neutral
detergent fibre (NDF) and acid detergent fibre (ADF) contents increased (P < 0.01), and crude
protein content decreased (P = 0.005) with advancing maturity of the alfalfa. In first cut silage,
the BS had the lowest (P < 0.05) pH and the highest (P < 0.05) asymptotic gas volume, dry
matter digestibility (DMD), neutral detergent fibre digestibility (NDFD) and total volatile fatty
acid (VFA) production in vitro among the three treatments. In second cut silage, the silage pH,
ammonia nitrogen (NH3-N), acetic acid and butyric acid contents decreased (P < 0.05) with
advancing maturity, but the IFS had the highest asymptotic gas volume, DMD and NDFD among
the three treatments; the proportions of Fibrobacter succinogenes, Butyrivibrio fibrisolvens and
Ruminobacter flavefacien and carboxymethyl-cellulase and β-glycosidase activities of in vitro in-
cubation fluid were higher for the IFS compared with those of the BS. In conclusion, based on the
nutritional value, fermentation characteristics and subsequent in vitro rumen digestibility of al-
falfa silage, the best harvest stage of the first cut and second cut alfalfa were at BS and IFS,
respectively. At the same maturity stage, the first cut alfalfa silage was better than the second cut
silage.

1. Introduction

Alfalfa (Medicago sativa L.) is one of major forage for ruminants because of high protein content. Its position in animal husbandry
is becoming increasingly prominent, and it has attracted widespread attention and planting (Zhang et al., 2017). Alfalfa is cut three to
four times a year; its slow water evaporation and high nutrient loss make hay curing difficult, especially when regrowth alfalfa is
harvested in the rainy season during June and July. Therefore, ensiling is currently increasingly popular in China.

⁎
Corresponding author.
E-mail address: [email protected] (W.J. Huo).
1
These authors contributed equally to this work.

https://doi.org/10.1016/j.anifeedsci.2019.114274
Received 15 February 2019; Received in revised form 24 August 2019; Accepted 2 September 2019
0377-8401/ © 2019 Elsevier B.V. All rights reserved.
G. Guo, et al. Animal Feed Science and Technology 257 (2019) 114274

An advantageous management strategy is to improve the quality of forage in cost-effective (Burns et al., 2007). In the past few
years, many experiments were conducted to explore the impact of management strategies on feed nutritional value and animal
performance. In general, with advancing crop maturity, the main characteristics are the increase of dry matter (DM), neutral de-
tergent fibre (NDF), and acid detergent fibre (ADF) contents, and the decrease of crude protein content (Fan et al., 2018; Sikora et al.,
2019) and forage digestibility (Palmonari et al., 2014; Yari et al., 2014). Balde et al. (1993) performed in vivo experiments using four
mature stages of fresh alfalfa and found that effective DM degradability declined with increasing maturity. Yu et al. (2003) reported
that alfalfa hay harvested at the early budding and late budding stages had higher in vitro DM digestibility (DMD) and NDF di-
gestibility (NDFD) than when the alfalfa hay harvested at the early flowering stage. However, all of these studies are based on fresh or
hay, not alfalfa silage.
Silage fermentation is a complex process and affected by material characteristics such as DM, water soluble carbohydrates (WSC),
buffering capacity and epiphytic microflora. Therefore, the composition of alfalfa at harvest has a major impact on the ensiling
process and silage quality. As alfalfa mature, buffering capacity usually decreases, and DM and WSC contents increase, which are
beneficial for silage fermentation. However, the nutritional value of alfalfa silage is reduced due to the increase in NDF and ADF
contents with advancing maturity (Buxton et al., 2003). Little information is available on investigating the suitable maturity stage of
first cut and second cut alfalfa for ensiling. This study was conducted to evaluate the effect of three maturity stages on nutrition value,
fermentation characteristics and subsequent in vitro gas production, methane production, digestibility and ruminal fermentation
parameters of first cut and second cut alfalfa silage, and further to explain the changes of NDFD by analysing ruminal cellulolytic
bacteria and their cellulase activities.

2. Materials and methods

2.1. Silage fermentation test

Alfalfa (Medicago sativa L., variety SR4030) was grown in experimental plots at the Shanxi Agricultural University (37°25′08″ N,
112°35′25″E, elevation 783 m), Shanxi province, China. The fields were fertilized annually with 60 kg/ha N, 42 kg/ha P2O5 and
50 kg/ha K2O. First cut and second cut alfalfa were harvested at three maturity stages (budding stage, BS, initial flowering stage, IFS
and full flowering stage, FFS) for two subsequent years: 2016 and 2017. The harvested fresh matter was chopped to approximately
2 cm in length with a fodder chopper (Type 690, Zhengzhou, China). After mixing, approximately 500 g alfalfa was placed into the
quintuplicate sterile vacuum-packed plastic bag with a release valve, sealed immediately and stored at room temperature for 45 d for
subsequent tests.

