TUTORPOD

presents

CET/NEET
Crash Course
2025
 TUTORPOD LEARNING LLP
BRIDGE cOURsE AND PU | KcET|IIT-JEE|NEET

Dr. Arvind Gambheer

Founder and CEO
Dr. Gambheer is one of the leading authorities in India on Entrance Exams
ranging from CET to IIT-JEE. With an experience of over 30+ years he has won many
national and international accolades.

A very passionate teacher himself, he has trained millions of students across

the globe and guided thousands of teachers. An architect in creating cutting edge
study material that has helped students ace their exams.

I PU CHEMISTRY MATERIAL
S.NO CHAPTER NAME PG.NO
1 Some Basic Concepts of Chemistry 1-2
2 Structure of Atom 3-4
3 Classification of Elements and Periodicity in Properties 5-6
4 Chemical Bonding 7-8
5 Thermodynamics and Thermochemistry 9-10
6 Equilibrium 11-12
7 Redox Reactions 13-15
8 Organic Chemistry - Some Principles and Techniques 16-18
9 Organic compounds Containing Nitrogen 19-21
 Chapter - 1
Some Basic Concepts of Chemistry

1. Two students X and Y report the mass of the same substance as 7.0 g and 7.00 g respectively. Which of
the following statement is correct?
(A) Both are equally accurate (B) X is more accurate than Y
(C) Y is more accurate than X (D) Both are inaccurate scientifically
2. The number of significant figures in  are
(A) One (B) Two (C) Three (D) Infinite
3. A measured temperature on Fahrenheit scale is 200F. What will this reading be on Celsius scale
(A) 40 C (B) 94 C (C) 93 C (D) 30 C
4. The result of which of the following has least significant figures?
0.02856  298.15  0.112
(A) (B) 5  5.364
0.5785
(C) 0.0125 + 0.7864 + 0.0215 (D) All have same number of significant figures
5. Hydrogen and oxygen combine to form H2O2 and H2O containing 5.93% and 11.2% hydrogen
respectively. The data illustrates
(A) Law of conservation of mass (B) Law of constant proportions
(C) Law of reciprocal proportions (D) Law of multiple proportions
6. Total number of electrons in 1 mole of CO2is (in terms of N0)
(A) 3 N0 (B) 10 N0 (C) 16 N0 (D) 22 N0
7. Which of the following represents/represent 32 g of the substance?
(A) one mole of oxygen atoms (B) one mole of Nitrogen gas at STP
(C) 224 L of O2 gas at STP (D) one mole of Sulphur molecules
8. Which one of the following groupings represents a collection of isoelectronic species? (At. nos. Cs : 55,
Br : 35)
(A) N3−, F−, Na+ (B) Be, Al3+, Cl− (C) Ca2+, Cs+, Br (D) Na+, Ca2+, Mg2+
9. Total number of electrons in 1.4 g dinitrogen gas is
(A) 4.2  1023 (B) 6.02  1023 (C) 3.01  1023 (D) 8. 4  1024
10. Of the following sets which one does NOT contain isoelectronic species?
(A) PO −43 ,SO −42 ,ClO −4 (B) CN − , N 2 ,C 2−2 (C) SO3−2 ,CO3−2 , NO3− (D) BO3−3 ,CO3−2 , NO3−

11. 4.48 litre of methane at S.T.P. corresponds to

(A) 1.2  1022 molecules of methane (B) 0.5 mole of methane
(C) 3.2 g of methane (D) 0.1 mole of methane
12. The reaction between yttrium metal Y and dilute hydrochloric acid produce H2 (g) and Y3+ ions. The
molar ratio of yttrium used to hydrogen produced is

1 | | Dr. Arvind Gambheer and Team Bridge course and PU | KCET|IIT-JEE|NEET

 (A) 1 : 2 (B) 1 : 3 (C) 2 : 1 (D) 2 : 3
13. The equivalent weight of K2Cr2O7 in acidic medium is expressed in terms of its molecular weight (M) as
(A) M/3 (B) M/4 (C) M/6 (D) M/7
14. The percentage of nitrogen in urea is
(A) 59 (B) 54 (C) 46 (D) 25
15. A compound made of two elements A and B are found to contain 25% A (at. mass 12.5) and 75% B (at.
mass 37.5). The simplest formula of the compound is
(A) AB (B) AB2 (C) AB3 (D) A3 B
16. 60 g of a compound on analysis gave 24 g C, 4 g H and 32 g O. The empirical formula of the compound
is
(A) C2H4O2 (B) C2H2O2 (C) CH2O2 (D) CH2O
17. A compound having empirical formula ( C3 H 4 O ) n has vapour density 84. The molecular formula of this

compound is
(A) C3H4 (B) C6H8O2 (C) C6H8O2 (D) C9H12O3
18. What will be the molarity of a solution, which contains 5.85 g of NaCl(s) per 500mL?
(A) 4 mol L−1 (B) 20 mol L−1 (C) 0.2 mol L−1 (D) 2 mol L−1
19. The volume of water to be added to 100 cm3 of 0.5 NH2SO4 to get decinormal concentration is
(A) 400 cm3 (B) 500 cm3 (C) 450 cm3 (D) 100 mc3
20. The density of a solution prepared by dissolving 120 g of urea (mol mass = 69 ) in 1000 g of water is
1.15 g/ m L. The molarity of the solution is,
(A) 1.78 M (B) 1.02 M (C) 2.05 M (D) 0.50 M

2 | | Dr. Arvind Gambheer and Team Bridge course and PU | KCET|IIT-JEE|NEET

 Chapter - 2
Structure of atom

1. The atomic weight of an element is 23 and atomic number is11. The number of protons, electrons and
neutrons respectively present in the atom of the element are
(A) 11.11.12 (B) 12.12.11 (C) 11.12.11 (D) 12.11.12
2. In which one as the following pairs, the two species are both Iso electronic and isotopic
(A) 40
Ca 2 + and 40 Ar (B) 39
K + and 40 K + (C) 24 Mg+ and 25Mg (D) 23 K+ and 24 Na+
3. An isotone of 14
6 C is
14 15 16 40
(A) 7 N (B) 7 N (C) 8 O (D) 18 Ar

4. The threshold frequency 0 for a metal is 7.0  1014 s−1 calculate the kinetic energy of an electron emitted
when radiation of frequency  = 1.0  1015  10−1
(A) 1.98  10−19 (B) 2.98  10−13 (C) 3.20  10−20 (D) 1.0  10−10
5. The value of plank constant is 6.63  10−34 Js. The velocity of light is 3.0  108 ms−1. Which value is
closest to the wave length in Nanometres of a quantum of light with frequency of 8  1015 S−1
(A) 4  101 (B) 3  107 (C) 2  10−25 (D) 5  10−18
6. If the energies of the two photons are in the ratio of 3:2, their wavelengths will be the ratio of
(A) 9: 4 (B) 2:3 (C) 1:2 (D) 3:2
7. When the electrons of hydrogen atom return to L shell from shells of higher energy, we get a series of
line in the spectrum. This series is called
(A) Brackett series (B) Paschen series (C) Balmer series (D) Lyman series
8. In Bohr series of lines of hydrogen spectrum, the third line from the red end corresponds to which one of
the following inter-orbit jumps of the electron for Bohr orbits in an atom of hydrogen
(A) 5 → 2 (B) 4 → 1 (C) 2 → 5 (D) 3 → 2
9. The wave number of the first line of balmer series of hydrogen is 15200 cm −1. The wave number of the
first Balmer line of Li2+ ion is
(A) 15200 cm−1 (B) 60800 cm−1 (C) 7600 cm−1 (D) 136800 cm−1
10. In a hydrogen atom, if energy of an electron in the ground state is 13.6 eV, then that in the 2 nd excited
state is
(A) 1,51eV (B) 3.4 eV (C) 6.04 eV (D) 13.6 eV
11. Angular momentum of an electron in the nth orbit of hydrogen atom is given by
nh 2 
(A) (B) nh (C) (D)
2 nh 2nh
12. Ionization energy of He+ is 19.6 10−18J atom−1. The energy of the first stationary state (n=1) of Li2+ is
(A) 4.41 10−16Jatom−1 (B)−4.4110−16Jatom−1
(C) − 2.2 10−16Jatom−1 (D) 8.8210−16Jatom−1

3 | | Dr. Arvind Gambheer and Team Bridge course and PU | KCET|IIT-JEE|NEET

13. According to Bohr’s theory, the angular momentum of an electron in 5th orbit is
h h h h
(A) 25 (B) 1.0 (C) 10 (D) 2.5
   
14. Calculate the mass of a photon of sodium light having wavelength 600 nm and velocity 3  108 m s−1
(A) 3.68  10−36 kg (B) 4.09  10−19 kg (C) 2.24  10−10 kg (D) 2.02  10−12 kg
15. The number of 2p electrons having spin quantum number S=−1/2 are
(A) 6 (B) 0 (C) 2 (D) 3
16. For a f-orbital the values of m are

(A) −1, 0, +1 (B) 0, +1, + 2, + 3

(C) −2,−1, 0¸+ 1, + 2 (D) −3,−2,−1, 0, +1, +2, +3
17. Number of angular nodes for 4 d orbital is

(A) 4 (B) 3 (C) 2 (D) 1

18. Which of the following will violates aufbau principle as well as Pauli’s exclusion principle?

1s 1s 2p 1s 1s 2p
(A) (B)

1s 1s 2p
(C) (D) None of the above
19. Which of the following ions has the maximum magnetic moment?
(A) Mn+2 (B) Fe+2 (C) Ti+2 (D) Cr+2
20. An atom of an element A has three electrons in its outermost orbit and that of B has six electrons in its
outermost orbit. The formula of the compound between these two will be
(A) A3B6 (B) A2B3 (C) A3B2 (D) A2B

4 | | Dr. Arvind Gambheer and Team Bridge course and PU | KCET|IIT-JEE|NEET

 Chapter - 3
Classification of Elements and Periodicity in Properties

1. Pd has exceptional configuration 4d10, 5s0. It belongs to

(A) 4th period (B) 6th period (C) 7th period (D) 5th period
2. The element with atomic number 36 belongs to …… block in the periodic table
(A) p (B) s (C) f (D) d
3. The elements with atomic numbers 9, 17, 35, 53, 85 are all
(A) noble gases (B) halogens (C) heavy metals (D) light metals
4. Gallium was named by Mendeleeff as
(A) Eka−aluminum (B) Eka−silicon (C) Eka−germanium (D)Eka−zine
5. The element having electronic configuration [Kr] 4d10 4f14 5s2 5p6 6d16s2 belong to
(A)s − block (B) p – block (C) dblock (D) f− block
6. Smallest among these species is
(A) lithium (B) lithium ion (C) hydrogen (D) helium
7. Chloride ion and potassium ion are isoelectronic. Then
(A) potassium ion is relatively bigger (B) depends on the other cation and anion
(C) their sizes are same (D) chloride ion is bigger than potassium ion
8. Among Na2+, Na, Mg and Mg2+, the largest particle is
(A) Mg2+ (B) Mg (C) Na (D) Na+
9. In the following, the element with the highest ionization energy is
(A) [Ne] 3s23p1 (B) [Ne]3s23p3 (C) [Ne]3s23p2 (D) [Ne]3s23p4
10. The correct order of atomic size is
(A) F < N < Be < C (B) Be > C > F < N (C) Be < C > F < N (D) Be > C > F > N
11. The correct sequence of ionic radii, is
(A) Cl− > S2− > Ar > Ca2 + (B) S2− > Cl− > Ar > Ca2+
(C) Ar > Cl− > S2− > Ca2+ (D) Ca2+ > Ar > Cl− > S2−
12. Which of the following is the smallest ion?
(A) N3− (B) O2− (C) Mg2+ (D) Al3+
13. The first ionization potential of Na, Mg, Al and Si are in the order
(A) Na < Mg > Al < Si (B) Na > Mg > Al > Si
(C) Na < Mg < Al > Si (D) Na > Mg > Al < Si
14. The correct order of ionization energy is
(A) C > N > O (B) C > N > O (C) C < N > O (D) C < N < O
15. Which of the following factors may be regarded as the main cause of lanthanide contraction?

5 | | Dr. Arvind Gambheer and Team Bridge course and PU | KCET|IIT-JEE|NEET

 (A) Poor shielding of one of 4f electron by another in the subshell
(B) Effective shielding of one of 4f electors by another in the subshell
(C) Poorer shielding of 5d electrons by 4f electrons
(D) Grater shielding of 5d electrons by 4f electrons
16. The oxide of an element whose electronic configuration is 1s2 2s2 2p63s1 is
(A) amphoteric (B) basic (C) acidic (D) neutral
17. Which one of the following orders presents the correct sequence of the increasing basic nature of the
given oxides?
(A) MgO < K2O < Al2O3 < Na2O (B) Na2O < K2O < MgO < Al2O3
(C) K2O < Na2O < Al2O3 < MgO (D) Al2O3 < MgO < Na2O < K2O
18. Among Al2O3, SiO2, P2O3 and SO2, the correct order of acid strength is
(A) Al2O3 < SiO2 < SO2 < P2O3 (B) SiO2 < SO2 < Al2O3 < P2O3
(C) SO2 < P2O3 < SiO2 < Al2O3 (D) Al2O3 < SiO2 < P2O3 < SO2
19. Which of the following oxides is amphoteric in character?
(A) SnO2 (B) SiO2 (C) CO2 (D) CaO
20. The heat of hydration of Ca2+, Sr2+, and Ba2+ in the decreasing order is
(A) Ca2+ > Sr2+ > Ba2+ (B) Ca2+ > Ba2+ > Sr2+
(C) Sr2+, Ba2+ > Ca2+ (D) Ba2+ > Sr2+ > Ca2+

6 | | Dr. Arvind Gambheer and Team Bridge course and PU | KCET|IIT-JEE|NEET

 Chapter - 4
Chemical Bonding and Molecular Structure

1. Lattice energy of an ionic compound depends upon

(A) Charge on the ion only (B) Size of the ion only
(C) Packing of ions only (D) Charge on the ion and size of the ion
2. In the given bonds which one is most ionic
(A) Cs − Cl (B) Al − Cl (C) C − Cl (D) H − Cl
3. The covalency of nitrogen in HNO3 is

(A) 0 (B) 3 (C) 4 (D) 5

4. Expansion of octet can not take place in
(A) N (B) S (C) Si (D) P
5. Which is the correct electron dot structure of N 2 O molecule

.. .. .. .. .. ..
(A) :N = N = O (B) :N  N + − O :− (C) N = N = O (D) :N = N = O :
.. .. .. .. ..

6. Which of the following is Lewis acid

(A) BF3 (B) NH 3 (C) PH 3 (D) SO 2
7. The bond that exists between NH 3 and BF3 is called

(A) Electrovalent (B) Covalent (C) Coordinate (D) Hydrogen

8. Number of bonds in SO 2

(A) Two  and two  (B) Two  and one 

(C) Two , two  and one lone pair (D) None of these
9. The correct shape of SF4 will be

F F
F F F .. ..
: S F S F F F
S
(A) (B) (C) (D) S
.. F
F F F
F F F

10. Which molecule is not linear

(A) BeF2 (B) BeH 2 (C) CO 2 (D) H 2 O
11. The pair of compounds having identical shapes for their molecules is
(A) CH4, SF4 (B) BCl2, ClF3 (C) XeF2, ZnCl2 (D) SO2, CO2
12. The molecular shapes of SF4 ,CF4 and XeF4 are

(A) The same with 2, 0 and 1 lone pairs of electrons on the central atom, respectively
(B) The same with 1, 1 and 1 lone pair of electrons on the central atoms, respectively
(C) Different with 0, 1 and 2 lone pairs of electrons on the central atom, respectively

7 | | Dr. Arvind Gambheer and Team Bridge course and PU | KCET|IIT-JEE|NEET

 (D) Different with 1, 0 and 2 lone pairs of electrons on the central atom, respectively
13. Which has triangular planar shape
(A) CH 3+ (B) ClO −2 (C) PCl5 (D) N2

14. The bond order of NO molecule is

(A) 1 (B) 2 (C) 2.5 (D) 3
15. The number of unpaired electrons in O 2 molecule is

(A) 0 (B)1 (C) 2 (D) 3

16. The bond order is maximum in
(A) O 2 (B) O −21 (C) O +21 (D) O −22

17. What is correct sequence of bond order

(A) O +2  O 2−  O 2 (B) O +2  O 2  O 2− (C) O 2  O 2−  O 2+ (D) O −2  O 2+  O 2
18. Given H2, H +2 , He +2 . The correct order of increasing bond energy is

(A) H2 < H +2 < He +2 (B) He +2 < H +2 < H2 (C) H +2 < He +2 < H2 (D) H2 < He +2 < H +2

19. HCl is a gas but HF is a low boiling liquid. This is because

(A) H − F bond is strong (B) H − F bond is weak
(C) Molecules aggregate because of hydrogen bonding (D) HF is a weak acid
20. The maximum possible number of hydrogen bonds in which an H 2 O molecule can participate is

(A) 1 (B)2 (C) 3 (D) 4

8 | | Dr. Arvind Gambheer and Team Bridge course and PU | KCET|IIT-JEE|NEET

 Chapter - 5
Thermodynamics and Thermochemistry

1.  S surroundings = + 959.1 JK−1 mol−1  Ssystem = − 163.1 JK−1 mol−1 Then the process is
(A) Spontaneous (B) Non spontaneous
(C) At equilibrium 4Cannot be predicted from the information
2. For an endothermic reaction,  S is positive. Then the reaction is
(A) feasible when T S>  H (B) feasible when  H > T  S
(C) feasible at all temperatures (D) not feasible at all
3. For a process to be spontaneous at all conditions of temperature which of the following is true?
(A)  S positive and  H positive (B)  S positive and  H negative
(C)  S negative and  H positive (D)  S negative and  H negative
4. A gas expands by 0.5litre against a constant pressure of one atmosphere. Then the work done in joules
(A) 50.65 J (B) −100.5J (C) −200 J (D) −10 J
5. The difference between heat of reaction at constant pressure and constant volume for the reaction given
below at 25C in kJ is : 2C6H6 (l) + 1502 (g) → 12CO2 (g) + 6H2O (l)
(A) −7.43 (B) +3.72 (C) −3.72 (D) +7.43
6. If a gas absorbs 200 J of heat and expands by 500 cm3 against a constant pressure of 2  105 NM−2, then
change in internal energy is
(A) −300 J (B) −100 J (C) +100 J (D) + 300 J
7. 1.0 mole of a monoatomic ideal gas is expanded from state (1) to state (2) as shown in the figure.
Calculate the work done for the expansion of gas from state (1) to state (2) at 298 K
2.0 State (1)
(bar)
→
p

1.0 State (2)

22.7
V(L) →

(A) −1717.46 J (B) +1717.46 J (C) −1908.2 J (D) +1908.2 J

8. The equilibrium constant for a reaction is 10. What will be the value of G ? R = 8.314 JK−1 mol−1, T =
300 K.
(A) −574.414 J mol−1 (B) 5744.14 J mol−1 (C) −57.4414 J mol−1 (D) 57441.4 J mol−1
9. The enthalpy of formation of two compounds A & B are − 84 kJ & − 156 kJ respectively. Which one of
the following statements is correct?
(A) A is less stable than B (B) both A and B are unstable
(C) A and B are endothermic compounds (D) A is more stable than B

9 | | Dr. Arvind Gambheer and Team Bridge course and PU | KCET|IIT-JEE|NEET

10. In an adiabatic expansion of an ideal gas
(A) w = E (B) w = −E (C)E = 0 (D) w = 0
11. A mixture of two moles of CO and one mole of O2 in a closed vessel is ignited to convert CO in CO2. If
H is the enthalpy change and E is the internal energy change
(A) H > E (B) H < E
(C) E = H (D) depends on the capacity of the vessel
12. Which one of the following is an extensive property?
(A) molarity (B) molar volume
(C) mole fraction (D) number of moles
13. Which of the following is an extensive property?
(A) Enthalpy (B) Concentration (C) Density (D) Viscosity
14. 4.48 L of an ideal gas at STP requires 12.0 calories to raise it’s temperature by 15C at constant volume
the Cp of the gas is
(A) 3 cal (B) 4 cal (C) 7 cal (D) 6 cal
15. The standard heat of combustion of graphite carbon is −393.5 KJ mol−1. The standard enthalpy of CO2 is
(A) +393.5 kJ mol−1 (B) −393.5 kj mol−1 (C) +196.75 kJ mol−1 (D) −196.75 kJ mol−1
Ans (B)
C( graphite ) + O 2( g ) → CO 2( g ) , H = −393.5

16. H2 (g) + 12 (g) →2HI (g), H = 51.9 KJ. According to this, heat of formation of Hl is
(A) 51.9 KJ (B) −51.9 KJ (C) −25.95 KJ (D) 25.95 KJ
17. When 10 grams of methane is completely burnt in oxygen, the heat evolved is 560 KJ. What is the heat
of combustion (in kJ. mol−1) of methane?
(A) −1120 (B) −968 (C) −896 (D) −560
18. The heat of dissociation (in k. cals/mole) of CH4 and C2 H6 are 360 and 620 respectively. From these the
C − C bond energy in the ethane can be evaluated as
(A) 260 (B) 130 (C) 80 (D) 200
19. AB, A2 and B2 are diatomic molecules. If the bond enthalpies of A2, AB and B2 are in the ratio :1 : 0.5
and enthalpy of formation of AB from A2 and B2 is − 100 kJ mol−1. What is the bond energy of A2
(A) 200 kJmol−1 (B) 100 kJmol−1 (C) 300 kJmol−1 (D) 400 kJmol−1
20. If S (g) + e − → S1− (g), H = −207.6 KJ, S (g) + 2e− →S2− (g),  H = + 335.2 KJ. The enthalpy for the
reaction S1− (g) + e− → S2− (g) :
(A) =127.6 kJ (B) −127.6 kJ (C) +542.8 kJ (D) −641.8 kJ

10 | | Dr. Arvind Gambheer and Team Bridge course and PU | KCET|IIT-JEE|NEET

 Chapter - 6
Equilibrium

1. Le Chatelier’s principle is applicable only to a

(A) heterogeneous reaction (B) system in equilibrium
(C) irreversible reaction (D) homogeneous reaction
2. At 490 C, the equilibrium constant for the synthesis of HI is 50, the value of K for the dissociation of
HI will be
(A) 20.0 (B) 2.0 (C) 0.2 (D) 0.02
3. A reaction is A + B → C + D initially. We start with equal concentration of A and B. At equilibrium we
find the moles of C is two times that of A. What is the equilibrium constant of the reaction?
(A) ¼ (B) ½ (C) 4 (D) 2
4. A quantity of PCl5 was heated in a 10 dm3 vessel at 250C. PCl5 (g) PCl3(g) + Cl2(g). At equilibrium
the vessel contains 0.1 mole of PCl5 and 0.2 mole of Cl2. The equilibrium constant of the reaction is
(A) 0.05 (B) 0.02 (C) 0.025 (D) 0.04
5. For a reaction if Kp > Kc, the forward reaction is favored by
(A) low temperature (B) high temperature (C) high pressure (D) low pressure
6. For the reaction N 2( g ) + O 2( g ) 2NO 2 , the value of Kc at 800C is 0.1. When the equilibrium

concentrations of both the reactants is 0.5 mol, what is the value of Kp at the same temperature?
(A) 0.5 (B) 0.1 (C) 0.01 (D) 0.025
7. The active mass of 45 g of KCl in a 3 L flask would be
(A) 0.20 (B) 2.0 (C) 3 (D) 4
1
8. Equilibrium constants K1 and K2 for the following equilibria No ( g ) + O2 ⎯
⎯⎯ → NO2 ( g ) and
K2
⎯
2
2NO 2 ( g ) ⎯
⎯⎯ → 2NO ( g ) + O 2 ( g ) are related as
K2
⎯
1 1 1 1
(A) K1 = (B) K 2 = (C) K 2 = (D) K1 =
K2 K1 K12 K 22

9. What is the effect of pressure by doubling the volume on the following system at 500C?
H 2 ( g ) + l2 ( g ) 2Hl ( g )

(A) Shift to product side (B) Shift to reactant side

(C) Liquifaction of Hl (D) No effect
10. The equilibrium which remains unaffected by change in pressure of the reactants is
(A) N 2 ( g ) + 02 ( g ) 2N03 ( g ) (B) 2S02 ( g ) + 02 ( g ) 2S03 ( g )
(C) 2S03 ( g ) 302 ( g ) (D) 2N02 N 2 04 ( g )

11. the conjugate base of NH −2 is

(A) NH3 (B) NH2− (C) NH +4 (D) N 3−

11 | | Dr. Arvind Gambheer and Team Bridge course and PU | KCET|IIT-JEE|NEET

12. Acidity of BF3 can be explained on the basis of which of the following concepts?
(A) Arrhenius concept (B) Bronsted Lowry concept
(C) Lewis concept (D) Bronsted Lowry as well as
13. The pH of a 0.005 molar aqueous solution of sulphuric acid is
(A) 0.005 (B) 1 (C) 2 (D) 0.1
14. The pH of the solution is 6. Sufficient amount of acid is added to decrease the pH to 2. The increase in
hydrogen ion concertation is
(A) 3 times (B) 100 times (C) 1000 times (D) 10,000 times.
15. The pH of a sample of vinegar is 3.76. Calculate the concentration of hydrogen ion in it.
(A) 1.84  10−4 (B) 1.97  10−4 (C) 1.738  10−4 (D) 1.283  10−4
16. What will be the value of pH of 0.01 mol dm−3 CH3COOH (K1 = 1.74  10−5)?
(A) 3.4 (B) 3.9 (C) 3.6 (D) 3.0
17. How many sodium acetate should be added to 0.1 m solution of CH3COOH to give a solution of pH 5.5
(pKa of CH3COOH = 4.5)
(A) 0.1 m (B) 0.2 m (C) 1.0 m (D) 10.0 m
18. A 0.01 M ammonia solution is 5% ionized. The concentration of the OH− ions is
(A) 0.005 M (B) 0.0001 M (C) 0.0005 M (D) 0.05
19. Calculate the pH of the solution obtained by mixing 100 cm3 of solution with pH = 3 and 400 cm3 of
solution with pH = 4.
(A) 5: 53 (B) 3.55 (C) 4.55 (D) 6.24
20. If S1, S2, S3 and S4 are the solubilities of AgCl in water in 0.01 M CaCl2, in 0.01 M NaCl and in 0.05 M
AgNO3 respectively at a certain temperature, the correct order of solubility is
(A) S1 > S2 > S3 > S4 (B) S1 > S3 > S2 > S4
(C) S1 > S1 = S3 > S4 (D) S1 > S3 > S4 > S2

12 | | Dr. Arvind Gambheer and Team Bridge course and PU | KCET|IIT-JEE|NEET

 Chapter - 7
Redox Reactions

1. Of the following reactions, only one is a redox reaction. Identify it

(A) Ca(OH)2 + 2HCl → CaCl2 + 2H2oO (B) BaCl2 + MgSO4 → BaSO4 + MgCl2
(C) 2S2O72− + 2H 2O → 4SO 42− + 4H + (D) Cu2S + 2FeO → 2Cu + 2Fe + SO2

2. In the following reaction 4P + 3KOH + 3H2O → 3KH2PO2 + PH3

(A) only phosphorous is oxidized and reduced (B) only phosphorous is reduced
(C) phosphorous is both oxidized and reduced (D) phosphorous is neither oxidized nor reduced
3. Which of the following reactions depict the oxidizing behavior of H2SO4
(A) 2PCl5 + H2SO4 → 2POCl3 + 2HCl + SO2Cl2 (B) 2NaOH + H2SO4 → Na2SO4 + H2O
(C) NaCl + H2SO4 → NaHSO4 + HCl (D) 2HI + H2SO4 → I2 + SO2 + 2H2O
4. Which of the following involves transfer of five electrons?
(A) MnO −4 → Mn 2+ (B) CrO 24− → Cr 3+ (C) MnO 24− → MnO 2 (D) Cr2O 72− → 2Cr 3+

5. Which of the following arrangements represent increasing oxidation number of the central atom?
(A) CrO −2 , ClO3− , CrO 42− , MnO 4− (B) ClO3− , CrO 42− , MnO 4− , CrO 2−
(C) CrO −2 , ClO3− , MnO 4−, CrO 42− (D) CrO 24− , MnO4− , CrO 2− , ClO3−
6. When KMnO4 acts as an oxidizing agent and ultimately forms MnO −42 , MnO 2 , Mn 2O3 and Mn +2 , then

the number of electrons transferred in each case respectively is

(A) 4, 3, 1, 5 (B) 1, 5, 3, 7 (C) 1, 3, 4, 5 (D) 3, 5, 7, 1
+3
7. If three electrons are lost by a metal ion M , its final oxidation number would be
(A) zero (B) 6 (C) 2 (D) 4
8. The oxidation states of S atoms in S4O 62− from left to right respectively are
O O

O S S S S O
O O

(A) 6, 0, 0, 6 (B) 3, 1, 1, 3 (C) 5, 0, 0, 5 (D) 4, 1, 1, 4

9. What is oxidation number of Fe in Fe(CO)5 ?
(A) Zero (B) 5 (C) − 5 (D) + 3
10. The oxide, which cannot cat as a reducing agent, is
(A) NO2 (B) SO2 (C) CO2 (D) ClO2
11. Which of the following act as a strong oxidizing agent
(A) HNO2 (B) HNO3 (C) H2PO2 (D) All are equally strong
12. The following redox reaction is balanced by which set of coefficients?
aZn + bNO3− + cH + → dNH +4 + eH 2O + fZn 2+

(a) (b) (c) (d) (e) (f)

13 | | Dr. Arvind Gambheer and Team Bridge course and PU | KCET|IIT-JEE|NEET

 (A) 1 1 10 1 3 1
(B) 2 2 10 2 3 2
(C) 4 2 10 1 3 4
(D) 4 1 10 1 3 4
13. The reaction Ag2+ + Ag → 2Ag+ is an example of
(A) Displacement reaction (B) Disproportionation reaction
(C) Comproportionation reaction (D) None
14.
Column I Column II

(a) 2H 2O 2 ⎯⎯
→ 2H 2O + O 2 (i) Metal displacement Reaction
(b) 2 NaH → 2Na + H2 (ii) Disproportionation Reaction
(c) V2O5 + 5Ca → 2V + 5CaO (iii) Decomposition Reaction

(d) CaCO3 ⎯⎯
→ CaO + CO 2 (iv) Redox Reaction
(A) (a) → (ii),(iii),(iv); (b) → (iii), (iv); (c) → (i), (iv); (d) → (iii)
(B) (a) → (iii), (iv); (b) → (ii), (iv); (c) → (iii), (v); (d) → (i), (iv)
(C) (a) → (ii); (b) → (iii), (iv); (c) → (i); (d) → (ii), (iii)
(D) (a) → (ii), (iv); (b) → (iii), (iv); (c) → (i), (v); (d) → (iii)
15. When Cl2 gas reacts with hot ans concentrated solution of sodium hydroxide, the oxidation number of
chlorine changes from :
(A) Zero to + 1 and zero to − 5 (B) Zero to − 1 and zero to + 5
(C) Zero to − 1 and zero to − 3 (D) Zero to +1 and zero to − 3
−
16. Equivalent weight of MnO in acidic, basic and Neutral media are in the ratio of
4

(A) 3 : 5 : 15 (B) 5 : 3 : 1 (C) 5 : 1 : 3 (D) 3 : 5 : 5

17. The equivalent weight of Na2S2O3 (Mol. wt. = M) in the reaction :
2Na2S2 O3 + I2 → Na2S4O6 + 2 NaI is
(A) M/4 (B) M/3 (C) M/2 (D) M/6
18. The colour of K2Cr2O7 changes from red orange to lemon yellow on treatment with aqueous KOH
because of
(A) reduction of Cr(VI) to Cr(III)
(B) formation of chromium hydroxide
(C) conversion of dichromate ion to chromate
(D) oxidation of potassium hydroxide to potassium peroxide
19. Equivalent mass of oxidising agent in the reaction, SO2 + 2H2S → 3S + 2H2O is
(A) 32 (B) 64 (C) 16 (D) 8

14 | | Dr. Arvind Gambheer and Team Bridge course and PU | KCET|IIT-JEE|NEET

20. The formula mass of Mohr’s salt is 392. The iron present in it is oxidised by KMnO 4 in acidic medium.
The equivalent mass of Mohr’s salt is
(A) 392 (B) 31.6 (C) 278 (D) 156

15 | | Dr. Arvind Gambheer and Team Bridge course and PU | KCET|IIT-JEE|NEET

 Chapter - 8
Organic Chemistry - Some Principles and Techniques

1. Which one of the following does not have sp2 hybridized carbon?
(A) Acetone (B) Acetamide (C) Acetonitrile (D) Acetic acid
2. The IUPAC name of the compound shown below
(A) 2-bromo-6-chlorocyclohex-1-ene (B) 6-bromo-2-chlorocyclohexene
(C) 3-bromo-1-chlorocyclohexene (D) 1-bromo-3-chlorocyclohexene
3. Assertion: All the carbon atoms in H2C = C = CH2 are sp2 hyrbidised
Reason: In this molecule all the carbon atoms are attached to each other by double bonds
(A) both Assertion and Reason are true and Reason in the correct explanation of Assertion
(B) both Assertion and Reason are true but Reason is not the correct explanation of Assertion
(C) Assertion is true but Reason is false
(D) both Assertion and Reason are false

CH2 CH CH2
4. The IUPAC name of the compound
CN CN CN

(A) 1, 2, 3-tricyanoproapne (B) 3-cyanopentane-1, 5-dinitrile

(C) Propane-1, 2, 3,-tricarbonitrile (D) Propane-1, 2, 3-tricarbylamine
5. Which of the following is not a heterocyclic compound
(A) Furan (B) thiophene (C) pyrrole (D) cyclohexane
6. The total number of isomeric alcohols with the molecular formula C4H8OH is
(A) 3 (B) 4 (C) 5 (D) 2
7. The dihedral angle in the staggered conformation of C2H6 is
(A) 120 (B) 60 (C) 0 (D) 90
8. But-2-ene exhibit cis-trans isomerism due to
(A) rotation around C3 – C4 sigma bond (B) restricted rotation around C = C bond
(C) rotation around C1 – C2 bond (D) rotation around C2 – C3 double bond
9. The number of isomers for the compound with molecular formula C2BrClFI is
(A) 3 (B) 4 (C) 5 (D) 6
10. Arrangement of (CH3)3 – C −, (CH3)2 – CH -, CH3 – CH2 −, when attached to benzyl or an unsaturated
group, in increasing order of inductive effect is
(A) (CH3)3 – C − <(CH3)2 − CH − < CH3 – CH2
(B) CH3 – CH2 − < (CH3)2 − < CH − < (CH3)3 − C −

16 | | Dr. Arvind Gambheer and Team Bridge course and PU | KCET|IIT-JEE|NEET

 (C) (CH3)2 – CH < (CH3)3 − C − < CH3 − CH2
(D) (CH3)3 – C − < CH3 − CH2 < (CH3)2 − < CH
11. The increasing order of stability of the following free radicals is
• • • •
(A) ( CH3 )2 C H  ( CH3 )3 C  ( C6 H 4 )2 C H  ( C6 H5 ) C
• • • •
(B) ( C6 H5 )3 C  ( C6 H5 )2 C H  ( CH3 )3 C  ( CH3 )2 C H
• • • •
(C) ( C6 H5 )2 C H  ( C6 H5 )3 C  ( CH3 )3 C  ( CH 3 )2 C H
• • • •
(D) ( CH3 )2 C H  ( CH3 )3 C  ( C6 H5 )3 C  ( C6 H5 )2 C H

12. The order of stability of the following carbocation’s


CH2
 
CH 2 = CH − C H 2 CH3 − CH 2 − C H 2

(i) (ii) (iii)

(A) (iii) > (ii) > (i) (B) (ii) > (iii) > (i) (C) (i) > (ii) > (iii) (D) (iii) > (i) > (ii)
13. Arrange the carbanions ( CH 3 )3 C, CCl3 , ( CH 3 )2 CH,C6H 5CH 2 , in order of their decreasing stability
(A) C6 H 5CH 2  CCl3  ( CH3 )3 C  ( CH3 )2 CH (B) ( CH 3 )2 CH  CCl3  C6 H 5CH 2  ( CH 3 )3 C
(C) CCl3  C6 H 5CH 2  ( CH 3 )2 CH  ( CH 3 )3 C (D) ( CH 3 )3 C  ( CH 3 )2 CH  C6 H 5CH 2  CCl3