2.2. In vitro ruminal fermentation

In vitro ruminal fermentation followed the method described by Menke et al. (1979). Incubation fluid consisted of rumen fluid and
artificial buffer solution at a proportion of 1:2 (v/v). Rumen fluid was obtained from three rumen-cannulated dairy cattle before the
morning feeding. The cattle were fed with TMR that consisted of corn silage (300 g/kg DM), alfalfa hay (50 g/kg DM), alfalfa silage
(100 g/kg DM), corn grain (320 g/kg DM), soybean meal (100 g/kg DM), whole cottonseed (60 g/kg DM), wet brewer grain (50 g/kg
DM), and a supplement with vitamin and minerals (20 g/kg DM). The mixture of the rumen fluid was filtered by four layers of gauze,
mixed with buffer solution, and kept at 39 °C performed in a water bath while continually flushed with CO2. The artificial buffer
solution was prepared by the method of Menke and Steingass (1988) and kept in water bath at 39 °C. Approximately 0.5000 g dry
silage sample was placed into a special nylon bag (the aperture was 38–40 μm) of 35 mm × 60 mm, and then it was placed in
triplicate into calibrated 100 mL glass syringes (Häberle Labortechnik, Germany). Syringes were pre-warmed to 39 °C, and then
50 mL of the incubation fluid was inhaled. A total of 183 syringes (three maturity stage × two cutting × ten experimental replicate
samples × three glass syringes per sample), with three syringes as blanks without substrate, was prepared. The gas production was
recorded at 0, 4, 8, 12, 24 and 48 h incubation, and at each time point gases were collected with gas sampling bags (E-Switch, volume
500 mL, Shanghai ShenYuan Scientific Instrument Co., Ltd., China) for determining methane production. Cumulative gas production
data were fitted to the exponential equation (Ørskov and McDonald, 1979): Y = b (1 − e−ct), where Y is the gas production at time t,
b is the asymptotic gas volume (mL), c is the gas production rate constant, and t is the incubation time (h). After incubation, each
incubation fluid was immediately measured for pH, collected into a 50 mL sterile bottle and stored at −80 °C for the following tests
with ammonia nitrogen (NH3-N), volatile fatty acid (VFA), enzyme activity and microbial quantitative real-time PCR. The nylon bag
was removed, washed with distilled water, dried at 60 °C for 48 h and used to determine the DM and NDF content of the residue. The
DMD and NDFD of silage were calculated with the DM and NDF content before and after 48 h of in vitro incubation.

2.3. Chemical analyses

The DM of fresh material and silage were determined at 65 °C for 48 h. Total nitrogen (TN) content was determined according to
method 978.04 of AOAC (2012), and crude protein (CP) content was calculated by multiplying TN by 6.25. The WSC, aNDF (assayed
with a heat stable α amylase) and ADF contents of each sample was determined according to method of Kim and Adesogan (2006),
and method of VanSoest et al. (1991), respectively. Buffering capacity was determined according to method of Playne and McDonald
(1966). Thirty grams of each silage sample was blended with 60 ml of distilled water for 24 h and filtered through two layers of
cheesecloth. The filtrate was used for determining pH, lactic acid, NH3-N and VFA contents. The pH was measured with a glass

2
G. Guo, et al. Animal Feed Science and Technology 257 (2019) 114274

electrode pH meter (pH FE28, Mettler-Toledo Instruments Co., Ltd. China). Lactic acid and NH3-N contents were determined by
colorimetry, and VFA content was determined by gas chromatography with 30 m × 0.25 mm (df 0.25 μm) capillary column (Thermo
T1300, USA; Guo et al., 2015). The methane content in gas samples was determined by gas chromatography (Thermo T1300, USA,
with a 30 m × 0.30 mm capillary column, df 0.25 μm, and the following conditions: column temperature 100 °C, injection tem-
perature 220 °C, flame ionization detector) as described in Kougias et al. (2014). Enumeration of aerobic bacteria, lactic acid bacteria
(LAB), mould and yeast was performed by the method of Guo et al. (2015), and these data were log10 transformed. The incubation
fluid samples were used to analyse the cellulase activities (carboxymethyl-cellulase, β-glycosidase, xylanase and pectase) as described
by Agarwal et al. (2002).

2.4. Microbial quantitative real-time PCR analysis

Ruminal microbial DNA was extracted from 1 mL of incubation fluid using TIANamp Stool DNA Kit (DP302-02, Tiangen, Beijing,
China). Quantitative real-time PCR was used to determine the relative abundance of Ruminococcus albus, Ruminococcus flavefaciens,
Fibrobacter succinogenes and Butyrivibrio fibrisolvens in the incubation fluid using primers as listed in Table 1 . Real-time PCR was
carried out on an Applied Biosystems stepone plus Fast Real-Time PCR System (Applied Biosystems Co., USA). The reaction mixture
(20 μL) was mixed with SYBR Premix TaqTM (10 μL, TaKaRa Biotechnology Co., Ltd., Dalian, China), dH2O (7.0 μL), PCR Forward or
Reverse Primer (0.2 μmol/L, 0.8 μL), ROX Reference Dye (0.4 μL, 50×) and the template DNA (1 μL). The number of cycles required
to reach a threshold adjusted for each taxon (Ct) was recorded for each sample. The PCR programs included initial denaturation (1
cycle of 50 °C for 2 min and 95 °C for 2 min), primer annealing and product elongation (40 cycles of 95 °C for 15 s and 60 °C for 1 min;
Wang et al., 2016). The relative abundance of each bacteria was expressed as proportion of total bacterial 16SrDNA according to the
formula: relative quantification = 2−(Cyclethreshold[Ct]target−Cttotalbacteria), where Ct was threshold cycle (Pei et al., 2013), and the heat
map was made by GraphPad Prism 7 software.

2.5. Statistical analyses

Data on the fresh material and silage fermentation quality, nutrition value and in vitro ruminal fermentation characteristics were
analysed by two-way ANOVA with maturity stage (BS, IFS and FFS), cut number (first cut and second cut) and their interaction as the
main effects; years were considered replications and were analysed using the GLM procedure of SAS 9.3 (SAS Inst. Inc., Cary, NC).
The means were compared by Duncan’s multiple test, and differences were considered significant when P < 0.05.

3. Results

3.1. Chemical and microbial composition of fresh alfalfa

Chemical composition and microbial population of fresh material are shown in Table 2. The DM, WSC, aNDF and ADF contents
increased (P < 0.05), and CP content decreased (P < 0.05) with advancing maturity of alfalfa. Compared with first cut alfalfa,
second cut alfalfa had lower DM content (P < 0.001), and higher buffering capacity, aNDF and ADF contents (P = 0.001), and
similar CP (P = 0.860) and WSC contents (P = 0.098) at the same harvested stage. Epiphytic aerobic bacteria, lactic acid bacteria,
mould and yeast counts from the alfalfa were in the ranges of 6.5–8, 3–4.5 and 3.2–4.8 lg cfu/g fresh weight (FW), respectively. First
cut alfalfa had lower (P < 0.05) epiphytic microorganism counts compared with second cut alfalfa.

3.2. Chemical composition and fermentation characteristics of alfalfa silage

The silage DM, aNDF and ADF contents increased with advancing maturity (Table 3). At matched maturity stage, first cut silage
had higher DM content (P < 0.05) and lower aNDF and ADF contents (P < 0.05) than second cut silage. The CP content of first cut
silage gradually decreased (P < 0.05) from BS to FFS, but there was no significant difference for second cut silage.

Table 1
PCR primers for real-time PCR assay.
Target species Forward/reverse Sequence of Primer (5′→3′) Product size (bp) References

Ruminobacter albus F CCCTAAAAGCAGTCTTAGTTCG 175bp Koike and Kobayashi (2001)

R CCTCCTTGCGGTTAGAACA
Butyrivibrio fibrisolvens F TAACATGAGAGTTTGATCCTGGCTC 135bp Ma et al. (2016)
R CGTTACTCACCCGTCCGC
Ruminococcus flavefaciens F CGAACGGAGATAATTTGAGTTTACTTAGG 132bp Denman and McSweeney (2006)
R CGGTCTCTGTATGTTATGAGGTATTACC
Fibrobacter succinogenes F GTTCGGAATTACTGGGCGTAAA 121bp
R CGCCTGCCCCTGAACTATC
Total bacteria F CGGTGAATACGTTCYCGG 123bp
R GGWTACCTTGTTACGACTT

3
G. Guo, et al. Animal Feed Science and Technology 257 (2019) 114274

Table 2
Chemical composition and microbial population of first and second cut alfalfa harvested at three stages of maturity.
Itema DM (g/kg FW) (g/kg DM) Buffering capacity (mEq kg/DM) (lg cfu/g FW)

CP aNDF ADF WSC Aerobic bacteria LAB Mould and yeast

First cutb
BS 223b,c 216a 301c 218c 54.1ab 331b 7.22b 3.63c 3.60b
IFS 247a 201b 320c 226b,c 52.5ab 312b,c 6.80c 3.34c 3.32c
FFS 247a 196b 351b 235b 52.4ab 289c 7.21b 4.04b 3.36c
Second cut
BS 185d 218a 346b 236b 41.5b 420a 8.15a 3.90b 4.32a,b
IFS 208cd 202b 369a,b 261b 45.0b 400a 8.10a 4.55a 4.72a
FFS 240a,b 193b 395a 291a 57.4a 411a 7.13b 3.93b 3.23c
SEM 3.25 1.45 4.18 3.06 1.43 11.3 0.10 0.03 0.04
P value c
MS 0.001 0.021 0.008 0.007 0.041 0.072 0.036 0.060 0.011
CN < 0.001 0.860 0.001 0.001 0.098 0.001 0.001 0.001 0.008
MS × CN 0.110 0.291 0.767 0.154 0.132 0.331 0.003 0.001 0.211

Within each row, lower case superscripts (a–d) indicate significant differences at P < 0.05; SEM, standard error of the mean.
a
aNDF, neutral detergent fiber; ADF, acid detergent fiber; CP, crude protein; DM, dry matter; FW, fresh weight; WSC, water soluble carbohy-
drates.
b
BS, budding stage; IFS, initial flowering stage; FFS, full flowering stage.
c
MS, maturity stage; CN, cut number; MS × CN, interaction between maturity stage and cut number.

Table 3
Chemical composition of first and second cut alfalfa silages harvested at three stages of maturity.
Itema DM (g/kg FW) (g/kg DM)

CP aNDF ADF

b
First cut
BS 214b 204a 322d 228c
IFS 237a 189a,b 368c 259b,c
FFS 243a 177b 393b 274b
Second cut
BS 165c 177b 382b,c 284b
IFS 196b 185a,b 398a,b 285b
FFS 226a,b 178b 416a 309a
SEM 3.11 1.50 3.53 3.19
P value c
MS < 0.001 0.015 0.002 0.002
CN < 0.001 0.027 0.003 0.004
MS × CN 0.003 0.034 0.002 0.004

Within each row, lower case superscripts (a–c) indicate significant differences at P < 0.05; SEM, standard error of the mean.
a
aNDF, neutral detergent fiber; ADF, acid detergent fiber; CP, crude protein; DM, dry matter; FW, fresh weight; LAB, lactic acid bacteria.
b
BS, budding stage; IFS, initial flowering stage; FFS, full flowering stage.
c
MS, maturity stage; CN, cut number; MS × CN, interaction between maturity stage and cut number.

Fermentation characteristics of alfalfa silages are presented in Table 4. Whatever the harvested stage, the contents of lactic acid,
NH3-N and total VFA, and LAB count in first cut silage were similar, except for silage pH. In second cut silage, the pH, NH3-N, acetic
acid, propionic acid, butyric acid and total VFA contents decreased (P < 0.05), and the ratio of lactic acid to acetic acid increased
with advancing maturity. There were minor differences in the lactic acid content and LAB count among all silages. The cut number
significantly influenced the silage pH (P = 0.002), NH3-N (P < 0.001), acetic acid (P < 0.001), propionic acid (P = 0.03), butyric
acid (P = 0.001), total VFA contents (P < 0.001), and the ratio of lactic acid to acetic acid (P = 0.007).