14. Assertion: Energy of resonance hybrid is equal to the average of energies of all canonical forms
Reason: Resonance hybrid cannot be represented by a single structure
(A) both Assertion and Reason are true and Reason in the correct explanation of Assertion
(B) both Assertion and Reason are true but Reason is not the correct explanation of Assertion
(C) Assertion is true but Reason is false
(D) both Assertion and Reason are false
15. Which one of the following orders is correct regarding the −1 effect of the substituents?
(A) −NR2 < −OR > − F (B) −NR2 > −OR > − F
(C) −NR2 < − OR < −F (D) −NR2 > − OR < − F
16. is vinyl carbocation
  
(A) C6 H5 − C H 2 (B) CH 2 = CH − C H 2 (C) CH 2 = C H (D) All of these
17. Complete combustion of a hydrocarbon gives CO2 (0.66 g) and H2O (0.36 g). The empirical formula of
the compound is
(A) CH2 (B) C3H4 (C) C3H8 (D) C6H8
18. Match the Column I with Column II
Column I Column II
(i) Dumas Method (a) AgNO3
(ii) Kjeldahl’s method (b) Silica gel

17 | | Dr. Arvind Gambheer and Team Bridge course and PU | KCET|IIT-JEE|NEET

 (iii) Carius method (c) Nitrogen gas
(iv) Chromatography (d) Free radicals
(v) Homolysis (e) Ammonia
(A) (i) → (d); (ii) → (b); (iii) → (a); (iv) → (e); (v) → (c)
(B) (i) → (c); (ii) → (e); (iii) → (a); (iv) → (b); (v) → (d)
(C) (i) → (e); (ii) → (b); (iii) → (f); (iv) → (a); (v) → (c)
(D) (i) → (a); (ii) → (b); (iii) → (c); (iv) → (d); (v) → (e)
19. Separation of organic compounds by column chromatography is due to
(A) selective adsorption (B) selective absorption
(C) solubilities (D) selective adsorption and selective absorption
20. Organic solids can be purified by
(A) Steam distillation (B) Crystallisation
(C) Fractional distillation (D) Simple distillation

18 | | Dr. Arvind Gambheer and Team Bridge course and PU | KCET|IIT-JEE|NEET

 Chapter - 9
Hydrocarbons

1. Elimination of bromine from 2−bromobutane results in the formation of

(A) equimolar mixture of 1 and 2−butene (B) predominantly −2−butene
(C) predominantly 1− butene (D) predominantly 2−butyne
2. How many chiral compounds are possible on monochlorination of 2-methyl butane?
(A) 8 (B) 2 (C) 4 (D) 6
3. Arrange the halogens F2, Cl2, Br2, I2 order of their increasing reactivity with alkanes
(A) I2 < Br < CI2 < F2 (B) Br2 < CI2 < F2 < I2
(C) F2 < CI2 < Br2 < I2 (D) Br2 < I2 < CI2 < F2
4. The reagent used to convert a carboxyl group (−COOH) into −CH3 group is
(A) LiAlH4 (B) Na and alcohol (C) Red P and H (D) Zn + HCl
5. Electrolytic decarboxylation of sodium propionate produces
(A) propane (B) ethane (C) methane (D) butane
6. According to markownikoff ’s rule, when hydrogen chloride adds to an unsymmertrical alkene, the
hydrogen of HCl attaches to:
(A) Carbon in the middle of the molecule (B) Carbon in the end of the molecule
(C) Carbon with most number of hydrogens (D) Carbon with least number of hydrogens
7. 3− phenyl propene on reaction with HBr given (as a major product)
(A) C6H5CH2CH(Br)CH3 (B) C6H5CH(Br)CH2CH3
(C) C6H5CH2CH2CH2Br (D) C6H5CH(Br)CH=CH2

8. The olefin which on ozonolysis gives CH3CH2CHO and CH3CHO is

(A)1−butene (B) 2− butane (C) 1− pentene (D) 2−pentene
9.
Column II Column II
1
(a) CH 2 = CH 2 + O2 ⎯⎯
Ag

→ (i) Diol
2
(b) CH2 = CH2 + Cold (ii) Cyclic ether
Alkaline KMnO4→ (epoxide)
(c) CH2=CH2+ HOCl→ (iii) Unsaturated hydro carbon
(d) CH 2 Br − CH 2 Br ⎯⎯⎯→
Zn
Alcohol (iv) Chloro hydrin
(A) (a) → (i), (b) → (ii), (c) → (iii), (d) → (iv) (B) (a) → (ii), (b) → (i), (c) → (iv), (d) → (iii)
(C) (a) → (iii), (b) → (ii), (c) → (i), (d) → (iv) (D) (a) → (iii), (b) → (i), (c) → (ii), (d) → (iv)

19 | | Dr. Arvind Gambheer and Team Bridge course and PU | KCET|IIT-JEE|NEET

10. HBr reacts with CH2 = CH − OCH3 under anhydrous conditions at room temperature to give
(A) CH3CHO and CH3Br (B) BrCH2CHO and CH3OH
(C) BrCH2−CH2−OCH3 (D) H3C−CHBr−OCH3
11. Ozonolysis of an organic compound gives formaldehyde as one of the products. This confirms the
presence of
(A) two ethylenic double bonds (B) a vinyl group
(C) an iso propyl group (D) an acetylenic triple bond

12. A ⎯⎯⎯⎯
(i) BH3 ,THF
(ii) H O , OH −
⎯ CH3C  CH ⎯⎯⎯
HgSO4
H 2SO 4
→ B Identify A and B
2 2

(A) CH3CHO, CH3COCH3 (B) CH3CH2CHO, CH3COCH3

(C) CH3CH2CHO, CH3COCH2CH3 (D) HCHO, CH3COCH3
13. Which of the following alkynes will not be able to show acidic character?
(A) 1 − Butyne (B) 2 − Butyne (C) Propyne (D) Ethyne
14. When phenyl magnesium bromide reacts with tertiary butanol the product formed will be
(A) phenol (B) benzene
(C) tertiary butyl benzene (D) tertiary butyl phenyl ether
15. The compound formed as a result of oxidation of ehyl benzene by KMnO4 is :
(A) acetophenone (B) benzoic acid (C) benzyl alcohol (D) benzophenone
16. In the reaction Phenol ⎯⎯⎯⎯ Zn
distillation
→ A ⎯⎯⎯⎯⎯
Cone H 2SO4
Cone HNO3 60
→

The compounds A and B are

(A) Benzene, aniline (B) Benzene, benzene sulphonic acid
(C) Benzene, nitrobenzene (D) Benzene, toludine
17. Cyclopentadienyl anion is aromatic due to the presence of
(A) 6  electrons (B) 10  electrons
(C) 4 electrons (D) 12 electrons
18. Match the following reactants in Column I with the corresponding reaction products in Column II

Column I Column II

(a) Benzene + Cl2 ⎯⎯⎯

AICl3
→ 1. Benozoic acid

(b) Benzene + CH3CI ⎯⎯⎯

AICl3
→ 2. Methyl phenyl ketone

(c) Benzene + CH3COCI ⎯⎯⎯

AICl3
→ 3. Toluene

(d) Toluene ⎯⎯⎯⎯⎯

KMnO 4 / NaOH
→ 4. Chlorobenzene

5. Benzene Hexachloride

Codes
(a) (b) (c) (d)

20 | | Dr. Arvind Gambheer and Team Bridge course and PU | KCET|IIT-JEE|NEET

 (A) 4 3 2 1
(B) 1 2 3 4
(C) 4 3 1 5
(D) 1 5 2 3
19. Nitrobenzene can be prepared from benzene by using a mixture of concentrated HNO3 and concentrated
H2SO4. In the nitrating mixture, HNO3 acts as
(A) base (B) acid (C) reducing agent (D) catalyst
20. Among the following compounds (i) to (iii) the correct order of reaction with Electrophile is
OCH3 NO2

(i) (ii) (iii)

(A) (ii) > (iii) > (i) (B) (iii) < (i) < (ii) (C) (i) > (ii) > (iii) (D) (i) = (ii) = (iii)

21 | | Dr. Arvind Gambheer and Team Bridge course and PU | KCET|IIT-JEE|NEET

 TUTORPOD LEARNING LLP
BRIDGE cOURsE AND PU | KcET|IIT-JEE|NEET

Dr. Arvind Gambheer

Founder and CEO
Dr. Gambheer is one of the leading authorities in India on Entrance Exams
ranging from CET to IIT-JEE. With an experience of over 30+ years he has won many
national and international accolades.

A very passionate teacher himself, he has trained millions of students across

the globe and guided thousands of teachers. An architect in creating cutting edge
study material that has helped students ace their exams.

II PU CHEMISTRY MATERIAL
S.NO CHAPTER NAME PG.NO
1 Solutions 1-3
2 Electrochemistry 4-5
3 Chemical Kinetics 6-8
4 d and f block elements 9-10
5 Co-Ordination Compounds 11-12
6 Haloalkanes and Haloarenes 13-15
7 Alcohols phenols and Ethers 16-18
8 Aldehydes and ketones and carboxylic acids 19-20
9 Organic compounds Containing Nitrogen 21-23
10 Biomolecules 24-26
 Chapter - 1
Solutions

1. The density of a solution prepared dissolving 120 g of urea (molar mass = 60 g) in 1000 g of water is
115 g/mL. The molarity of solution is:
(A) 050 M (B) 178 M (C) 102 M (D) 205 M
2. What is the molarity of H2SO4 solution that has a density 1. 84 g/cc at 35C and contains 98% solute by
weight?
(A) 4.18 M (B) 1.84 M (C) 8.41 M (D) 18.4 M
3. The molality of pure water is
(A) 555 (B) 50 (C) 100 (D) 18
4. The mole fraction of the solute in one molal aqueous solution is
(A) 08 (B) 0018 (C) 04 0 (D) 02
5. Statement I The difference in the boiling points of equimolar solution of HCl and HF decreases as their
molarity is decreased.
Statement II The extent of dissociation decreases steadily with increasing dilution.
(A) Statement I is true, Statement II is true; Statement II is a correct explanation for Statement I
(B) Statement I is true, Statement II is true; Statement II is not a correct explanation for Statement I
(C) Statement I is true; Statement II is false.
(D) Statement I is false; Statement II is true.
6. Value of Henry’s constant KH
(A) increases with increase in temperature (B) decreases with increases in temperature
(C) remains constant (D) first increases then decreases
7. KH value for Ar(g), CO2(g), HCHO(g) and CH4 (g) are 40.39, 1.67, 1.83  10−5 and 0.413 respectively.
Arrange these gases in the order of their increasing solubility.
(A) HCHO < CH4 < CO2 < Ar (B) HCHO < CO2 < CH4 < Ar
(C) Ar < CO2 < CH4 < HCHO (D) Ar < CH4 < CO2 < HCHO
8. Henry law constant for solubility of N2 gas in water at 298 K is 1.0  105 atm. The mole fraction of N2 in
air is 0.8. The number of moles of N2 from air dissolved in 10 moles of water at 298 K and 5 atm
pressure is
(A) 4.0  10−4 (B) 4.0  10−5 (C) 5.0  10−4 (D) 4.0  10−6
9. A binary liquid solution is prepared by mixing n-heptane and ethanol. Which one of the following
statement is correct regarding the behavior of the solution?
(A) The solution is non-ideal, showing –ve deviation from Raoult’s law
(B) n-heptance shows +ve deviation while ethanol shows –ve deviation from Raoult’s law

1 | | Dr. Arvind Gambheer and Team Bridge course and PU | KCET|IIT-JEE|NEET

 (C) The solution formed is an ideal solution
(D) The solution is non−ideal, showing +ve deviation from Raoult’s Law
10. Boiling point of water at 750 mm Hg is 99.63C. How much sucrose is to be added to 500 g of water
such that it boils at 100C. [Kb for water is 0.52 K kg mol-1]
(A) 121 g (B) 150 g (C) 180 g (D) 300 g
11. On mixing 10 mL of acetone with 50 mL of chloroform the total volume of the solution is
(A) < 60 mL (B) > 60 mL (C) = 60 mL (D) unpredictable
Ans (A)
Cl
CH3
Cl C H .....O = C
CH3
Cl
Chloroform Acetone

Interparticle forces between chloroform and acetone are stronger (H-bonds) hence, there in a decrease in
volume on mixing acetone and chloroform
12. Azeotropic mixture of water and HCl boils at 381.5 K. By distilling the mixture it is possible to obtain
(A) Pure HCl only (B) Pure water only
(C) Neither water nor HCl (D) Both water and HCl in pure state.
13. The mole fraction of the solute in one molal aqueous solution is
(A) 08 (B) 0018 (C) 04 0 (D) 02
14. 18 g of glucose (C6H12O6) is added to 1782 g of water. The vapour pressure of water for this aqueous
solution at 100C is
(A) 76.00 torr (B) 75240 torr (C) 75900 torr (D) 760 torr

15. A solution of sucrose (molar mass = 342 g mol−1) has been prepared by dissolving 685 g of sucrose in
1000 g of water. The freezing point of the solution obtained will be: (Kf for water = 186 K kg mol−1)
(A) − 0520C (B) + 0.372C (C) −0570C (D) − 0372C
16. A 00020 m aqueous solution of an ionic compound, Co(NH3)5(NO2)Cl freezes at −000732C. Number
of moles of ions which 1 mol of ionic compound produces on being dissolved in water will be (Kf =
186C/m)
(A) 3 (B) 4 (C) 1 (D) 2
17. Which of the following statements is false?
(A) Units of atmospheric pressure and osmotic pressure are the same
(B) In reverse osmosis, solvent molecules move through a semipermeable membrane from a region of
lower concentration of solute to a region of higher concentration
(C) The value of molal depression constant depends on nature of solvent
(D) Relative lowering of vapour pressure is a dimensionless quantity

2 | | Dr. Arvind Gambheer and Team Bridge course and PU | KCET|IIT-JEE|NEET

18. Lowering of vapour pressure of an aqueous solution of a non-volatile non-electrolyte 1 m aqueous
solution at 100C is
(A) 14.12 Torr (B) 312 Torr (C) 13.45 Torr (D) 352 Torr
19. pH of a 0.1 M monobasic acid is found to be 2. Hence, its osmotic pressure at a given temperature T K is
(A) 1.1 RT (B) 0.1 RT (C) 0.11 RT (D) 0.01 RT
20. Osmotic pressure of 0.1 M solution of NaCl and Na2SO4 will be
(A) same
(B) osmotic pressure of NaCl solution will be more than Na2SO4 solution
(C) osmotic pressure of Na2SO4 solution will be more than NaCl
(D) osmotic pressure of NaSO4 will be less than that NaCl solution

3 | | Dr. Arvind Gambheer and Team Bridge course and PU | KCET|IIT-JEE|NEET

 Chapter – 2
Electrochemistry

1. In a galvanic cell
(A) Electrical energy is converted into heat
(B) electrical energy is converted chemical energy
(C) chemical energy is converted into electrical energy
(D) chemical energy is converted into heat
2. Normal aluminum electrode coupled with normal hydrogen electrode gives an E. M. F. of 1.66 V. So the
standard electrode potential of aluminum is: (Given that Galvanometer deflection is towards Al)
(A) – 1.66 V (B) 1.66 V (C) – 0.83 V (D) + 0.83 V
3. The quantity of electricity required to liberate 112 cm3 of hydrogen at STP from acidulated water is
(A) 965 C (B) 1 Faraday (C) 0.1 F (D) 96500 C
4. In a galvanic cell, the electrons flow from
(A) anode to cathode through the solution (B) cathode to anode through the solution
(C) anode to cathode through the external circuit (D) cathode to anode through the external circuit
5. The emf of a galvanic cell constituted with the electrodes Zn2+ / Zn (E = – 0.76 V) and Fe2+/
(E°= – 0.41 V) is
(A) – 0.35 V (B) + 1.17 V (C) + 0.35 V (D) –1.17 V
6. The oxidation potential of A and B are +2.37 and + 1.66 V respectively. In a chemical reaction
(A) A will be replaced by B (B) A will replace B
(C) A will not replace B (D) A and B will not replace each other
7. Ecell = 0.78 volt for the following cell Fe ( s ) | Fe2+ ( aq ) || Cu 2+ ( aq ) | Cu ( s )
( xM ) ( 0.01M )
E o
Fe/Fe2+ ( aq )
= 0.44V, E o
Cu/Cu 2+ ( aq )
= −0.34V

(A) x cannot be predicted (B) x > 0.01 M

(C) x = 0.01 M (D) x < 0.01 M
8. What will be the emf of the given cell. Pt − H 2 ( P1 ) | H + ( aq ) || H + ( aq ) | H 2 ( P2 ) Pt
RT P1 RT P1 RT P2
(A) In (B) In (C) In (D) None of these
F P2 2F P2 2F P1

9. The relationship between standard reduction potential of a cell and equilibrium constant is shown by
n 0.0591
(A) E o cell = log K c (B) E o cell = log K c
0.0591 n
log K c
(C) E o cell = 0.0591 n log K c (D) E o cell =
n
10. The Equilibrium constant of the reaction
Cu(s) + 2Ag+ (aq) → Cu2+(aq) + 2Ag(s) is (Given E = 0.46 V)

4 | | Dr. Arvind Gambheer and Team Bridge course and PU | KCET|IIT-JEE|NEET

 (A) 6  107 (B) 3  1015 (C) 4.2  1015 (D) 4  1015
11. For a cell reaction involving two electrons change, the standard e. m. f. of the cell is found to be 0.295 V
at 298 K. The equilibrium constant of the reaction at the same temperature will be
(A) 2.95  102 (B) 10 (C) 1  1010 (D) 1  10–10
12. For the reduction of silver ions with copper metal, the standard cell potential was found to be + 0.46 V at
25C. The value of standard Gibb’s energy, G will be (F = 96500 C mol–1)
(A) – 89.0 kJ (B) – 89.0 J (C) – 44. 5 kJ (D) – 98.0 kJ
13. E of zinc electrode is −0.762 V. Calculate the single electrode potential of Zn electrode in decimolar
ZnSO4 solution
(A) −0.791 V (B) −1.2 V (C) −2.5 V (D) −3.2 V
14. The Gibbs energy for the decomposition of Al2O3 at 500 C is as follows:
The potential difference needed for electrolytic reduction of