3.3. In vitroincubation of alfalfa silage

The NH3-N concentration of incubation fluid was not different among all silages (Table 5). In first cut silage, the total VFA,
acetate, propionate and valerate concentrations of incubation fluid increased (P < 0.05) from BS to FFS. In second cut silage, IFS had
higher individual and total VFA concentrations (P < 0.05) than those of BS, but it was similar to that of FFS. The cut number
significantly influenced the total VFA (P < 0.001), acetate (P < 0.001), propionate (P = 0.001), butyrate (P = 0.024), isobutyrate
(P = 0.023) and valerate (P = 0.001) concentrations of incubation fluid.
As shown in Table 6, the maturity stage and cut number significantly influenced asymptotic gas volume (P < 0.01), methane
production (P < 0.05), DMD (P < 0.001) and NDFD (P < 0.01). In first cut silage, the asymptotic gas volume, DMD and NDFD

4
G. Guo, et al. Animal Feed Science and Technology 257 (2019) 114274

Table 4
Fermentation characteristics of first and second cut alfalfa silages harvested at three stages of maturity.
Itema pH NH3-N (g/kg TN) (g/kg DM) Lactic acid: acetic acid LAB (cfu/g FW)

Lactic acid Acetic acid Propionic acid Butyric acid Total VFA

First cutb
BS 5.06d 45.4d 34.5 15.4b,c 0.545b,c 0.160c 16.1c 2.28a,b 7.86
IFS 5.30b,c 62.3d 26.2 14.6c 0.541b,c 0.813bc 15.9c 1.95a,b 7.14
FFS 5.15c 56.6d 31.6 15.4b,c 0.623b 0.584c 16.6c 2.94a 7.84
Second cut
BS 5.74a 256a 20.0 39.6a 3.422a 9.187a 52.2a 0.59c 7.19
IFS 5.49ab 183b 29.9 33.8a,b 0.891b 1.674b 36.4a,b 1.04b,c 8.28
FFS 5.00d 112c 38.6 21.5b 0.391c 0.412c 22.3b 1.97a,b 8.48
SEM 0.056 14.8 2.30 1.95 0.171 0.457 2.72 0.23 0.133
P value c
MS 0.004 0.005 0.304 0.029 0.021 0.001 0.003 0.089 0.070
CN 0.002 < 0.001 0.787 < 0.001 0.030 0.001 < 0.001 0.007 0.107
MS × CN 0.001 0.001 0.126 0.038 0.016 < 0.001 0.003 0.696 0.106

Within each row, lower case superscripts (a–d) indicate significant differences at P < 0.05; SEM, standard error of the mean.
a
DM, dry matter; FW, fresh weight; LAB, lactic acid bacteria; NH3-N, ammonia nitrogen; TN, total nitrogen; VFA, volatile fatty acid.
b
BS, budding stage; IFS: initial flowering stage; FFS: full flowering stage.
c
MS, maturity stage; CN, cut number; MS × CN, interaction between maturity stage and cut number.

Table 5
Fermentation parameters after 48 h in vitro incubation of first and second cut alfalfa silages harvested at three stages of maturity.
Itema NH3-N (mg/100 mL) (mmol/L) Acetate: propionate

Total VFA Acetate Propionate Isobutyrate Butyrate Isovalerate Valerate

b
First cut
BS 38.4 69.6a 44.6a 13.3a 1.24ab 6.50ab 2.44ab 1.53a 3.35c
IFS 36.4 66.1ab 41.9ab 12.1ab 1.28a 6.74a 2.59a 1.49ab 3.45c
FFS 35.8 61.8bc 39.1b 11.5b 1.20b 6.20b 2.37b 1.45b 3.41c
Second cut
BS 35.3 57.8c 37.5c 9.8c 1.11c 5.99c 2.22b 1.19c 3.82a
IFS 37.6 63.2b 40.3ab 11.0b 1.28a 6.40ab 2.66a 1.53a 3.67b
FFS 37.6 60.0bc 38.6b 10.3bc 1.16bc 6.16bc 2.35ab 1.41b 3.74ab
SEM 0.42 1.02 0.60 0.38 0.14 0.01 0.06 0.03 0.03
P value c
MS 0.334 0.018 0.038 0.044 0.011 0.010 0.001 0.006 0.117
CN 0.632 < 0.001 < 0.001 0.001 0.023 0.024 0.359 0.001 0.001
MS × CN 0.662 < 0.001 < 0.001 0.003 0.092 0.352 0.127 0.001 0.295

Within each row, lower case superscripts (a–c) indicate significant differences at P < 0.05; SEM, standard error of the mean.
a
NH3-N, ammonia nitrogen; VFA, volatile fatty acid.
b
BS, budding stage; IFS, initial flowering stage; FFS, full flowering stage.
c
MS, maturity stage; CN, cut number; MS × CN, interaction between maturity stage and cut number.

decreased (P < 0.05) from BS to FFS. In second cut silage, IFS had the highest asymptotic gas volume, DMD and NDFD among the
three treatments. The rate of gas production did not show a significant difference among all silages.
In first cut silage, the activities of carboxymethyl-cellulase, xylanase and β-glycosidase (Table 7), and the relative proportions of
Butyrivibrio fibrisolvens and Fibrobacter succinogenes were similar (Fig. 1), but FFS had the lowest pectase activity and Ruminococcus
flavefaciens proportion (P < 0.05), and the highest Ruminobacter albus proportion (P < 0.05) among the three treatments. In second
cut silage, the carboxymethyl-cellulase activity and the relative proportions of B. fibrisolvens, R. flavefaciens and F. succinogenes were
lower (P < 0.05) for BS compared with those of IFS. The ruminal cellulolytic bacteria proportions and cellulase activities did not
show difference between IFS and FFS.