Al2O3 at 500 C is at least

(A) 3.0 V (B) 2.5 V (C) 5.0 V (D) 4. 5 V
15. How long 2.5 amp of current is passed to supply 54000 C of charge?
(A) 1 hr (B) 2.5 hr (C) 6 hr (D) 9 hr
16. When a quantity of electricity is passed through CuSO4 solution, 0.16 g of copper gets deposited. If the
same quantity of electricity is passed through acidulated water, then the volume of H2 liberated at STP
will be [Given At. Wt. of Cu = 64.]
(A) 4.0 cm3 (B) 56 cm3 (C) 604 cm3 (D) 8.0 cm3
17. Out of Cu, Ag, Fe and Zn, the metal which can displace all others from their salt solution:
(A) Ag (B) Cu (C) Zn (D) Fe
18. When a strip of copper is dipped in a solution of ferrous sulphate
(A) iron is deposited on the copper strip (B) copper is precipitated
(C) copper dissolves (D) no reaction occurs
19. The potential of hydrogen electrode having a pH = 10 is
(A) 0.59 v (B) – 0.59 V (C) zero volt (D) – 0.059 V
20. When a lead storage battery is discharged
(A) SO2 is evolved (B) lead sulphate is consumed
(C) lead is formed (D) sulphuric acid is consumed

5 | | Dr. Arvind Gambheer and Team Bridge course and PU | KCET|IIT-JEE|NEET

 Chapter – 3
Chemical Kinetics

1. Rate of formation of SO3 in the following reaction 2SO2 + O2 → 2SO4 is 100 g min−1. Hence rate of
disappearance of O2 is
(A) 50 g min−1 (B) 100 g min−1 (C) 200 g min−1 (D) 20 g min−1
2. If the concentrations are expressed in mol litre–1 and time in s, then the units of the rate constant for the
first order reaction are :
(A) mol litre–1 s–1 (B) mol–1 litre s–1 (C) s–1 (D) mol2 litre–2 s–1
3. For a given reaction, A → Product, rate is 1  10−4 M s−1 when [A] = 0.01 M and rate is 1.41  10−4 M
s−1 when [A] = 0.02 M. hence, rate law is
d A −d  A 
(A) − = k A = k A
2
(B)
dt dt
−d  A  k −d  A 
= A = k A
1/ 2
(C) (D)
dt 4 dt
4. A radioactive isotope has a half-life of 10 days. It today 125 mg is left over, what was its original weight
40 days earlier?
(A) 2 g (B) 600 mg (C) 1 g (D) 1.5 g
5. The rate of a reaction between two reactants A and B decreases by a factor of 4 if the concertation of
reactant B is doubled. The order of reaction with respect to reactant B is
(A) 2 (B) –2 (C) 1 (D) –1
6. In a first-order reaction A → B, if k is rate constant and initial concentration of the reactant A is 0.5 M,
then the half-life is
log 2 log 2 ln 2 0.693
(A) (B) (C) (D)
k k 0.5 k 0.5k

7. For a chemical reaction A + B → C, the following data were found:

Initial Conc Initial Conc Rate
Of A Of B (mol litre–1 sec–1)
2.0 3.0 0.10
6.0 3.0 0.90
6.0 6.0 0.90
The correct rate expression from these data is
(A) r = k [A]2 [B]2 (B) r = k[A] [B] (C) r = k [A]2 (D) r = k[A] [B]2
8. On increasing temperature of the reacting system by 10 degrees the rate of reaction almost doubles. The
most appropriate reason for this is
(A) Collision frequency increases
(B) Activation energy decreases by increase in temperature

6 | | Dr. Arvind Gambheer and Team Bridge course and PU | KCET|IIT-JEE|NEET

 (C) The fraction of molecules having energy equal to threshold energy or more increases
(D) The value of threshold energy decreases
9. For the first order reaction, time required for 99% completion is
(A) half the time required for completion of 90% of reaction
(B) thrice the time required for 90% completion of reaction
(C) twice the time required for 90% completion of reaction
(D) none of these
10. Which of the following graphs correspond to first order reaction?
Rat

Rat

Rat

Rat
e

e
(A) (B) (C) (D)

C 1/C C C2
11. A reaction is 50% complete in 2 hours and 75% complete in 4 hours. The order of reaction is
(A) 0 (B) 1 (C) 2 (D) 3
12. For the reaction A + B → product, it is observed that
(i) on doubling the concentration of A only, the rate of reaction is also doubled
(ii) on doubling the initial concentration of both A and B, there is change by a factor of 8 in the rate of
reaction the rate of reaction is given by.
(A) Rate = k [A] [B]2 (B) Rate = k[A]2 [B]2
(C) Rate = k[A] [B] (D) Rate = k[A]2 [B]
13. Consider the decomposition of N2O5 as
1
N 2O5 → 2NO 2 + O 2
2
d  N 2O5  1 d  NO 2  d O 2 
The rate of reaction is given by − = =2 = k1  N 2 O 5 
dt 2 dt dt
d  N 2 O5 
Therefore , − = k1  N 2 O 5 
dt
d  NO2 
+ = 2k1  N 2O5  = k1'  N 2O5 
dt
d  O2  1
+ = k1  N 2O5  = k1''  N 2O5 
dt 2
Choose the correct option
(A) k1 = k '1 = k"1 (B) k1 = 2k '1 = k"1 (C) 2k1 = k '1 = 4k"1 (D) 4k1 = 2k '1 = k"1

14. For the reaction, A + B → 2C + D, which one is the incorrect statement?

(A) Rate of disappearance of A = Rate of disappearance of B
(B) Rate of disappearance of A = Rate of appearance of D
(C) Rate of disappearance of B =2  Rate of appearance of C

7 | | Dr. Arvind Gambheer and Team Bridge course and PU | KCET|IIT-JEE|NEET

 1
(D) Rate of disappearance of B =  rate of appearance of C
2
15. Which one of the following is not a first order reaction?
(A) 2HI → H2 + I2 (B) 2NO2 → 2NO + O2
(C) 2NO + O2 → 2NO2 (D) NH4 NO2 → N2 + 2H2O
16. In pseudo-unimolecular reaction
(A) one of the reactants is present in large excess
(B) both the reactants have same concentration
(C) both the reactants are present in low concentration
(D) one of the reactants is less reactive
17. The time for half-life period of a certain reaction A → Product is 1 hour. When the initial concentration
of the reactant ‘A’ is 2 mol L–1. How much time does it take for its concentration to come from 0.50 to
0.25 mol L–1 if it a zero order reaction?
(A) 0.25 h (B) 1 h (C) 4 h (D) 0.5 h
18. A reactant (A) forms two product
A ⎯⎯ k1
→ B, Activation energy, E a1
A ⎯⎯
k2
→ C, Activation energy, E a 2
If E a 2 = 2E a1 , then k1 and k2 are related as
(A) k 2 = k1.e + Ea /RT (B) k 2 = k1e
E a 2 /RT

(C) k1 = Ak 2e Ea /RT (D) k1 = 2k 2e

E a 2 /RT

19. In a zero-order reaction for every 10C rise of temperature, the rate is doubled. If the temperature is
increased from 10C to 100C, the rate of the reaction will become
(A) 256 times (B) 512 times (C) 64 times (D) 128 times
20. An endothermic reaction with high activation energy for the forward reaction is given by the diagram

(A) (B) (C) (D)

8 | | Dr. Arvind Gambheer and Team Bridge course and PU | KCET|IIT-JEE|NEET

 Chapter - 4
d and f block elements

1. The number of unpaired electrons in Cr + will be

(A) 3 (B) 4 (C) 5 (d) 6
2. Which of the following has highest ionic radii
(A) Cr +3 (B) Mn +3 (C) Fe +3 (D) Co +3

3. What is the general electronic configuration for 2nd row transition series
(A) [ Ne ]3 d 1−10 ,4 s 2 (B) [ Ar ]3 d 1−10 ,4 s 1− 2 (C) [Kr ]4 d 1−10 , 5 s 1− 2 (D) [ Xe ]5 d 1 −10 , 5 s 1 − 2

4. series, the highest B.P. and M.P. is of

(A) Cr (B) V (C) Ni (D) Fe
5. Cuprous ion is colourless while cupric ion is coloured because
(A) Both have half filled p and d-orbitals
(B) Cuprous ion has incomplete d-orbital and cupric ion has a complete d-orbital
(C) Both have unpaired electrons in the d-orbitals
(D) Cuprous ion has a complete d-orbital and cupric ion has an incomplete d-orbital
6. Which is most reactive metal
(A) Fe (B) Pt (C) Ni (D) Co
7. Super alloys are usually
(A) Iron based (B) Nickel based (C) Cobalt based (D) Based on all of these
8. Which of the following ions is paramagnetic
(A) Cu + (B) Zn +2 (C) Ti +3 (D) Ti +4

9. The correct order of magnetic moments (spin only values in B.M.) among is
(A) [Fe (CN )6 ] 4 −  [MnCl 4 ] 2 −  [CoCl 4 ] 2 − (B) [MnCl 4 ] 2 −  [Fe (CN )6 ] 4 −  [CoCl 4 ] 2 −

(C) [MnCl 4 ] 2 −  [CoCl 4 ] 2 −  [Fe (CN )6 ]4 − (D) [Fe (CN )6 ]4 −  [CoCl 4 ] 2 −  [MnCl 4 ] 2 −
(Atomic nos. Mn = 25 , Fe = 26 , Co = 27

10. Potassium permanganate acts as an oxidant in neutral, alkaline as well as acidic media. The final
products obtained from it in the three conditions are, respectively]
(A) MnO 2 , MnO 2 , Mn 2 + (B) MnO 42 − , Mn 3 + , Mn 2 +

(C) MnO 2 , MnO 42 − , Mn 3 + (D) MnO , MnO 4 , Mn 2 +

11. Acidified potassium dichromate is treated with hydrogen sulphide. In the reaction, the oxidation number
of chromium
(A) Increases from + 3 to + 6 (B) Decreases from +6 to +3
(C) Remains unchanged (D) Decreases from +6 to +2
12. Blue vitriol is

9 | | Dr. Arvind Gambheer and Team Bridge course and PU | KCET|IIT-JEE|NEET

 (A) (B) (C) (D)
13. Equivalent weight of acting as an oxidant in acidic medium is equal to
(A) Molecular weight of (B)  Molecular weight of

(C)  Molecular weight of (D)  Molecular weight of

14. Nesseler's reagent is

(A) (B) (C) (D)

15. In the dichromate dianion

(A) 4 Cr − O bonds are equivalent (B) 6 Cr − O bonds are equivalent
(C) All Cr − O bonds are equivalent (D) All Cr −O bonds are non-equivalent
16. Which of the following pairs has the same size?
(A) Zr4+ and Hf4+ (B) Zr4+ and Ti4+ (C) Zn2+ and Hf 4+ (D) Fe2+ and Ni2+
17. The lanthanide contraction relates to
(A) Atomic radii (B) Atomic as well as radii
(C) Valence electrons (D) Oxidation states
18. Which one of the following organisation’s iron and steel plant was built to use charcoal as a source of
power, to start with, but later switched over to hydroelectricity
(A) The Tata Iron and Steel Company (B) The Indian Iron and Steel Company
(C) Mysore Iron and Steel Limited (D) Hindustan Steel Limited
19. Cerium is an important member of the lanthanoids. Which of the following statements about
cerium is incorrect
(A) The +4 oxidation state of cerium is not known in solutions
(B) The +3 oxidation state of cerium is more stable than the +4 oxidation state
(C) The common oxidation states of cerium are +3 and +4
(D) Cerium (IV) acts as an oxidizing agent
20. Most common oxidation states of (cesium) are
(A) + 2, + 3 (B) + 2, + 4 (C) + 3, + 4 (D) + 3, + 5

10 | | Dr. Arvind Gambheer and Team Bridge course and PU | KCET|IIT-JEE|NEET

 Chapter – 5
Co-Ordination Compounds

1. The solution of the complex [Cu(NH3)4]SO4 in water will

(A) give the test of Cu2+ ion (B) give the test of NH3
2−
(C) give the test of SO 4 ions (D) not give the tests of any of the above

2. According to IUPAC nomenclature, sodium nitroprusside is named as

(A) sodium nitro ferricyanide (B) sodium nitro ferrocyanide
(C) sodium pentacyanonitrosy lferrate(II) (D) sodium pentacyanonitrosylferrate(III)
3. Which is incorrectly matched?
Complex Co-ordination number
(A) Cuprammonium sulphate 4
(B) [Co(en)3]3+ 3
(C) [Co(NH3)3Cl3] 6
(D) Ni(CO)4 4
4. The complexes [Co(NH3)6] [Cr(CN)6] and [Cr(NH3)6] [Co(CN)6] are the examples of which type of
isomerism?
(A) Linkage isomerism (B) Ionizaiton isomerism
(C) Co- ordination isomerism (D) Geometrical isomerism
5. The complex [Pt(Py) (NH3) BrCl] will have how many geometrical isomers?
(A) 3 (B) 4 (C) 0 (D) 2
6. 2, 4 dinitrophenyl hydrazine is an example for
(A) Tridenate ligand (B) Monodenate ligand
(C) Polydentate ligand (D) Didentate ligand
7. The complex [Ag(NH3)2] [Ag(CN)2] has the IUPUAC name
(A) Diamminesilver(I) dicyanosilver(I) (B) Diamminesilver(I) dicyanoargentate(I)
(C) Dicyanosilver(I) diammineargentate(I) (D) Diamminesilver(I) dicyanoargentate (II)
8. The complex [PtCl2(en)2]2+ ion shows
(A) structural isomerism (B) optical isomerism only
(C) geometrical and optical isomerism (D) geometrical isomerism only
9. Considering H2O as a weak field ligand, the number of unpaired electrons in [Mn(H2O]62+ will be (At.
No. of Mn = 25)
(A) two (B) three (C) four (D) five
10. What is EAN of nickel in Ni(CO)4?
(A) 38 (B) 30 (C) 36 (D) 32

11 | | Dr. Arvind Gambheer and Team Bridge course and PU | KCET|IIT-JEE|NEET

11. Among the following complexes the one which shows zero crystal field stabilization energy (CFSE) is
(A) [Mn(H2O)63+ (B) [Fe(H2)6]3+ (C) [Co(H2O)6]2+ (D) [Co(H2O)6]3+
12. Which of the following is an outer orbital complex and exhibits paramagnetic character?
(A) [Ni(NH3)6]2+ (B) [Zn(NH3)6]2+j (C) [Cr(NH3)6]3+ (D) [Co(NH3)6]3+
13. Which statement is incorrect?
(A) Ni(CO)4 − tetrahedral, paramagnetic (B) Ni(CN)42− − square planar, diamagnetic
(C) Cu(CN)42− − square planer, paramagnetic (D) NiCl42− − tetrahedral, paramagnetic
14. The expected spin only magnetic moments for [Fe(CN)6]4− and [FeF6]3− are
(A) 1.73 and 1.73 B. M (B) 1.73 and 5.92 B. M (C) 0.0 and 1.73 B. M (D) 0.0 and 5.92 B. M
15. The crystal field stabilization energy (CFSE) is the highest for
(A) [CoF4]2− (B) [Co(NCS) 4] 2− (C) [Co(NH3)6]3+ (D) [CoCl4]2−
16. Which of the following complexes is used as an anticancer agent?
(A) mer-[Co(NH3)3Cl3] (B) cis-[PtCl2(NH3)2]
(C) cis-K2[PtCl2Br2] (D) Na2CoCl4
17. Which off the following is considered to be an anticancer species?
CH2
Cl Cl H3N Cl H3N Cl
Pt Pt Pt Cl CH2
(A) (B) (C) Cl NH3
(D) Pt
Cl Cl H3N Cl
Cl Cl

18. Which of the following biomolecules contain non-transition metal ion?

(A) Vitamin B12 (B) Chlorophyll (C) Haemoglobin (D) Insulin
19. The metal ion present in Insulin is
(A) Zn2+ (B) Cu2+ (C) Mg2+ (D) Fe2+
20. Which of the following organometallic compound is  and −bonded?
(A) [Fe(5 − C5H5)2] (B) [PtCl3 (2 − C2H4)]
(C) [Co(CO)5NH3]2+ (D) Al[CH3)3].

12 | | Dr. Arvind Gambheer and Team Bridge course and PU | KCET|IIT-JEE|NEET

 Chapter - 6
Haloalkanes and Haloarenes

1. The IUPAC name of allyl chloride is

(A) 1-Chloroethane (B) 3-Chloro-1-propyne
(C) 3 − Chloro−1−propene (D) 1− chloro propene
2. For the preparation of n-propyl bromide from n-propyl alcohol which of the following reagent is most
preferred?
(A) P4/ Br2 (B) HBr (C) Br2 (D) NaBr
3. Thinyl chloride is preferred in the preparation of chlorine compounds from alcohols because
(A) The reaction geos to completion
(B) The byproducts beings gases, escape, hence there is no problem of separation of the product
(C) The reagent is cheap
(D) None of the above
4. The hydrocarbon of molecular mass 72 gives a single monochlorides and two dichlorides on treatment
with Cl2/ sunlight. The hydrocarbon, is
(A) Pentane (B) 2-Methylbutane
(C) 2, 2-Dimethylpropane (D) All of the above
5. How many monochlorobutanes will be possible on chlorination of n-butane?
(A) 2 (B) 2 (C) 3 (D) 5
6. When silver propanoate is treated with iodine in CCl4. The main product formed is
(A) Iodoethane (B) Propyl propanoate
(C) Ethyl propanoate (D) I−Iodopropane
7. RCl + NaI ⎯⎯⎯→
Acetone
R − I + NaCl This reaction is known as
(A) Wurtz Reaction (B) Fittig Reason
(C) Frankland Reaction (D) Finkelstein Reaction
8. Identify (C) in the following series
KOH( alc.) KCN( aq.)
C3H 7 I ⎯⎯⎯⎯ →(A) ⎯⎯⎯
NBS

→(B) ⎯⎯⎯⎯ →(C)

(A) (CH3)2CH − CN (B) CH2 = CH − CH2CN

CH2 CH CHCN
(C) Br − CH = CH − CN (D) Br
9. Reaction of C6H5CH2 Br with aqueous sodium hydroxide follows
(A) SN1 mechanism
(B) SN2 mechanism
(C) Any of the above two depending upon the temperature of reaction

13 | | Dr. Arvind Gambheer and Team Bridge course and PU | KCET|IIT-JEE|NEET

 (D) Saytzeff rule
10. Which is the correct increasing order of boiling points of the following compounds?
1-Bromoethane, 1-Bromobutane, 1-Bromobutane, Bromobenzene
(A) Bromobenzene, <1- Bromobutane < 1-Bromopropane < 1-Bromoethane
(B) Bromobenzene < 1-Bromoethane < 1- Bormopropane < 1- Bromobutane
(C) 1-Bromopropane < 1- Bromobutane < 1- Bromoehtane < Bromobenzene
(D) 1- Bromoehtane < 1- Bromopropane < 1- Bromobutane < Bromobenzene
11. What is ‘A’ in the following reaction?
CH2CH CH2

+ HCl A

CH2 CH CH2 CH2 CH2 CH2 Cl

Cl

(A) (B)

Cl
CH CH2 CH3
CH2 CH CH3

Cl
(C) (D)
12. What is ‘A’ in the following reaction?
CH2CH CH2

+ HCl A

CH2 CH CH2 CH2 CH2 CH2 Cl

Cl

(A) (B)

Cl
CH CH2 CH3
CH2 CH CH3

Cl
(C) (D)
13. The reaction :
RX + 2Na + RX ⎯⎯⎯⎯
Dry ether
→ R − R + 2NaX is called
(A) Sandmeyer’s reaction (B) Fitting reaction
(C) Wurtz reaction (D) Williamson’s synthesis
14. In the reaction CH 3CH 2 I ⎯⎯⎯→ X ⎯⎯→ Y ⎯⎯⎯
alc.KoH
→ Z, Z is
Br2 KCN

(A) CH3CH2CN (B) CNCH2CH2CN (C) BrCH2CH2CN (D) BrCH = CHCN

14 | | Dr. Arvind Gambheer and Team Bridge course and PU | KCET|IIT-JEE|NEET

15. The increasing order of hydrolysis of the following compounds is
Br Br Br CH3

CH3 C Br
CH3
(A) (B) (C) (D)

(A) A < D < B < C (B) A < B < D < C (C) D < C < B < A (D) A < B < C < D
16. The correct increasing order of reactivity of halides for reaction SN reaction is
(A) CH3CH2 X < (CH3)2CHX < CH2 = CHCH2X < PhCH2X
(B) (CH3)2CHX < CH3CH2X < CH2 = CHCH2X < PhCH2X
(C) PhCH2X < (CH3)2CHX < CH3CH2X < CH2 = CHCH2X
(D) CH2 = CHCH2 X < PhCH2X < (CH3)2CHX < CH3CH2X
17. The formula of chloral is
(A) CHCl3 (B) CH2ClCHO (C) CCl3CHO (D) CHCl2CHO
18. The raw material s for the commercial manufacture of DDT are
(A) Chlorobenzene and chloroform (B) Chlorobenzene and chloromethane
(C) Chlorobenzene and chloral (D) Chlorobenzene and iodoform
19. Phosgene is the common name for
(A) CO 2 and PH 3 (B) Phosphoryl chloride

(C) Carbonyl chloride (D) Carbon tetrachloride

20. Which compound needs chloral in its synthesis
(A) D. D. T. (B) Gammexane
(C) Carbon tetrachloride (D) Michler’s Ketone

15 | | Dr. Arvind Gambheer and Team Bridge course and PU | KCET|IIT-JEE|NEET

 Chapter - 7
Alcohols phenols and Ethers

1. Which one is primary alcohol

(A) Butene-2-ol (B) Propan-2-ol
(C) Butan-1-ol (D) 2,3-Dimethylhexane-4-ol
2. Alcohol can be obtained by all methods except
(A) C2 H 5 I + H 2 O / OH (B) C2H5NH2/ NaNO2 + HCl

(C) C2H5MgBr/ H2O (D) CH3CHO/NaBH4

H 2 O/ H +
3. For the sequence of reactions A ⎯⎯⎯⎯
→ B ⎯⎯⎯⎯
→ tert − Pentyl alcohol The compound A in the
C2 H5 Mgl
ether

sequence is
(A) 2-Butanone (B) Acetaldehyde (C) Acetone (D) Propanal
4. Which one has highest boiling point?
(A) Butan-2-ol (B) Ethane (C) Butane (D) Pentane
5. Which bond of ethyl alcohol undergoes cleavage during its reaction with sodamide?
(A) C − C (B) C − O (C) C − H (D) O − H
P + I2
6. In the following sequence of reaction CH 3CH 2 OH ⎯⎯⎯ → A ⎯⎯⎯
Mg
ether
→ B ⎯⎯⎯
HCHO
→ C ⎯⎯⎯
H2O
→ D The

compound D is
(A) propanol (B) butanol (C) n-butyl alcohol (D) n-propyl alcohol
7. In the following reaction
CH3
H2O / H+
H3C C CH CH2 A + B
Major Minor
CH3
product product

The major product is

CH3 CH3

CH3 C CH CH2 CH2 C CH2 CH3

(A) (B)
OH CH3 OH CH
CH
33
CH3
H3C C CH CH2
(C) CH3 C CH CH3 (D)
CH3 OH OH
CH3 OH

8. When vapours of isopropyl alcohol is passed over heated copper we get acetone, it is an example for
(A) dehydration (B) dehalogenation
(C) dehydrohalogenation (D) dehydrogenation

16 | | Dr. Arvind Gambheer and Team Bridge course and PU | KCET|IIT-JEE|NEET

9. Dehydration of the following in increasing order of
OH OH

(I) (II)

OH OH

(III) (IV)

(A) I < II < III < IV (B) II < III < IV < I (C) I < III < II < IV (D) I / IV < II = III
10. The appropriate reagent (s) for the transformation
O
CH2CH3
CH3
HO HO

is / are
(A) Zn + Hg, 523 K (B) NH2NH2, OH– (C) Both (A) and (B) (D) NaBH4 or LiAlH4
11. Phenol cannot be obtained by one of the following reactions
OH
COONa
(A) C6 H 5 N 2+ Cl− + H 2 O ⎯⎯⎯⎯
dil.H 2SO 4
→ (B) + NaOH CaO

()
(C) C6 H5Cl + NaOH ⎯⎯⎯⎯ → (D) C6 H 5 MgBr + H 2 O ⎯⎯⎯→
i 633 K Dil.HCl
200 atm
( ii ) Dil.HCl

12. Cumene is the compound used for commercial preparation of phenol. Chemically cumene is
(A) Isopropyl benzene (B) ethylbenzene (C) n-propylbenzene (D) None of above
13. Decarboxylation of sodium salicylate with soda lime forms
(A) Salicylic acid (B) Phenol (C) Benzene (D) None of these
( i ) Na
14. C6 H5 OH ⎯⎯⎯ CCl4
NaOH
→ X ⎯⎯⎯
Zndust
Heat
→ Y ⎯⎯⎯⎯→
(i)Soda lim e
Z in the above sequence Z is

(A) Toluene (B) Cresol (C) Benzene (D) Benzol

15. Grignard reagent is not prepared in a aqueous medium but it is prepared in ether medium, because
(A) the reagent forms complex with water (B) the reagent becomes inactive in water
(C) it is insoluble in water (D) the reagent is highly reactive in water
16. The C − O − C angle in ether is about
(A) 180 (B) 190 − 28 (C) 110 (D) 105

O
17. O C + NO2+ A The product A is

O NO2
NO2
O
O C
(A) O C (B)
NO2

17 | | Dr. Arvind Gambheer and Team Bridge course and PU | KCET|IIT-JEE|NEET

 O
NO2 O
(C) O
(D) O C NO2
O2N C

OCH3

NaNH2/ Liq. ammonia

18. In the reaction A The major product A is

Cl

OCH3
OCH3 OCH3 OCH3

(A) (B) (C) (D) NH2

NH2 Cl
NH2

19. When methyl−t−butyl ether is formed?

(A) (C2H5)3 CONa + CH3Cl (B) CH3ONa + (CH3)3CCl
(C) (CH3)3 CONa + C2H5Cl (D) (CH3)3CONa + CH3Cl
CH3
Heat ..........
CH3 CH CH2 O CH2 CH3+ HI .
20. In the reaction which of the following compounds will be
formed

CH3 CH3
(A) CH CH CH2OH + CH3CH2I
(B) CH3 CH CH2 I + CH3CH2OH
3

CH3 CH CH3 + CH3CO2OH CH3 CH CH2OH + CH3CH3

(C) CH3 (D)
CH3

18 | | Dr. Arvind Gambheer and Team Bridge course and PU | KCET|IIT-JEE|NEET

 Chapter – 7
Aldehydes and ketones and carboxylic acids
1. C6 H 5 + CO + HCl ⎯⎯⎯⎯
Anhy.AlCl3
→ X + HCl Compound X is

(A) C6H5OH3 (B) C6H5CH2Cl (C) C6H5CHO (D) C6H5COOH

2. The treatment of 2-Methyl but-2-ene with or boiling KMnO4 produces
(A) CH3COCH3 + CH3COOH (B) CH3COCH3 + CH3CHO
(C) CH3CHO + CO2 (D) CH3COCH3 only
3. Which of the following carbonyl compound does not form crystalline addition product with NaHSO3?
H H3C H3C C2H5
(A) C O (B) C O (C) C O (D) C O
H H H3C C2H5

4. The change in hybridization which occurs when nucleophilic addition occurs to the carbonyl compound
is
(A) sp to sp2 (B) sp2 to dsp2 (C) sp2 to sp3 (D) sp3 to sp3 d2
5. Aldehydes and ketones can be distinguished by
(A) solubility in water (B) molisch test (C) tollen,s test (D) bromoform
6. In a set of reactions, m-bromo benzoic acid gave a product ‘D’. Identify the product.
COOH Br 2
SOCl2 NH3
[B] [C] [D]
NaOH

Br

SO2NH2 COOH NH2 CONH2

(A) (B) (C) (D)

Br Br

7. Which of the following is the strongest acid?

(A) CF3COOH (B) CBr3COOH (C) CH3COOH (D) CCl3COOH
8. In a set of reactions, acetic acid yields a product [C].
C6H6 C2H5MgBr
CH3COOH + PCl5 [A] [B] [C]
Anhyd. AlCl3 ether

C2H5

CH3 C(OH)C6H5
(A) CH3CH(OH)C2H5 (B) CH3COC6H5 (C) CH3CH(OH) C6H5 (D)
O
C CH3
9. O
AlCl3
+ CH3 C Cl
(A) Aldol condensation (B) Cannizaro’s reaction
(C) Rosenmund’s reduction (D) Stephen’s reaction
10. Aldol condensation between the following compounds followed by dehydration gives methyl vinyl
ketone

19 | | Dr. Arvind Gambheer and Team Bridge course and PU | KCET|IIT-JEE|NEET

 (A) Methanal and ethanal (B) Two mole of formaldehyde
(C) Methanal and propanone (D) Two mole of ethanal
11. In the Cannizzaro’s reaction given below:
−
2Ph − CHO ⎯⎯⎯
OH
→ Ph − CH 2OH + PhCOO − the slowest step is

(A) The attack of OH– at the carbonyl group

(B) The transfer of hydride to the carbonyl group
(C) The abstraction of proton from the carboxylic acid
(D) The deprotonation of Ph – CH2OH
12. Aldol condensation will not take place in
(A) CH3COCH3 (B) CH3CHO (C) HCHO (D) CH3CH2CHO
13. Which one of the following does not turn Schiff’s reagent to pink?
(A) Formaldehyde (B) Acetone (C) Acetaldehyde (D) None of these
14. Predict the product ‘B’ in the sequence of reaction HC  CH ⎯⎯⎯⎯
30%H 2SO4
HgSO 4
→ A ⎯⎯⎯
NaOH
→B

(A) CH3COONa (B) CH3COOH

CH3 CH CH2 CHO

OH
(C) CH3CHO (D)
15. An organic compound ‘A’ has the molecular formula C3H6O, it under goes iodoform test. When
saturated with HCl it gives ‘B’ of molecular formula C9H14O. A and B, respectively are
(A) Propanal and mesitylene
(B) Propanone and mesityl oxide
(C) Propanone and 2, 6-dimethyl-2, 5-heptadien-4-one.
(D) Propanone and mesitylene oxide
LiAlH4 Cu dilute
16. CH3COOH X Y Z
300oC NaOH
In the above reaction Z is
(A) Butanol (B) Aldol (C) Ketol (D) Acetal
17. The reaction of carboxylic acid gives effervescences of CO2 with NaHCO3. The CO2 comes from
(A) R – COOH (B) NaHCO3 (C) Both (A) and (B) (D) None of these
18. Mark the correct order of increasing reactivity
(A) CH3CONH2 < CH3COOC2H5< CH3COCl (B) CH3COOC2H5 < CH3COCl < CH3CONH2
(C) CH3COCl < CH3CONH2 < CH3COOC2H5 (D) CH3COOC2H5 < CH3CONH2 < CH3COCl
19. An organic liquid of the composition C4H8O2 yields a sodium salt of an acid C3H6O2 and methanol on
boiling with NaOH solution. The given liquid is
(A) CH3CH2COOCH3 (B) CH3COOC2H5 (C) HCOOC3H7 (D) CH3CH2CH2COOH
20. In the mechanism of Hoffmann reaction, which intermediate rearranges to alkyl isocyanate?
(A) Bromamide (B) Methane (C) Nitrene (D) Amide

20 | | Dr. Arvind Gambheer and Team Bridge course and PU | KCET|IIT-JEE|NEET

 Chapter – 7
Organic compounds Containing Nitrogen

1. Reduction of Nitroalkanes with Sn/HCl yields

(A) Amine (B) Alcohol (C) Acid (D) Diazo compound
2. R − CH = NOH ⎯⎯⎯
LiAlH 4
→ A . The compound A is
(A) R − CH 2 − NH 2 (B) R − NH 2 (C) R − H (D) NH3

3. In which of the following reaction a primary amine without loss of Carbon is produced
(A) R − CONH 2 + NaOH ⎯⎯→
Br2
(B) R − CONH 2 ⎯⎯⎯
LiAlH 4
→
(C) R − CONH 2 ⎯⎯⎯
NaBH 4
→ (D) R − COOH ⎯⎯⎯
N3 H
→

4. magnesium bromide followed by of subsequent hydrolysis gives:

(A) Propanone (B) Ethanone (C) Ethanal (D) Propanal
5. Gabriel synthesis is used for the preparation of :
(A) 1 amine (B) 2 amine (C) 3 amine (D) All can be prepared
6. Which of the following statement about primary amines is false?
(A) Alklamines are stronger base than aryl amines
(B) Alkylamines react with nitrous acid to produce alcohols
(C) Arylamines react with nitrous acid to produce phenols
(D) Alkylamines ae stronger bases than ammonia

7. In the following compounds the order of basicity is

O
I II III IV
N
N N N
H
H

(A) IV > I > III > II (B) III > I > IV > II (C) II > I > III
' > IV (D) I > III > II > IV
8. If methyl is alkyl group, then which order of basicity is correct
(A) RNH 2  NH 3  R 2 NH  R 3 N (B) R 2 NH  RNH 2  RNH 2  NH 3
(C) R 3 N  R 2 NH  R − NH 2  NH 3 (D) NH 3  RNH 2  R 2 NH  R 3 N

9. The strongest base among the following is

NH2
(A) N (B) N
(C) (D)
N
H

10. The compound C5H13N is optically active and reacts with HNO2 to give an alcohol C5H11OH. Hence the
compound is

21 | | Dr. Arvind Gambheer and Team Bridge course and PU | KCET|IIT-JEE|NEET

 (A) 2−aminopentane (B) N−Methyl butanamine
(C) N, N dimethyl propanamine (D) 1 − amino pentane
11. What is the increasing order of reactivity of the following amines in the above Carbyl amine reaction

NH2 NH2 NH2 NH2

(I) (II) (III) (IV)
NO2 OCH3 Cl

(A) I < II < III < IV (B) II < IV < III < I (C) II < IV < I < III (D) III < I < IV < II
12. .. CN is
X . (X)
NH

..
NH CH 2 CH 2 CN
(A) (B) CH 3 − CH 2 − NH − CH 2 − CH 2 − CN

(C) H 2 N − CH 2 − CH 2 − CN (D) None of these

13. The end product of the reactions is C2 H 5 NH 2 ⎯⎯⎯
HNO2
→ A ⎯⎯⎯
PCl5
→ B ⎯⎯⎯
H.NH 2
→C

(A) Ethyl amine (B) Ethyl cyanide

(C) Methyl amine (D) Acetamide

14. The final product C, is obtained in this reaction

NH2
Ac2O Br2 H2O
A B C Would be
CH3COOH H+

CH3

NH2
NH2 Br COCH3 NHCOCH3
Br Br Br

(A) (B) (C) (D)

CH3
CH3 CH3
CH3

15. Aniline when diazotized in cold and then treated with dimethyl aniline gives a colored product. Its
structure would be

(CH3)2N NH (CH3)2N N N
(A) (B)

CH3NH N N NHCH3 NH2

CH3 N N
(C) (D)
16. Which one of the following is more reactive towards electrophilic reagent?
CH3 CH3 CH3 CH3
(A) (B) (C) OH
(D) NHCOCH3
CH2OH OCH3

22 | | Dr. Arvind Gambheer and Team Bridge course and PU | KCET|IIT-JEE|NEET

17. Nitration of aniline is carried out after acylation because
(A) Acylation deactivates the −NH2 group (B) Oxidation can be prevented
(C) o- and p-products are obtained in good yield (D) All the three
18. The precipitate formed by mixing silver nitrate and sodium chloride disappears on adding ethylamine. It
is due to the formation of
(A) C2H5Cl (B) C2H5NO3 (C) [Ag(C2H5NH2)2]Cl (D) CH3COCl

CH3
NH2
19. ⎯⎯⎯
NaNO 2
HCl
→ A ⎯⎯⎯
CuCN
KCN
→ B ⎯⎯⎯
LiAlH 4
→ C would be
CH3 CH3
CH2 CH3
COOH CH2NH2
CH2 NH2 C H
(A) (B) (C) (D)