4. Discussion

4.1. Effects of maturity stage and cut number on nutritional value and fermentation characteristics of alfalfa silage

Forage maturity has a greater impact on fermentation quality and nutritional value of silage. Present study shown that the DM,
NDF and ADF contents increased with advancing maturity for both first cut and second cut alfalfa silage, which is consistent with
Sikora et al. (2019). This is due to the moisture and leaf to stem ratio decreases and cell wall content in stem increases with advancing
maturity of alfalfa (Yari et al., 2012). In addition, alfalfa leaves have a higher protein than its stems (Stefanon et al., 1996). According

5
G. Guo, et al. Animal Feed Science and Technology 257 (2019) 114274

Table 6
Gas production parameters, methane production, dry matter digestibility (DMD) and neutral detergent fibre digestibility (NDFD) after 48 h in vitro
incubation of first and second cut alfalfa silages harvested at three stages of maturity.
Item (mL/g) Rate of gas production (10−3/h) (g/kg DM)

b
Potential gas production 48 h methane production DMD NDFD

a
First cut
BS 151a 33.2a 66.9 594a 427a
IFS 136b 32.8a 66.2 559b 416a,b
FFS 127b,c 32.4a 65.4 545b,c 402b
Second cut
BS 126c 32.2a 57.4 543b,c 396c
IFS 129b,c 31.8a,b 63.1 556b 402b
FFS 110d 30.5b 58.5 538c 399b,c
SEM 1.82 1.24 0.45 1.24 1.67
P value c
MS 0.004 0.015 0.182 < 0.001 0.003
CN 0.006 0.009 0.065 < 0.001 0.001
MS × CN 0.254 0.867 0.899 0.004 0.001

Within each row, lower case superscripts (a–d) indicate significant differences at P < 0.05; SEM, standard error of the mean.
a
BS, Budding stage; FFS, Full flowering stage; IFS, Initial flowering stage.
b
Cumulative gas production data were fitted to the exponential equation: Y = b (1 − e−ct), where Y is the gas production at time t, b is the
asymptotic gas volume (ml), c is the gas production rate constant, t is the incubation time (h).
c
MS, Maturity stage; CN, cut number; MS × CN, interaction between maturity stage and cut number.

Table 7
Cellulase activity of incubation fluid after 48 h in vitro incubation of first and second cut alfalfa silages harvested at three stages of maturity.
Item (μmol/min/L)

Carboxymethyl-cellulase Xylanase β-glycosidase Pectase

First cuta
BS 11.6ab 20.3 43.5ab 38.1c
IFS 11.3ab 20.0 43.6ab 38.2c
FFS 10.4b 21.4 41.1b 39.2b
Second cut
BS 10.8b 20.5 43.7ab 39.2b
IFS 12.3a 21.6 47.4a 40.3ab
FFS 12.3a 20.4 46.2a 41.2a
SEM 0.10 1.91 0.37 0.28
P value b
MS 0.022 0.379 0.086 0.022
CN 0.017 0.382 0.001 0.020
MS × CN 0.748 0.323 0.001 0.976

Within each row, lower case superscripts (a–c) indicate significant differences at P < 0.05; SEM, standard error of the mean.
a
BS, budding stage; IFS, initial flowering stage; FFS, full flowering stage.
b
MS, maturity stage; CN, cut number; MS × CN, interaction between maturity stage and cut number.

to this theory, the CP content of fresh alfalfa or its silage should decreases with advancing maturity. However, in second cut silage, BS
had higher CP content in fresh material, but slightly lower CP content in silage compared with those of IFS. Muck (1987) reported
that the proteolysis rates in alfalfa silage have a negative linear correlation with its initial DM content. Therefore, the highest
proteolysis and CP loss were found in second cut BS silage due to its lowest initial DM content (185 g/kg FW) and poor fermentation
quality with high pH (5.74) and NH3-N (256 g/kg TN) and butyric acid (9.2 g/kg DM) contents. According to the report of Guo et al.
(2015), the concentrations of NH3-N and butyric acid in good fermentation silage were less than 100 g/kg TN and 2.0 g/kg DM,
respectively. When the initial DM content of fresh material is below 200 g/kg FW, clostridia will rapid growth and produce large
amount of butyric acid and NH3-N, and resulting in high DM losses and protein proteolysis (McDonald et al., 1991).
In first cut silage, the three treatments had good fermentation quality with similar contents of lactic acid, acetic acid, butyric acid
and NH3-N, which is consistent with the result of Sikora et al. (2019). In second cut silage, the fermentation quality gradually
improved with advancing maturity, although IFS and FFS also had extensive proteolysis with the amounts of released NH3-N
(> 100 g/kg TN). It is generally known that silage fermentation is a complex process affected by many factors, such as DM, WSC
contents, epiphytic microorganism counts and buffering capacity of silage raw materials (Buxton et al., 2003). Suitable DM content,
sufficient WSC content and LAB counts, low buffer capacity and harmful bacteria counts are precursors for successful silage fer-
mentation (Pitt et al., 1991; Cai, 1999; Zhang et al., 2010). Compared with first cut alfalfa, second cut alfalfa harvested from BS to the
IFS had higher buffering capacity, epiphytic aerobic bacteria and harmful microorganism counts and lower DM and WSC contents.

6
G. Guo, et al. Animal Feed Science and Technology 257 (2019) 114274

Fig. 1. Relative proportion of ruminal microbes after 48 h in vitro incubation of first and second cut alfalfa silages harvested at three stages of
maturity. First cut-BS, first cut alfalfa silages harvested at budding stage; First cut−IFS, first cut alfalfa silages harvested at initial flowering stage;
First cut− FFS, first cut alfalfa silages harvested at full flowering stage; Second cut−BS, second cut alfalfa silages harvested at budding stage;
Second cut−IFS, second cut alfalfa silages harvested at initial flowering stage; Second cut−FFS, second cut alfalfa silages harvested at full flowering
stage. Within each row, lower case superscripts (a–c) indicate significant differences at P < 0.05.