20. A compound (X) has the molecular formula C7H7NO. On treatment with Br2 and KOH, (X) gives an
amine (Y); (Y) gives carbylamine test. (Y) upon diazotization and coupling with phenol gives an azodye
(Z). (X) is :
(A) PhCONH2 (B) PhCONHCOCH3 (C) PhNO2 (D) PhCOONH4

23 | | Dr. Arvind Gambheer and Team Bridge course and PU | KCET|IIT-JEE|NEET

 Chapter – 7
Organic compounds Containing Nitrogen

1. Which is correct?
(A) Starch is a polymer of - glucose
(B) Amylose is a component of cellulose
(C) Proteins are composed of only one type of amino acids
(D) In cyclic structure of furanose, there are four carbons and one oxygen atom
2. D(+) – glucose reacts with hydroxyl amine and yields an oxime. The structure of the oxime would be

CH NOH CH NOH

H C OH HO C H

HO C H HO C H
(A) (B)
HO C H H C OH

H C OH H C OH

CH2OH CH2OH

CH NOH CH NOH

C H H C OH
HO
HO C H
(C) H C OH (D)
H C OH
HO C H
H C OH
H C OH
CH2OH
CH2OH

3. The conversion of maltose to glucose is possible by the enzyme

(A) zymase (B) lactase (C) maltase (D) diastase
4. Fructose reduces Tollen’s reagent due to
(A) asymmetric carbons
(B) primary alcoholic group
(C) secondary alcoholic group
(D) enolisation of fructose followed by conversion to aldehyde by base
5.  – D (+) – glucose and  – D(+) – glucose are
(A) Enatiomers (B) Geometrical isomers
(C) Anomers (D) Epimers
6. The calorific value is maximum in case of
(A) Milk (B) Minerals (C) Carbohydrates (D) Proteins
7. Glucose when reduced with HI and red phosphorus gives

24 | | Dr. Arvind Gambheer and Team Bridge course and PU | KCET|IIT-JEE|NEET

 (A) n-hexane (B) n-heptane (C) n-pentane (D) n-octane
8. In the following structure, anomeric carbon is

(A) 1 (B) 2 (C) 3 (D) 4

9. The N-terminal amino acid in the chain – A of insulin is
(A) glycine (B) asparagine (C) phenylalanine (D) threonine
10. Which of the following tests is not used for testing proteins?
(A) Ninhydrin test (B) Millon’s test (C) Molisch test (D) Biuret test
11. Amino acids usually exist in the form of Zwitter ions. This means that it consists of
(A) the basis group –NH2 and the acidic group – COOH
(B) the basic group –NH3+ and the acidic group CO −2

(C) the basic group –CO2– and the acidic group –NH3+
(D) no acidic or basic group
12. The test used for identifying peptide linkage in proteins is
(A) Molisch’s test (B) Ninhydrin test (C) Biuret test (D) Spot test
13. The amino acid which is not optically active is
(A) serine (B) lactic acid (C) glycine (D) alanine

14. In alkaline medium, alanine exists predominantly as/in…..

(A) anion (B) zwitter ion (C) cation (D) covalent form
15. Phospholipids are esters of glycerol with
(A) three carboxylic acid residues
(B) three phosphate groups
(C) two carboxylic acid residues and one phosphate group
(D) one carboxylic acid residue and two phosphate groups
16. Vanspathi is prepared by the …..of vegetable oils
(A) oxidation (B) hydrogenation (C) distillation (D) dehydrogenation
17. Treatment of fats with strong alkali is an example for
(A) dehydrogenation (B) hydrogenation
(C) decarboxylation (D) saponification
18. Waxes are esters of
(A) glycerol and fatty acid (B) long chain alcohols and long chain fatty acids
(C) glycerol (D) long chain alcohols
19. Which of the following is a steroid

25 | | Dr. Arvind Gambheer and Team Bridge course and PU | KCET|IIT-JEE|NEET

 (A) Insulin (B) Vitamins (C) Lipids (D) Estrogen
20. Which of following hormone is produced by testis
(A) Progesterone (B) Estradiol (C) Testosterone (D) Estrone

26 | | Dr. Arvind Gambheer and Team Bridge course and PU | KCET|IIT-JEE|NEET

KCET / NEET crash course
2025

Topic: Diversity in living organisms

1. Select correctly written scientific name of Mango which was first described by Carolus Linnaeus:
(A) Mangifera indica Car. Linn. (C) Mangifera indica Linn.
(B) Mangifera indica (D) Mangifera Indica
2. Which is not the correct hierarchical arrangement?
(A) Class --- Family --- Genus (C) Class --- Order --- Family
(B) Phylum ---- Order --- Family (D) Family --- Class --- Order
3. The most notable diseases caused by prions are
(A) Bovine serum encephalopathy in cattle (C) Creutzfeldt-Jacob disease in Cattle
(B) Creutzfeldt-Jacob disease in humans (D) Both A & B
4. Match the following
Column I Column I
i Morels P Deuteromycetes
ii Smut Q Basidiomysetes
iii Bread mold R Ascomycetes
iv Alternaria S Phycomycetes
(A) i-S, ii-Q, iii-R, iv-P (C) i-Q, ii-R, iii-S, iv-P
(B) i-R, ii-Q, iii-S, iv-P (D) i-P, ii-R, iii-S, iv-Q
5. Select the wrong statements.
(A) Stanley showed that viruses could be crystallized.
(B) The term Contagium vivum fluidum was given by Beijerinck.
(C) Mosaic disease in tobacco & AIDS in humans are caused by viruses.
(D) The viroids were discovered by Ivanowski.
6. Which organisms have silica in their cell wall?
(A) Dinoflagellates (B) Chrysophytes (C) Slime mold (D) Protozoa
7. Specialized cells called heterocysts are present in
(A) Dinoflagellates (B) Chrysophytes (C) Cyanobacteria (D) Archaebacteria
8. Red tides is caused by
(A) Dinoflagellates (B) Chrysophytes (C) Cyanobacteria (D) Archaebacteria
9. Agaricus belongs to
(A) Phycomycetes (B) Ascomycetes (C) Basidiomysetes (D) Deuteromycetes
10. Match the following
Column I Column I
i Chlorophyceae P Floridean starch
ii Phaephyceae Q Starch
iii Rhodophyceae R Laminarin & mannitol
(A) i-P, ii-Q, iii-R (B) i-Q, ii-P, iii-R (C) i-Q, ii-R, iii-P (D) i-Q, ii-P, iii-R
11. Life cycle of Ectocarpus & Fucus are respectively:
(A) Haplontic, Diplontic (C) Haplo-diplontic, Diplontic
(B) Diplontic, Haplo-diplontic (D) Haplo-diplontic, Haplontic
12. Statement A: In Cycas, male cones & megasporophylls are borne on different plants.
Statement B: Cycas forms Coralloid roots.
 (A) Both statements A & B are true (C) Statements A is true & B is false
(B) Both statements A & B are false (D) Statements A is false & B is true
13. Which of the following sponge is called Venus flower basket?
(A) Spongilla (B) Euplectella (C) Ascon (D) Euspongia
14. Bioluminescence is well marked in
(A) Coelenterates (B) Comb jellies (C) Sea urchins (D) Platyhelminthes
15. Malphigian tubules are
(A) Excretory organs in annelids (C) Excretory organs in molluscs
(B) Excretory organs in insects (D) Respiratory organs in insects
16. Assertion: The duck-billed platypus & the spiny ant eater, both are egg-laying animals yet they
are grouped under mammals.
Reason: Both of them have 7 cervical vertebrae & 12 pairs of cranial nerves.
(A) If Assertion and Reason are true and the reason is the correct explanation of the assertion.
(B) If Assertion and Reason are true but Reason is not an explanation to Assertion.
(C) If Assertion is true and Reason is false.
(D) If Assertion and Reason both are false.
17. Which of the following statements is/are incorrect about hemichordate?
Statement A: It was earlier considered as a subphylum of phylum chordata, now it is placed as a
separate phylum under invertebrates.
Statement B: They have a rudimentary structure in the collar region called stomochord, a
structure similar to notochord.
(A) Both statements A & B are true (C) Statements A is true & B is false
(B) Both statements A & B are false (D) Statements A is false & B is true
18. Which of these is not a characteristic feature of Aschelminthes
(A) Presence of pseudocoelom (B) They exhibit sexual dimorphism
(B) Digestive system is incomplete (D) Males are smaller than females
19. Metameric segmentation is the main feature of phylum
(A) Platyhelmithes (B) Annelida (C) Aschelminthes (D) Arthropoda

Latest NEET questions

20. Identify the pair of heterosporous pteridophytes among the following: (NEET 2023)
(A) Selaginella and Salvinia (C) Equisetum and Salvinia
(B) Psilotum and Salvinia (D) Lycopodium and Selaginella
21. Assertion A : The first stage of gametophyte in the life cycle of moss is protonema stage.
Reason R : Protonema develops directly from spores produced in capsule. (NEET 2023)
In the light of the above statements, choose the correct answer from the options given below:
(A) Both A and R are correct and R is the correct explanation of A.
(B) Both A and R are correct but R is NOT the correct explanation of A.
(C) A is correct but R is not correct.
(D) A is not correct but R is correct.
22. Assertion A : In gymnosperms the pollen grains are released from the microsporangium and
carried by air currents. (NEET 2023)
Reason R : Air currents carry the pollen grains to the mouth of the archegonia where the male
gametes are discharged and pollen tube is not formed.
In the light of the above statements, choose the correct answer from the options given below:
(A) Both A and R are correct and R is the correct explanation of A.
(B) Both A and R are correct but R is NOT the correct explanation of A.
(C) A is correct but R is not correct.
(D) A is not correct but R is correct.
23. Select the correct statements with reference to chordates. (NEET 2023)
a. Presence of mid-dorsal, solid and double nerve cord.
b. Presence of closed circulatory system
c. Presence of paired pharyngeal gillslits
d. Presence of dorsal heart
e. Triploblastic pseudocoelomate animals
Choose the correct answer from the options given below:
(A) b and c only (B) b, d and e only (C) c, d and e only (D) a, c and d only
24. The unique mammalian characteristics are: (NEET 2023)
(A) hairs, pinna and mammary glands (C) pinna, monocondylic skull and mammary glands
(B) hairs, pinna and indirect development (D) hairs, tympanic membrane and mammary glands
25. Match List - I with List – II (NEET 2023)
List I List II
a) Taenia i. Nephridia
b) Paramoecium ii. Contractile vacuole
c) Periplaneta iii. Flame cells
d) Pheretima iv. Uricose gland
Choose the correct answer from the options give below :
(A) A-I, B-II, C-IV, D-III (C) A-III, B-II, C-IV, D-I
(B) A-III, B-I, C-IV, D-III (D) A-I, B-II, C-III, D-IV

****
KCET / NEET crash course
2025

Topic: Cell structure & Cell division

1. Which of the following statement with respect to endoplasmic reticulum is incorrect?
(A) SER is devoid of ribosomes (C) SER are the sites of lipid synthesis
(B) In prokaryotes only RER is present (D) RER has ribosomes attached to ER
2. When the centromere is situated in the middle of two equal arms of chromosomes, the
chromosome is referred as :
(A) Metacentric (B) Telocentric (C) Sub-metacentric (D) Acrocentric
3. The concept Omnis-cellula-e-cellula was given by
(A) Rudolf Virchow (B) Leewenhoek (C) Louis Pasteur (D) Robert Koch
4. Aleuroplasts are leucoplasts storing
(A) Lipids (B) Carbohydrates (C) Proteins (D) All
5. What is/are common to both mitochondria and chloroplasts
(A) Both are double membranous organelles (C) Both contain 70S ribosomes
(B) Both contain ds circular chromosomes (D) All
6. Which of the following arrangements of microtubules is correct for eukaryotic flagellum?
(A) 9 peripheral triplets + 2 central singlet (C) 9 peripheral singlet + 2 central doublets
(B) 9 peripheral doublets + 2 central doublets (D) 9 peripheral doublets + 2 central singlet
7. Which of the following differentiate plant cells from animal cells?
(A) Presence of large central vacuole, plastids & cell wall
(B) Presence of plastids & mitochondria
(C) Presence of large cell membrane, plastids & cell wall
(D) Presence of centrioles, plastids & cell wall
8. Phospholipids can assemble into a bilayer because of their
(A) Lack of fatty acids (C) dual solubility properties
(B) Ability to dissolve in water (D) inability to associate with other phospholipids
9. The golgi complex plays a major role
(A) In post translational modification of proteins & glycosylation of lipids
(B) As energy transferring organelles
(C) In trapping light & transforming into chemical energy
(D) In digesting proteins & carbohydrates
10. Tonoplast is the membrane surrounding
(A) Nucleolus (B) Vacuole (C) Chloroplast (D) Nucleus
11. Whi ch of the following statements about inclusion bodies is incorrect?
(A) These are involved in ingestion of food particles.
(B) They lie free in the cytoplasm.
(C) These are present reserve material in cytoplasm.
(D) They are not bound by any membrane
12. Of the total duration of cell cycle, the interphase lasts more than
(A) 50 % (B) 75 % (C) 95 % (D) 25 %
13. Synapsis occurs between
(A) Spindle fibres and centromere (C) mRNA and ribosomes
(B) A male and a female gamete (D) two homologous chromosomes
14. Statement A: Meiosis is also termed as reductional division.
Statement B: Non sister chromatids exchange segments during zygotene.
(A) Both statement A and B are correct. (C) Statement A is correct, B is incorrect
(B) Both statement A and B are incorrect. (D) Statement A is incorrect, B is correct
15. Statement A: Longest phase of meiosis is Prophase I.
Statement B: Crossing over requires an enzyme recombinase.
(A) Both statement A and B are correct. (C) Statement A is correct, B is incorrect
(B) Both statement A and B are incorrect. (D) Statement A is incorrect, B is correct.
16. X ensures the production of Y phase in the life cycle of sexually reproducing organisms whereas
fertilization restores the Z phase.
(A) X-Mitosis, Y- haploid, Z- haploid (C) X-Meiosis, Y- haploid, Z- haploid
(B) X-Mitosis, Y- diploid, Z- haploid (D) X-Meiosis, Y- haploid, Z- diploid
17. In meiosis, the separation of homologous chromosomes is seen during:
(A) Metaphase I (B) Metaphase II (C) Anaphase I (D) Anaphase II
18. The chromosomes appear like string of beads during
(A) Leptotene (B) Zygotene (C) Pachytene (D) Diplotene
19. Chiasma are seen during
(A) Leptotene (B) Zygotene (C) Pachytene (D) Diakinesis
20. Which of the following stage of cell cycle is known as quiescent stage?
(A) G1 phase (B) S phase (C) G2 phase (D) G0 phase

Latest NEET questions

21. The process of appearance of recombination nodules occurs at which sub stage of prophase I in
meiosis? (NEET 2023)
(A) Pachytene (B) Diplotene (C) Diakinesis (D) Zygotene
22. Which of the following stages of meiosis involves division of centromere? (NEET 2023)
(A) Metaphase II (B) Anaphase II (C) Telophase (D) Metaphase I
23. Which of the following are NOT considered as the part of endomembrane system?
a. Mitochondria b. Endoplasmic Reticulum c. Chloroplasts (NEET 2023)
d. Golgi complex e. Peroxisomes
Choose the most appropriate answer from the options given below:
(A) a, c and e only (B) a and d only (C) a, d and e only (D) b and d only
24. Which of the following functions is carried out by cytoskeleton in a cell? (NEET 2023)
(A) Protein synthesis (B) Motility (C) Transportation (D) Nuclear division
25. Select the correct statements. (NEET 2023)
a. Tetrad formation is seen during Leptotene.
b. During Anaphase, the centromeres split and chromatids separate.
c. Terminalization takes place during Pachytene.
d. Nucleolus, Golgi complex and ER are reformed during Telophase.
e. Crossing over takes place between sister chromatids of homologous chromosome.
Choose the correct answer from the options given below:
(1) b and d only (2) a, c and e only (3) b and e only (4) a and c only

****
KCET / NEET crash course
2025

Topic: Biomolecules & Structural organization in animals

1. Match List - I with List - II.
Column A Column B
i Protein p C = C double bonds
ii Unsaturated fatty acid q Phosphodiester bonds
iii Nucleic acid r Glycosidic bonds
iv Polysaccharide s Peptide bonds
(A) i-p, ii-q, iii-r, iv-s (B) i-r, ii-p, iii-q, iv-s (C) i-s, ii-p, iii-q, iv-r (D) i-s, ii-q, iii-r, iv-p
2. Choose the correct match
Column A Column B
i Acidic amino acid p Alanine
ii Aromatic amino acid q Lysine
iii Basic amino acid r Glutamic acid
iv Neutral amino acid s Phenyl alanine
(A) i-p, ii-r, iii-q, iv-s (B) i-p, ii-s, iii-q, iv-r (C) i-r, ii-s, iii-q, iv-p (D) i-r, ii-s, iii-p, iv-q
3. In a polysaccharide, the individual monosaccharides are linked by
(A) Peptide bond (B) Ester bond (C) Phosphodiester bond (D) Glycosidic bond
4. An organic substance bound to an enzyme and essential for its activity is called
(A) Holoenzyme (B) Apoenzyme (C) Coenzyme (D) Isoenzyme
5. Statement A: Collagen is the most abundant protein in animal world.
Statement B: Ribulose bisphosphate Carboxylase-Oxygenase (RuBisCO) is the most abundant
protein in the whole of the biosphere
(A) Both statement A and B are correct. (C) Statement A is correct, B is incorrect
(B) Both statement A and B are incorrect. (D) Statement A is incorrect, B is correct.
6. Statement A: Inulin is a polymer of fructose.
Statement B: Cellulose is a homopolymer.
(A) Both statement A and B are correct. (C) Statement A is correct, B is incorrect
(B) Both statement A and B are incorrect. (D) Statement A is incorrect, B is correct.
7. Which of these act as a cofactor for the enzyme carboxypeptidase
(A) Mo (B) Zn (C) Mg (D) Haem
8. Which enables glucose transport into cells?
(A) GLUT – 1 (B) GLUT – 2 (C) GLUT – 3 (D) GLUT – 4
9. Enzymes speed up the rate of reaction by
(A) Combining with product (B) Lowering activation energy
(C) Forming reactant - product complex (D) Changing equilibrium of the reaction
10. The inhibitor which inhibits the enzyme activity by binding to the active site of enzyme due the
close resemblance to the substrate in its molecular structure is called
(A) Non-competitive inhibitor (C) Competitive inhibitor
(B) Allosteric modulator (D) Feedback inhibitor
11. Cloacal aperture of frog is used to pass out
(A) Sperm (B) faeces (C) urine (D) all of these.
12. On land, the respiratory organs (s) of frog is/are
(A) Skin (cutaneous respiration) (C) Lungs and buccal cavity
(B) Skin, lungs (pulmonary respiration) and buccal cavity (D) Skin and buccal cavity
13. In frogs, sexual dimorphism is shown by
(A) Presence of sound producing vocal sacs in male frogs which are absent in female frogs.
(B) Male frogs have a copulatory pad on the first digit of the hind limbs which are absent in
female frogs.
(C) Both A and B.
(D) None of the above.
14. Statement I: In male frogs, the ureters act as urinogenital duct which opens into the cloaca.
Statement II: In females the ureters and oviduct open separately in the cloaca.
(A) Both statement I and Statement II are true. (C) Statement I is true but Statement II is false.
(B) Both statement I and Statement II are false. (D) Statement I is false but Statement II is true.
15. The nervous system of frog is organised into
(A) Central nervous system and peripheral nervous system
(B) Central nervous system and autonomic nervous system
(C) Central nervous system, peripheral nervous system and autonomic nervous system
(D) Brain and spinal cord