Although second cut alfalfa harvested at FFS had similar DM, WSC contents and harmful microorganism counts compared with first
cut alfalfa harvested at the same stage, its higher buffering capacity could lead to a slow decline of silage pH and more protein
hydrolysis during initial fermentation (Buxton et al., 2003). In general, the first cut alfalfa silage showed higher fermentation quality
compared with the second cut alfalfa silage at the same harvest stage, which could be attributed to the first cut alfalfa experiencing a
longer vegetative growth period and accumulating more nutrients (McDonald et al., 1991).
In addition, present study shown an interesting result, the contents of acetic acid, propionic acid, butyric acid and total VFA
decreased and the ratio of lactic acid to acetic acid increased from BS to FFS in second cut alfalfa silage. This is also related to the
moisture content of alfalfa at harvest. As alfalfa matures, its moisture content decrease, which promotes lactic acid fermentation
resulting in decrease in the activity of enterobacteria, propionibacteria and clostridia, and reduce acetic acid, propionic acid and
butyric acid production (Muck, 1987; Buxton et al., 2003).

4.2. Effects of maturity stage and cut number on in vitrofermentation characteristics, digestibility, the ruminal cellulolytic bacteria populations
and their cellulase activity of alfalfa silage

In vitro gas production techniques have been widely used to estimate DMD of forage in the rumen (Menke et al., 1988). It was
observed that the asymptotic gas volume was positively related to DMD and total VFA production after 48 h incubation of alfalfa
silage, which was consistent with the results reported by Muck et al. (2007) and Blümmel et al. (1997). In the current study,
asymptotic gas volume, DMD and total VFA production of silage were lower at later maturity, which was attributed to the decrease in
nutritional value, especially the increase of fibre content (McDonald et al., 2011; Abbasi et al., 2012; Zhang et al., 2015). However,
second cut alfalfa silage harvested at BS did not conform to this rule, which was related to the deterioration of silage. Silage NDFD
had a similar change with DMD. With advancing maturity, the digestibility of silage decreases with the increases of fibre proportion,
especially ADF (Buxton et al., 2003). In addition, asymptotic gas volume, DMD and NDFD were lower for second cut alfalfa silage
compared with first cut alfalfa harvested at the same stage due to the higher NDF and ADF contents, and the lower fermentation
quality; then, no more reserved nutrition was provided for extensive rumen fermentation. There were minor differences in the rate of
gas production among all silages in this study. Wilman et al. (1996) suggested that the in vitro rate of gas production decrease with
advancing maturity of forage. However, Buxton et al. (2003) indicated that the range in in vitro gas production rate of alfalfa hay from
BS to IFS was narrow. Therefore, the difference in nutritional value of alfalfa silages did not significant influence the rate of gas
production in this study.
Johnson and Johnson (1995) reported that greater methane production resulted from the more extensive fermentation of fibre
carbohydrates, which are related to the formation of hydrogen. The decreasing of 48−h methane production with advancing ma-
turity of alfalfa was related to their lower NDFD. However, second cut alfalfa silage harvested at BS was an exception, it having the
lowest NDFD but highest methane production among the three maturity stages of second cut alfalfa silage. This might be related to
the ratio of acetic acid to propionic acid. In the process of methane formation, hydrogen is an important precursor that is accom-
panied by acetate production (Cao et al., 2010; Navarro-Villa et al., 2013). Meanwhile, hydrogen can be used to produce propionic
acid by intermediates (such as malic acid and fumaric acid) of the succinic acid cycle. Therefore, this pathway influences the methane
formation by competing for hydrogen (Hobson and Stewart, 1997). The ratios of acetate to propionate in the incubation fluid were
3.83, 3.66 and 3.75 for second cut silage harvested at three consecutive stages, respectively. In addition, maturity stage and cut
number did not significantly influence the pH and NH3-N concentration of incubation fluid in this study.
Some researchers report that there was a positive correlation between the ruminal cellulolytic bacteria populations and their
cellulase activity (Agarwal et al., 2002; Wang et al., 2016). F. succinogenes, B. fibrisolvens, R. albus and R. flavefaciens were

7
G. Guo, et al. Animal Feed Science and Technology 257 (2019) 114274

predominant cellulolytic bacteria in the rumen (Hobson and Stewart, 1997). Present study shown that the proportion of R. flavefacien
and F. succinogenes, and carboxymethyl-cellulaseand β-glycosidase activities tended to decline with advancing maturity of alfalfa,
except for second cut silage harvested at BS. F. succinogenes had a strong ability to degrade the structure of tough cellulose by
carboxymethyl-cellulase and β-glycosidase (Miron et al., 2001; Wanapat et al., 2014); similar changes were found in the NDFD of
silage. R. flavefaciens and R. albus can produce a large amount of xylanase, but they inhibit each other (Hobson and Stewart, 1997).
Whenever it is harvest stage, there was no significant difference in xylanase activity, although the proportion of the two strains was
different. Pectin is an important component and interweaves with non-starch polysaccharides such as cellulose and hemicellulose to
form plant cell walls, pectin content increases with plant maturity (McDonald et al., 2011). The increased pectase activity might be
related to the increased pectin content with advancing maturity of alfalfa.
In the present study, the lower NDFD but higher cellulose activity with second cut than the first cut silage may be explained by the
high fibre content, which may stimulate cellulose activity. On the other hand, with the increase of ADF content, the binding of lignin
to cellulose becomes tighter, and thus reduce microbial colonization on fibre particles, which is critical step for fibre digestion
(Jounamy, 1991).