Latest NEET questions

16. Cellulose does not form blue colour with Iodine because (NEET 2023)
(A) It is a helical molecule.
(B) It does not contain complex helices and hence cannot hold iodine molecules.
(C) It breakes down when iodine reacts with it.
(D) It is a disaccharide.
17. Melonate inhibits the growth of pathogenic bacteria by inhibiting the activity of (NEET 2023)
(A) Amylase (B) Lipase (C) Dinitrogenase (D) Succinic dehydrogenase
18. Given below are two statements: (NEET 2023)
Statement I : A protein is imagined as a line, the left end represented by first amino acid (C-
terminal) and the right end represented by last amino acid (N-terminal).
Statement II : Adult human haemoglobin, consists of 4 subunits (two subunits of α type and two
subunits β type.)
In the light of the above statements, choose the correct answer from the options given below :
(A) Both statement I and Statement II are true. (C) Statement I is true but Statement II is false.
(B) Both statement I and Statement II are false. (D) Statement I is false but Statement II is true.
19. Primary proteins are also called as polypeptides because : (NEET 2022)
(A) They can assume many conformations (C) They are polymers of peptide monomers
(B) Successive amino acids are joined by peptide bonds (D) They are linear chains
20. Read the following statements on lipids and find out the correct set of statements. (NEET 2022)
(a) Lecithin found in the plasma membrane is a glycolipid.
(b) Saturated fatty acids possess one or more C=C bonds
(c) Gingelly oil has a lower melting point, hence remain as oil in winter
(d) Lipids are generally insoluble in water but are soluble in some organic solvents
(e) When fatty acid is esterifed with glycerol, monoglyceride is formed.
Choose the correct answer from the following
(A) (a) (d) & (e) only (C) (a) (b) & (d) only
(B) (c) (d) & (e) only (D) (a) (b) & (c) only
*****
KCET / NEET crash course
2025

Topics: Morphology of flowering plants & Anatomy of flowering plants

1. Statement A: A typical leaf consists of three main parts: leaf base, petiole & leaf lamina.
Statement B: In some leguminous plants the leaf base may become swollen, which is called the
pulvinus.
(A) Both statement A and B are correct. (C) Statement A is correct, B is incorrect
(B) Both statement A and B are incorrect. (D) Statement A is incorrect, B is correct.
2. Statement A: Whorled phyllotaxy is seen in case of Alstonia.
Statement B: Opposite phyllotaxy is seen in case of China rose.
(A) Both statement A and B are correct. (C) Statement A is correct, B is incorrect
(B) Both statement A and B are incorrect. (D) Statement A is incorrect, B is correct.
3. Fill in the blanks:
I. In racemose type of inflorescence, the flowers are arranged in ____p______ succession.
II. In cymose type of inflorescence, the flowers are arranged in ______q____ succession.
(A) p - acropetalous, q - basipetalous (C) p - acropetalous, q - acropetalous
(B) p - basipetalous, q - acropetalous (D) p - basipetalous, q - basipetalous
4. In floral formula (K) denotes
(A) Polypetalous (B) Polysepalous (C) Gamopetalous (C) Gamosepalous
5. Individual components of perianth are called
(A) Sepals (B) Tepals (C) Stipules (D) Bracts
6. Perigynous flowers are found in
(A) China rose (B) Rose (C) Guava (D) Cucumber
7. The fleshy fruits with hard & stony endocarp are called
(A) Drupe (B) Berry (C) Pome (D) Hesperidium
8. Identify the type of petals in the given diagram (A, B and C).
(A) A-Wings, B-Keel, C-Standard
(B) A-Keel, B-Wings, C-Standard
(C) A-Standard, B-Wings, C-Keel
(D) A-Standard, B-Keel, C-Wings
9. Name the type of aestivation when sepals or petals in a whorl
just touch one another at the margin without overlapping.
(A) Twisted aestivation (B) Valvate aestivation
(C) Imbricate aestivation (D) Vexillary aestivation
10. Diadelphous stamens are found in:
(A) China rose (B) Citrus (C) Pea (D) China rose and citrus
11. Polyarch & exarch vascular bundles are the characteristics of
(A) Monocot root (B) Dicot root (C) Monocot stem (D) Dicot stem
12. Mesophyll is differentiated into palisade & spongy tissues in
(A) Monocot leaves (B) Dicot leaves (C) Hydrophytic leaves (D) All of these
13. Vascular bundles occur in a leaf in
(A) Entire lamina (B) Leaf margin (C) Veins & veinlets (D) All of these
14. Cell wall of sclerenchyma cells have large percentage of
(A) Pectin (B) Cellulose (C) Hemicellulose (D) Lignin
15. In monocot stem, the vascular bundles are
(A) Conjoint & open (C) Scattered throughout the ground tissue
(B) Conjoint & closed (D) Both B & C
16. U shaped casparian thickenings are present in
(A) Endodermis of dicot (C) Endodermis of monocot
(B) Epidermis of dicot (D) Epidermis of monocot
17. Which of these are true about monocot stem
(A) Atactostele arrangement of vascular bundles (C) Presence of 2 metaxylem & 1 protophloem
(B) Presence of Lysigenous cavity (D) All of the above
18. Eustele arrangement is seen in
(A) Dicot root (B) Monocot root (C) Dicot stem (D) Monocot stem
19. In monocot stem, the hypodermis is
(A) parenchymatous (B) sclerenchymatous (C) collenchymatous (D) meristematic
20. Bulliform cells takes part in
(A) Guttation (B) Transpiration (C) Inrolling (D) All of these

Latest NEET questions

21. Axile placentation is observed in (NEET 2023)

(A) China rose, Beans and Lupin (C) China rose, Petunia and Lemon
(B) Tomato, Dianthus and Pea (D) Mustard, Cucumber and Primrose
22. Given below are two statements: (NEET 2023)
Statement I : Endarch and exarch are the terms often used for describing the position of
secondary xylem in the plant body.
Statement II : Exarch condition is the most common feature of the root system.
In the light of the above statements, choose the correct answer from the options given below;
(A) Both statement I and II are correct. (C) Statement I is correct, II is incorrect
(B) Both statement I and II are incorrect. (D) Statement I is incorrect, II is correct.
23. The flowers are zygomorphic in (NEET 2022)
(a) Mustard (b) Gulmohar (c) Cassia (d) Datura (e) Chilly
Choose the correct answer from the options given below.
(A) b & c only (B) d & e only (C) c, d & e only (D) a, b & c only
24. Which of the following plants show vexillary aestivation & diadelphous stamens (NEET 2022)
(A) Pisum sativum (B) Allium cepa (C) Solanum nigrum (D) Colchicum autumnale
25. Match the following (NEET 2021)
Column A Column B
i Cells with active cell division capacity p Vascular tissues
ii Tissue having all cells similar in structure & function q Meristematic tissue
iii Tissue having different types of cells r Sclereids
iv Dead cells with highly thickened walls & narrow lumen s Simple tissue
(A) i-p, ii-q, iii-r, iv-s (B) i-q, ii-p, iii-r, iv-s (C) i-r, ii-q, iii-p, iv-s (D) i-q, ii-s, iii-p, iv-r

****
KCET / NEET crash course
2025

Topic: Respiration in plants , Photosynthesis and Plant growth & development

1. Acceptor of Acetyl CoA in Kreb’s cycle is
(A) Citric acid (B) Succinic acid (C) Oxaloacetic acid (D) Malic acid
2. Statement A: Glycolysis takes place in cytoplasm.
Statement B: The net ATP gain in glycolysis is 8 ATPs.
(A) Both statements A and B are true (C) Statement A is true, Statement B is false
(B) Both statements A & B are false (D) Statement B is true, Statement A is false
3. Point out the correct sequence of intermediate organic acid occurring during Krebs cycle,
(A) Citrate  isocitrate  Alpha ketoglutarate  Succinate  Fumarate
(B) Isocitrate  Citrate  Alpha ketoglutarate  Fumarate  Succinate
(C) Alpha-ketoglutarate  Succinate  Citrate  Isocitrate  Fumarate
(D) Succinate  Fumarate  Isocitrate  Alpha-ketoglutarate  Citrate
4. Production of acetyl CoA from pyruvate
(A) Takes place in cytosol (C) takes place in inner membrane of mitochondria
(B) Takes place in mitochondrial matrix (D) takes place in endoplasmic reticulum
5. Which of the following is complex V of the electron transport system of inner mitochondrial
membrane?
(A) cytochrome bc1 complex (C) NADH dehydrogenase
(B) cytochrome oxidase complex (D) ATP synthase
6. Which of the following biomolecules is common to respiration-mediated breakdown of fats,
carbohydrates and proteins?
(A) Pyruvic acid (B) Acetyl CoA (C) Glucose-6-phosphate (D) Fructose 1,6-bisphosphate
7. Which of the following statements is incorrect?
(A) During aerobic respiration, role of oxygen is limited to the terminal stage.
(B) In ETC (Electron Transport Chain), one molecule of NADH + H+ gives rise to 2 ATP molecules,
and one FADH2 gives rise to 3 ATP molecules.
(C) ATP is synthesized through complex V.
(D) Oxidation-reduction reactions produce proton gradient in respiration
8. Respiratiory Quotient (RQ) value of tripalmitin is
(A) 0.9 (B) 0.7 (C) 0.07 (D) 0.09
9. RuBisCO is the most abundant enzyme in the world and present in very high concentration in
chloroplasts. It is required in very high concentration for Photosynthesis because it
(A) is a very slow acting enzyme (C) also acts as an oxygenase
(B) catalyzes a reversible reaction (D) is degraded very rapidly
10. Chloroplast dimorphism is a characteristic feature of
(A) plants with Calvin cycle (C) C4 plants
(B) all plants (D) only in algae
11. The reaction centre in PS II has an absorption maxima at
(A) 700 nm (B) 660 nm (C) 780 nm (D) 680 nm
12. Electrons passed out by PS II are replaced from
(A) H2O (B) O2 (C) CO2 (D) None of the above
13. Photosynthetically active radiation represents which of the following range of wavelength?
(A) 450-950nm (B) 400-700nm (C) 500-600nm (D) 350-450nm
14. Statement I : The primary CO2 aceptor in C4 plants is phosphoenolpyruvate and is found in the
mesophyll cells.
Statement II : Mesophyll cells of C4 plants lack RuBisCO enzyme.
In the light of the above statements, choose the correct answer from the options given below.
(A) Both I and II are correct (C) I is correct, II is incorrect
(B) Both I and II are incorrect (D) II is correct, I is the incorrect
15. Match the following
Column I Column II
(A) A-s, B-q, C-r, D- p
A Blackmann p C3 cycle
(B) A-r, B-s, C-q, D-t
B Melvin Calvin q Red drop experiment
C Emerson r C4 cycle (C) A-t, B-q, C-p, D-r
D Hatch & Slack s Non-cyclic photophosphorylation (D) A-t, B-p, C-q, D-r
t Law of limiting factors
16. Photorespiration in C3 plants begins from
(A) glycerate (B) phosphoglycolate (C) phosphoglycerate (D) glycine
17. Plant growth hormones extracted from a fungus & a fish are respectively
(A) Gibberellin & Zeatin (C) Ethylene & cytokinin
(B) Auxin & 2,4-D (D) Gibberellin & Kinetin
18. Movement of auxin is
(A) Centripetal (B) Basipetal (C) Acropetal (D) Both B & C
19. Production of Cucumber has increased manifold in recent years. Application of which of the
following phytohormones has resulted in this increased yield as the hormone is known to
produce female flowers in the plants
(A) Cytokinin (B) ABA (C) Gibberellin (D) Ethylene
20. Which one of the following plants does not show plasticity?
(A) Maize (B) Cotton (C) Coriander (D) Buttercup

Latest NEET questions

21. How many ATP and NADPH2 are required for the synthesis of one molecule of Glucose during
Calvin cycle? (NEET 2023)
(A) 18 ATP and 12 NADPH2 (C) 18 ATP and 16 NADPH2
(B) 12 ATP and 16 NADPH2 (D) 12 ATP and 12 NADPH2
22. Spraying of which of the following phytohormone on juvenile conifers helps in hastening the
maturity period, that leads to early seed production? (NEET 2023)
(A) Gibberellic Acid (B) Zeatin (C) Abscisic Acid (D) Indole-3-butyric Acid
23. Which micronutrient is required for splitting of water molecule during photosynthesis?
(A) molybdenum (B) magnesium (C) copper (D) manganese (NEET 2023)
24. Which hormone promotes internode/petiole elongation in deep water rice? (NEET 2023)
(A) Kinetin (B) Ethylene (C) 2, 4–D (D) GA3
25. Assertion A : ATP is used at two steps in glycolysis. (NEET 2023)
Reason R : First ATP is used in converting glucose into glucose-6-phosphate and second ATP is
used in conversion of fructose-6-phosphate into fructose-1-6-diphosphate.
(A) Both A and R are correct and R is the correct explanation of A.
(B) Both A and R are correct but R is NOT the correct explanation of A.
(C) A is correct but R is not correct.
(D) A is not correct but R is correct.
*****
KCET / NEET crash course
2025

Topic: Breathing & exchange of gases and Body fluids & circulation
1. In humans, exchange of gases occurs
(A) By diffusion (C) between alveoli & pulmonary blood capillary
(B) Between blood & tissue (D) all of these
2. Which portion of the human respiratory system is called sound box?
(A) Nasopharynx (B) Glottis (C) Larynx (D) Trachea
3. At which thoracic vertebrae does trachea divide into right & left pulmonary bronchi?
(A) 5th (B) 6th (C) 9th (D) 4th
4. Select the correct pair of muscles involved in the normal breathing in humans.
(A) External & internal intercostal muscles (C) Diaphragm & internal intercostal muscles
(B) Diaphragm & external intercostal muscles (D) Diaphragm & abdominal muscles
5. Which of the following statements are true?
(A) 70 % of it is carried as bicarbonate
(B) 20-25 % of CO2 is transported by RBCs
(C) About 7 % of CO2 is carried in a dissolved state through plasma
(D) All of these
6. Select the favourable conditions required for the formation of oxyhaemoglobin at the alveoli.
(A) High pO2, low pCO2, less H+, lower temperature (NEET 2021)
(B) Low pO2, high pCO2, more H+, higher temperature
(C) High pO2, high pCO2, less H+, higher temperature
(D) Low pO2, low pCO2, more H+, higher temperature
7. The partial pressure of CO2 (pCO2) is the highest in
(A) Trachea (B) alveoli (C) tissues (D) bronchi
8. How many molecules of oxygen are carried by one molecule of haemoglobin?
(A) 6 (B) 8 (C) 2 (D) 4
9. One of the major cause of emphysema is
(A) Smog (B) Pollution (C) Cigarette smoking (D) Allergy
10. Blood analysis of a patient reveals an unusually high quantity of carboxyhaemoglobin content.
Which of the following conclusions is most likely to be correct? The patient has been inhaling
polluted air containing unusually high content of
(A) Carbon disulphide (B) chloroform (C) carbon dioxide (D) carbon monoxide.
11. The first heart sound is
(A) Lub sound during closure of semi-lunar valves
(B) Dub sound during closure of semi-lunar valves
(C) Lub sound during closure of atrio-ventricular valves
(D) Dub sound during closure of atrio-ventricular valves
12. Bicuspid valve is found between
(A) right atrium and right ventricle (C) left atrium and left ventricle
(B) right and left ventricle (D) left ventricle and aorta.
13. Continuous bleeding from an injured part of body is due to deficiency of
(A) Vitamin-A (B) Vitamin-B (C) Vitamin-K (D) Vitamin-E
14. Bundle of His is a network of
 (A) Nerve fibres distributed in ventricles (C) Muscle fibres distributed throughout the heart walls
(B) Nerve fibres found throughout the heart (D) Muscle fibres found only in the ventricle wall
15. Circulatory system does not help in
(A) Transport of hormones (B) Transport of gases (C) Transport of nutrients (D) Passage of impulses
16. Which would be the heart rate of a person if the cardiac output is 5L, blood volume in the
ventricles at the end of diastole is 100 mL and at the end of ventricular systole is 50 mL?
(A) 50 beats per min (B) 75 beats per min (C) 100 beats per min (D) 125 beats per min
17. Foramen ovale
(A) Connects the two atria in the foetal heart
(B) Connects pulmonary trunk & aorta in foetal heart
(C) Is a shallow depression in the inter-ventricular septum
(D) Is condition in which heart valves do not completely close
18. Statement A: Arteries & veins are made up of three layers: Tunica externa, tunica media &
tunica intima
Statement B: The tunica media is comparatively thin in the veins than in arteries.
(A) Both statement A and B are correct (C) Statement A is correct, B is incorrect
(B) Both statement A and B are incorrect (D) Statement A is incorrect, B is correct
19. A healthy individual has ___ gms of haemoglobin in every 100 ml of blood.
(A) 50 - 55 gm (B) 12 – 16 gm (C) 5 – 6 gm (D) 70 – 80 gm
20. Arrange the following formed elements in the decreasing order of their abundance in blood in
humans: (a) Platelets (b) Neutrophils (c) Erythrocytes (d) Eosinophils (e) Monocytes
Choose the most appropriate answer from the options given below:
(A) (c), (a), (b), (e), (d) (B) (d), (e), (b), (a), (c) (C) (c), (b), (a), (e), (d) (D) (a), (c), (b), (d), (e)