5. Conclusion

From the perspective of nutritional value, fermentation characteristics and subsequent in vitro rumen digestibility of alfalfa silage,
first cut alfalfa harvested at BS and second cut alfalfa harvested at IFS were more suitable for ensiling. At the same maturity stage,
first cut alfalfa silage had a better quality than second cut silage. The populations of ruminal cellulolytic bacteria and cellulase
activities were not found to be completely consistent with the NDFD of alfalfa silage harvested at different cutting, and their re-
lationship needs to be further studied.

Declaration of Competing Interest

No conflict of interest exits in the submission of this manuscript, and manuscript is approved by all authors for publication. All the
authors listed have approved the manuscript that is submitted. I would like to solemnly affirm that the material included here with in
this manuscript has never been published before, and furthermore ensured that none of the contents are currently under con-
sideration elsewhere.

Acknowledgments

This work was supported by National Natural Science Foundation of China (31502015), Scientific and Technologial Innovation
Programs of Higher Education Institutions in Shanxi (2019L0356) and Graduate Student Education Innovation project of Shanxi
Province (2019SY221).

References

Abbasi, D., Rouzbehan, Y., Rezaei, J., 2012. Effect of harvest date and nitrogen fertilization rate on the nutritive value of amaranth forage (Amaranthus hypochon-
driacus). Anim. Feed Sci. Tech. 171, 6–13.
Agarwal, N., Kamra, D.N., Chaudhary, L.C., Agarwal, I., Sahoo, A., Pathak, N.N., 2002. Microbial status and rumen enzyme profile of crossbred calves fed on different
microbial feed additives. Lett. Appl. Microbiol. 34, 329–336.
AOAC, 2012. Official Methods of Analysis, 19th ed. Association of Official Analytical Chemistry International, Gaithersburg, MD.
Balde, A.T., Vandersall, J.H., Erdman, R.A., Reeves, J.B., Glenn, B.P., 1993. Effect of stage of maturity of alfalfa and orchardgrass on in situ dry matter and crude
protein degradability and amino acid composition. Anim. Feed Sci. Technol. 44, 29–43.
Blümmel, M., Makkar, H.P.S., Becker, K., 1997. In vitro gas production: a technique revisited. J. Anim. Physiol. Anim. Nutr. 77, 24–34.
Burns, J.C., Fisher, D.S., Mayland, H.F., 2007. Diurnal shifts in nutritive value of alfalfa harvested as hay and evaluated by animal intake and digestion. Crop Sci. 47,
2190–2197.
Buxton, D.R., Muck, R.E., Harrison, J.H., 2003. Silage Science and Technology. ASAS, CSSA, SSSA Inc., Madison, WI.
Cai, Y.M., 1999. Identification and characterization of Enterococcus species isolated from forage crops and their influence on silage fermentation. J. Dairy Sci. 82,
2466–2471.
Cao, Y., Takahashia, T., Horiguchia, K., Yoshidaa, N., Cai, Y.M., 2010. Methane emissions from sheep fed fermented or non-fermented total mixed ration containing
whole-crop rice and rice bran. Anim. Feed Sci. Tech. 157, 72–78.
Denman, S.E., Mc Sweeney, C.S., 2006. Development of a real-time PCR assay for monitoring anaerobic fungal and cellulolytic bacterial populations within the rumen.
FEMS Microbiol. Ecol. 58, 572–582.
Fan, W.Q., Ge, G.T., Liu, Y.H., Wang, W., Liu, L.Y., Jia, Y.S., 2018. Proteomics integrated with metabolomics: analysis of the internal causes of nutrient changes in
alfalfa at different growth stages. BMC Plant Biol. 18, 78.
Guo, G., Yuan, X.J., Wen, A.Y., Liu, Q., Zhang, S.L., Shao, T., 2015. Silage fermentation characteristics of Napiergrass (Pennisetum purpureum Sch.) harvested at various
times on sunny day. Crop Sci. 55, 458–464.
Hobson, P.N., Stewart, C.S., 1997. The Rumen Microbial Ecosystem, 2nd ed. Chapman and Hall, London.
Johnson, K.A., Johnson, D.E., 1995. Methane emissions from cattle. J. Anim. Sci. 73, 2483–2492.
Jounamy, J.P., 1991. Rumen Microbial Metabolism and Ruminal Digestion. INRA Publications, Paris.
Kim, S.C., Adesogan, A.T., 2006. Influence of ensiling temperature, simulated rainfall, and delayed sealing on fermentation characteristics and aerobic stability of corn
silage. J. Dairy Sci. 89, 3122–3132.
Koike, S., Kobayashi, Y., 2001. Development and use of competitive PCR assays for the rumen cellulolytic bacteria: fibrobacter succinogenes, Ruminococcus albus and
Ruminococcus favefaciens. FEMS Microbiol. Lett. 204, 361–366.
Kougias, P.G., Boe, K., Tsapekos, P., Angelidaki, I., 2014. Foam suppression in overloaded manure-based biogas reactors using antifoaming agents. Bioresour. Technol.
153, 198–205.
Ma, T., Chen, D.D., Tu, Y., Zhang, N.F., Si, B.W., Deng, K.D., Diao, Q.Y., 2016. Effect of supplementation of allicin on methanogenesis and ruminal microbial flora in

8
G. Guo, et al. Animal Feed Science and Technology 257 (2019) 114274

Dorper crossbred ewes. J. Anim. Sci. Biotechnol. 7 (1).

McDonald, P., Edward, R.A., Greenhalgh, J.F.D., Morgan, C.A., Sinclair, L.A., Wilkinson, R.G., 2011. Animal Nutrition, 7th ed. Pearson Publications, Harlow, pp.
481–520.
McDonald, P., Henderson, A.R., Heron, S.J., 1991. The Biochemistry of Silage, 2nd ed. Cambrian Publications, Aberystwyth, pp. 19–151.
Menke, K.H., Raab, L., Salewski, A., Steingass, H., Fritz, D., Schneider, W., 1979. The estimation of the digestibility and metabolizable energy content of ruminant
feedingstuffs from the gas production when they are incubated with rumen liquor in vitro. J. Agric. Sci. 93, 217–222.
Menke, K.H., Steingass, H., 1988. Estimation of the energetic feed value obtained from chemical analysis and in vitro gas production using rumen fluid. Anim. Res. Dev.
28, 7–55.
Miron, J., Ben-Ghedalia, D., Morrison, M., 2001. Invited review: adhesion mechanisms of rumen cellulolytic bacteria. J. Dairy Sci. 84, 1294–1309.
Muck, R.E., 1987. Dry matter level effects on alfalfa silage quality. I. Nitrogen transformation. Trans. Asae 30, 7–14.
Muck, R.E., Filya, I., Contreras-Govea, F.E., 2007. Inoculant effects on alfalfa silage: in vitro gas and volatile fatty acid production. J. Dairy Sci. 90, 5115–5125.
Navarro-Villa, A., O’Brien, M., Lo´pez, S., Boland, T.M., O’Kiely, P., 2013. In vitro rumen methane output of grasses and grass silages differing in fermentation
characteristics using the gas-production technique (GPT). Grass Forage Sci.68 228–244.
Ørskov, E.R., Mcdonald, I., 1979. The estimation of protein degradability in the rumen from incubation measurements weighted according to rate of passage. J. Agric.
Sci. 92, 499–503.
Palmonari, A., Fustini, M., Canestrari, G., Grilli, E., Formigoni, A., 2014. Influence of maturity on alfalfa hay nutritional fractions and indigestible fiber content. J.
Dairy Sci. 97, 7729–7734.
Pei, C.X., Liu, Q., Dong, C.S., Li, H.Q., Jiang, J.B., Gao, W.J., 2013. Microbial community in the forestomachs of alpacas (Lamapacos) and sheep (Ovis aries). J. Integr.
Agric. 12, 314–318.
Pitt, R.E., Muck, R.E., Pickering, N.B., 1991. A model of aerobic fungal growth in silage. 2. Aerobicstability. Grass Forage Sci. 46, 301–312.
Playne, M.J., McDonald, P., 1966. The buffering constituents of herbage and silage. J. Sci. Food Agric. 17, 264–266.
Sikora, M.C., Hatfield, R.D., Kalscheur, K.F., 2019. Fermentation and chemical composition of high-moisture lucerne leaf and stem silages harvested at different stages
of development using a leaf stripper. Grass Forage Sci. 74, 254–263.
Stefanon, B., Pell, A.N., Schofield, P., 1996. Effect of maturity on digestion kinetics of water-soluble and water-insoluble fractions of alfalfa and brome hay. J. Anim.
Sci. 74, 1104–1115.
VanSoest, P.J., Robertson, J.B., Lewis, B.A., 1991. Methods for dietary fiber, neutral detergent fiber, and nonstarch polysaccharides in relation to animal nutrition. J.
Dairy Sci. 74, 3583–3597.
Wanapat, M., Gunun, P., Anantasook, N., Kang, S., 2014. Changes of rumen pH, fermentation and microbial population as influenced by different ratios of roughage
(rice straw) to concentrate in dairy steers. J. Agric. Sci. 152, 675–685.
Wang, C., Liu, Q., Guo, G., Huo, W.J., Ma, L., Zhang, Y.L., Pei, C.X., Zhang, S.L., Wang, H., 2016. Effects of rumen-protected folic acid on ruminal fermentation,
microbial enzyme activity, cellulolytic bacteria and urinary excretion of purine derivatives in growing beef steers. Anim. Feed Sci. Technol. 221, 185–194.
Wilman, D., Foulkes, G.R., Givens, D.I., 1996. The rate and extent of cell-wall degradation in vitro for 40 silages varying in composition and digestibility. Anim. Feed
Sci. Technol. 63, 111–122.
Yari, M., Valizadeha, R., Naseriana, A.A., Ghorbanib, G.R., Rezvani Moghaddamc, P., Jonkerd, A., Yue, P., 2012. Botanical traits, protein and carbohydrate fractions,
ruminal degradability and energy contents of alfalfa hay harvested at three stages of maturity and in the afternoon and morning. Anim. Feed Sci. Technol. 172,
162–170.
Yari, M., Valizadeh, R., Naserian, A.A., Jonker, A., Azarfar, A., Yu, P., 2014. Effects of including alfalfa hay cut in the afternoon or morning at three stages of maturity
in high concentrate rations on dairy cows performance, diet digestibility and feeding behavior. Anim. Feed Sci. Technol. 192, 62–72.
Yu, P., Christensen, D.A., McKinnon, J.J., Markert, J.D., 2003. Effect of variety and maturity stage on chemical composition, carbohydrate and protein subfractions, in
vitro rumen degradability and energy values of timothy and alfalfa. Can. J. Anim. Sci. 83, 279–290.
Zhang, J.G., Kawamoto, H., Cai, Y.M., 2010. Relationships between the addition rates of ellulose or glucose and silage fermentation at different temperatures. Anim.
Sci. J. 81, 325–330.
Zhang, Q., Yu, Z., Yang, H., Na, R.S., 2015. The effects of stage of growth and additives with or without cellulase on fermentation and in vitro degradation char-
acteristics of Leymus chinensis silage. Grass Forage Sci. 71, 595–606.
Zhang, Q., Yu, Z., Wang, X.G., Na, R.S., 2017. Effects of chlorpyrifos and chlorantraniliprole on fermentation quality of alfalfa (Medicago sativa L.) silage inoculated
with or without Lactobacillus plantarum LP. Anim. Sci. J. 88, 456–462.