Latest NEET questions

21. Match List - I with List - II. (NEET 2023)

Column A Column B
i P - wave p Beginning of systole
ii Q - wave q Repolarisation of ventricles
iii QRS complex r Depolarisation of atria
iv T - wave s Depolarisation of ventricles
(A) i-p, ii-q, iii-r, iv-s (B) i-r, ii-p, iii-q, iv-s (C) i-s, ii-p, iii-q, iv-r (D) i-r, ii-p, iii-s, iv-q
22. Vital capacity of lung is______. (NEET 2023)
(A) IRV + ERV + TV + RV (B) IRV + ERV + TV – RV (C) IRV + ERV + TV (D) IRV + ERV
23. Under normal physiological conditions in human being every 100 ml of oxygenated blood can
deliver _____ ml of O2 to the tissues. (NEET 2022)
(A) 10 ml (B) 2 ml (C) 5 ml (D) 4 ml
24. Which of the following statements is correct? (NEET 2022)
(A) The tricuspid & bicuspid valves open due to pressure exerted by simultaneous contraction of
atria
(B) blood moves freely from atrium to ventricle during joint diastole
(C) Increased ventricular pressure causes closing of the semilunar valves
(D) Increased ventricular pressure causes closing of the semilunar valves
25. The partial pressures (in mm Hg) of oxygen (O2) and carbon dioxide (CO2) at alveoli (the site of
diffusion) are (NEET 2021)
(A) pO2 = 104 and pCO2 = 40 (C) pO2 = 95 and pCO2 = 40
(B) pO2 = 40 and pCO2 = 45 (D) pO2 = 159 and pCO2 = 0.3
KCET / NEET crash course
2025

Topic: Excretion & locomotion

1. In medullary nephrons,
(A) Loop of Henle is short (C) The PCT is very long
(B) loop of Henle is long (D) the DCT is short
2. Length, width and thickness of the adult human kidney are approximately
(A) 12-16 cm, 10-12 cm and 4-6 cm respectively (C) 10-12 cm, 2-3 cm and 5-7 cm respectively
(B) 10-12 cm, 5-7 cm and 2-3 cm respectively (D) 12-16 cm, 5-7 cm and 2-3 cm respectively
3. Many collecting ducts converge and through medullary pyramids in the calyces open into the
(A) Renal pelvis (B) Columns of Bertini (C) Collecting duct (D) Malpighian corpuscle
4. The amount of urine released by a normal man per day is
(A) 1-5 gm (B) 12-20 gm (C) 1-1.5 litres (D) 80 gm
5. Which part of nephron is impermeable to water? (AIIMS 15)
(A) Proximal convoluted tubule (C) Ascending loop of Henle
(B) Distal convoluted tubule (D) Descending loop of Henle
6. Angiotensin-II stimulates
(A) Vasoconstriction (C) Vasodilation (AIPMT 15)
(B) Adrenal cortex to release glucocorticoids (D) The secretion of ADH
7. Kidney functioning is efficiently monitored and regulated by hormonal feedback mechanisms.
Which of the following is/are involved in it?
a. Heart b. Hypothalamus c. Juxta glomerular apparatus
(A) only a (B) only a and b (C) only a and c (D) a, b and c
8. Which of the following statements is/are true?
a. ANF can cause dilation of blood vessels and thus, increase the blood pressure.
b. Presence of Glycosuria and Ketonuria in urine are indicative of diabetes mellitus.
(A) Only a (B) Only a and b (C) Only b (D) both are false
9. Podocytes are present on the
(A) Endothelial cells of glomerulus (C) Epithelial cells of glomerulus
(B) Endothelial cells of Bowman’s capsule (D) Epithelial cells of Bowman’s capsule
10. Renal calculi is
(A) Soluble mass of crystallized salts in kidney (C) Insoluble mass of proteins in kidney
(B) Soluble mass of proteins in kidney (D) Insoluble mass of crystallized salts in kidney
11. Which one of the following statements is incorrect?
(A) Heart muscles are striated and involuntary
(B) The muscles of hands and legs are striated and voluntary
(C) The muscles located in the inner walls of alimentary canal are striated and involuntary
(D) Muscles located in the reproductive tracts are unstriated and involuntary
12. Which muscle band remains unchanged during the contraction & relaxation of skeletal muscle?
(A) I (B) H (C) A (D) E
13. The globular head of heavy meromyosin is an active ATPase enzyme and has
a. ATP binding sites b. Actin binding sites c. Myosin binding sites
d. Troponin binding sites e. Calcium binding sites
(A) a and b (B) a and c (C) a, c and d (D) a, c and e
14. Action potential in sarcolemma of muscles causes the release of
(A) Na2+ (B) Ca2+ (C) Cl- (D) Mg2+
15. Statement A: Contraction of muscles takes place by the sliding of thin filament over thick filament.
Statement B: In the centre of each I-band there is an elastic fibre called Z line.
(A) Both statement A and B are correct (C) Statement A is correct, B is incorrect
(B) Both statement A and B are incorrect (D) Statement A is incorrect, B is correct
16. The store house of calcium ions in the muscle fibre is
(A) Golgi body (B) Lysosomes (C) Nucleus (D) Sarcoplasmic reticulum
17. Neural canal is
(A) Solid portion of vertebrae through which the spinal cord passes (C) Both A & B
(B) Hollow portion of vertebrae through which the spinal cord passes (D) None of these
18. Statement A: The first vertebrae in human is called axis.
Statement B: The second vertebrae in human is called atlas.
(A) Both statement A and B are correct (C) Statement A is correct, B is incorrect
(B) Both statement A and B are incorrect (D) Statement A is incorrect, B is correct
19. Cartilaginous joints in humans
(A) Permit no movement (B) Permit little movement (C) Permit any movement (D) All of these
20. The correct sequential order of vertebrae in the vertebral column of humans is
(A) Cervical Lumbar Thoracic Coccygeal Sacrum
(B) Cervical Thoracic Lumbar Coccygeal Sacrum
(C) Cervical Lumbar Thoracic Sacrum Coccygeal
(D) Cervical Thoracic Lumbar Sacrum Coccygeal

Latest NEET questions

21. Match List - I with List - II. (NEET 2023)

Column A (Type of Joint) Column B (Found between)
i Cartilaginous Joint p Between flat skull bones
ii Ball and Socket Joint q Between adjacent vertebrae in vertebral column
iii Fibrous Joint r Between carpal and metacarpal of thumb
iv Saddle Joint s Between Humerus and Pectoral girdle
(A) i-p, ii-q, iii-r, iv-s (B) i-q, ii-s, iii-p, iv-r (C) i-s, ii-p, iii-q, iv-r (D) i-q, ii-p, iii-s, iv-r
22. Which of the following statements are correct regarding skeletal muscle? (NEET 2023)
a. Muscle bundles are held together by collagenous connective tissue layer called fascicle.
b. Sarcoplasmic reticulum of muscle fibre is a store house of calcium ions.
c. Striated appearance of skeletal muscle fibre is due to distribution pattern of actin and myosin
proteins.
d. M line is considered as functional unit of contraction called sarcomere.
Choose the most appropriate answer from the options given below:
(A) b and c only (B) a, c and d only (C) c and d only (D) a, b and c only
23. Assertion A : Nephrons are of two types : Cortical & Juxta medullary, based on their relative
position in cortex and medulla. (NEET 2023)
Reason R : Juxta medullary nephrons have short loop of Henle whereas, cortical nephrons have
longer loop of Henle.
In the light of the above statements, choose the correct answer from the options given below:
(A) Both A and R are true but R is NOT the correct explanation of A.
(B) A is true but R is false.
(C) A is false but R is true.
(D) Both A and R are true and R is the correct explanation of A.
24. Select the correct statements. (NEET 2022)
(a) Angiotensin II activates the cortex of adrenal gland to release aldosterone.
(b) Aldosterone leads to increase in blood pressure.
(c) ANF acts as a check on renin-angiotensin mechanism.
(d) ADH causes vasodilation.
(e) Vasopressin is released from adenohypophysis.
Choose the most appropriate answer from the options given below:
(A) (a), (b) and (e) only (C) (b), (c) and (d) only
(B) (c), (d) and (e) only (D) (a), (b) and (c) only
25. Which of the following is correct match for disease and its symptoms? (NEET 2022)
(A) Muscular dystrophy – An auto immune disorder causing progressive degeneration of
skeletal muscle
(B) Myasthenia gravis – Genetic disorder resulting in weakening and paralysis of skelatal muscle
(C) Arthritis– Inflammed joints
(D) Tetany - high Ca2+ level causing rapid spasms

*****
KCET / NEET crash course
2025

Topic: Neural control & coordination and Chemical coordination & integration
1. Which of the following is a neuroglial cell?
(A) Astrocytes (B) Oligodendrocytes (C) Microglia (D) All of these
2. For the maintenance of ionic gradients across the resting membrane, the sodium-potassium
pump transports
(A) 3Na+ outwards for 2K+ into the cell (C) 2Na+ outwards for 2K+ into the cell
+ +
(B) 3Na inwards for 2K out the cell (D) 2Na+ inwards for 2K+ out the cell
3. Statement A: Myelinated nerve fibres are found in spinal and cranial nerves.
Statement B: Unmyelinated nerve fibres are commonly found in autonomous and the somatic
neural systems.
(A) Both statement A and B are correct (C) Statement A is correct, B is incorrect
(B) Both statement A and B are incorrect (D) Statement A is incorrect, B is correct
4. Select the correct sequence of meninges from outer to inner side.
(A) Duramater  Piamater  Arachnoid (C) Piamater  Arachnoid  Duramater
(B) Duramater  Arachnoid  Piamater (D) Piamater  Duramater  Arachnoid
5. Statement A: A synapse is formed by the membranes of a pre-synaptic neuron and a post-synaptic
neuron, which may or may not be separated by a gap called synaptic cleft.
Statement B: There are two types of synapses: electrical synapses & chemical synapses.
(A) Both statement A and B are correct (C) Statement A is correct, B is incorrect
(B) Both statement A and B are incorrect (D) Statement A is incorrect, B is correct
6. Which part of the brain is responsible for thermoregulation?
(A) Cerebrum (B) Hypothalamus (C) Corpus callosum (D) Medulla oblongata
7. A gymnast is able to balance his body upside down even in the total darkness because of
(A) Tectorial membrane (B) Organ of corti (C) Cochlea (D) Vestibular apparatus
8. Which one ofthe following statements is not correct?
(A) Rhodopsin is the purplish red protein presents in rods only.
(B) Retinal is the light absorbing portion of visual photo pigments
(C) In retina the rods have the photopigment rhodopsin while cones have three different
photopigments.
(D) Retinal is a derivative of Vitamin C.
9. In mammalian eye, the fovea' is the center of the visual field, where
(A) The optic nerve leaves the eye (C) More rods than cones are found
(B) Only rods are present (D) High density of cones occur, but has no rods
10. Statement A: The cerebral cortex is referred to as grey matter of the brain.
Statement B: It is due to the high concentrations of neuronal axons in it.
(A) Both statement A and B are correct (C) Statement A is correct, B is incorrect
(B) Both statement A and B are incorrect (D) Statement A is incorrect, B is correct
11. Deficiency of thyroxine in adults will cause
(A) myxedema (B) cretinism (C) both (A) and (B) (D) exophthalmic goiter
12. The pineal gland secretes
(A) Vasopressin (B) Melanin (C) Melatonin (D) MSH
13. Select the correct statement.
(A) Glucagon is associated with hypoglycemia (C) Insulin acts on pancreatic cells and adipocytes
(B) Insulin is associated with hyperglycemia (D) Glucocorticoids stimulate gluconeogenesis
14. Flight or fight reactions cause activation of
(A) The kidney, leading to suppression of renin-angiotensin-aldosterone pathway
(B) The pancreas leading to a reduction in blood glucose level
(C) The adrenal medulla, leading to increased secretion of epinephrine & norepinephrine
(D) The parathyroid glands leading to increased metabolic rate
15. Ca2+ level is maintained by
(A) PTH (B) TCT (C) Thymosin (D) Both A & B
16. Hyposecrection of corticoids leads to
(A) Addison’s disease (C) Diabetes mellitus
(B) Cushing’s disease (D) Diabetes insipidus
17. Steroid hormones typically alters the activity of target cells by
(A) Activating primary messenger (C) interacting with intracellular receptors
(B) Activating secondary messenger (D) all of these
18. Chemical nature of hormones secreted by α and β cells of Islets of Langerhans of pancreas is
(A) Glycoprotein (B) Steroid (C) Polypeptide (D) Glycolipid
19. Trophic hormones are produced by
(A) Anterior pituitary (B) Middle pituitary (C) Posterior pituitary (D) Thyroid
20. Thyrotrophic releasing factor (TRF) is secreted by
(A) Hypothalamus (B) Adenohypophysis (C) Pars intermedia (D) Neurohypophysis

Latest NEET questions

21. Match List - I with List - II. (NEET 2023)

List - I List - II
i CCK p Kidney
ii GIP q Heart
iii ANF r Gastric gland
iv ADH s Pancreas
(A) i-s, ii-q, iii-r, iv-p (B) i-q, ii-s, iii-p, iv-r (C) i-s, ii-r, iii-q, iv-p (D) i-q, ii-p, iii-s, iv-r
22. The parts of human brain that helps in regulation of sexual behaviour, expression of excitement,
pleasure, rage, fear etc. are: (NEET 2023)
(A) Corpora quadrigemina & hippocampus (C) Corpus callosum and thalamus
(B) Brain stem & epithalamus (D) Limbic system & hypothalamus
23. Which of the following statements are correct? (NEET 2023)
a. An excessive loss of body fluid from the body switches off osmoreceptors.
b. ADH facilitates water reabsorption to prevent diuresis.
c. ANF causes vasodilation.
d. ADH causes increase in blood pressure.
e. ADH is responsible for decrease in GFR.
Choose the correct answer from the options given below:
(A) b, c and d only (B) a, b and e only (C) c, d and e only (D) a and b only
24. Which of the following are NOT under the control of thyroid hormone? (NEET 2023)
a. Maintenance of water and electrolyte balance
b. Regulation of basal metabolic rate
c. Normal rhythm of sleep-wake cycle
d. Development of immune system
e. Support the process of R.B.Cs formation
Choose the correct answer from the options given below:
(A) b and c only (B) c and d only (C) d and e only (D) a and d only
25. Match List - I with List – II (NEET 2022)
List I List II
a) Multipolar neuron i. Somatic neural system
b) Bipolar neuron ii. Cerebral cortex
c) Myelinated nerve fibre iii. Retina of Eye
d) Unmyelinated nerve fibre iv. Spinal nerves
Select the correct option
(A) (a) – (iii), (b) – (i), (c) – (iv), (d) – (ii)
(B) (a) – (ii), (b) – (iv), (c) – (iii), (d) – (i)
(C) (a) – (ii), (b) – (iii), (c) – (i). (d) – (iv)
(D) (a) – (ii), (b) – (iii), (c) – (iv), (d) – (i)

*****
KCET / NEET crash course
2025

Topic: Sexual reproduction in flowering plants

1. In some members of which of the following pairs of families, pollen grains retain their viability
for months after release?
(A) Poaceae ; Rosaceae (C) Poaceae; Leguminosae
(B) Poaceae; Solanaceae (D) Rosaceae ; Leguminosae
2. The term used for transfer of pollen grains from anthers of one plant to stigma of a different
plant which, during pollination, brings genetically different types of pollen grains to stigma, is
(A) Xenogamy (B) Geitonogamy (C) Chasmogamy (D) Cleistogamy
3. In a flower, if the megaspore mother cell forms megaspores without undergoing meiosis & if
one of the megaspores develop into embryo sac, its nuclei would be
(A) Haploid (B) Diploid (C) with varying ploidy (D) a few haploid & a few diploid
4. Species that provide floral rewards in the form of providing safe area to lay eggs for insects are
(A) Amorphophallus (B) Yucca (C) Fig (D) All of these
5. Polygonum type of embryo sac is:
(A) 8-nucleate, 7-celled (B) 8-nucleate, 8-celled (C) 7-nucleate, 7-celled (D) 4-nucleate, 3-celled
6. When micropyle, chalaza and hilum lie in a straight line, the ovule is said to be:
(A) anatropous (B) orthotropous (C) amphitropous (D) campylotropous
7. Protandry is a condition in which:
(A) anthers mature after stigma (C) anthers and stigmas mature at the same time
(B) anthers mature earlier than the stigma (D) pollens of the same flowers pollinates stigmas
8. Which of the following floral parts form pericarp after fertilization?
(A) Nucellus (B) wall of ovary (C) Outer integument of ovule (D) Inner integument of ovule
9. Which of the following is correct?
(A) Proembryo  Heart shaped embryo  Globular embryo  mature embryo
(B) Heart shaped embryo  Proembryo  Globular embryo  mature embryo
(C) Proembryo  Globular embryo  Heart shaped embryo  mature embryo
(D) Globular embryo  Heart shaped embryo  Proembryo  mature embryo
10. Apomixis is seen in some species of
(A) Asteraceae (B) Grasses (C) Both A & B (D) Neither A nor B
11. How many meiotic divisions are necessary for the formation of 100 grains of wheat?
(A) 100 (B) 125 (C) 25 (D) 50
12. Even in absence of pollinating agents seed setting is assured in
(A) Commelina (B) Zostera (C) Salvia (D) Fig
13. Which of the following is true?
(A) Banana is an example for parthenocarpic fruit (C) Apple is an example for false fruit
(B) Outer integument of ovule forms testa of the seed (D) All of these
14. Assertion: Wind pollinated plant have large feathery stigma
Reason: Feathery stigma easily traps air-borne pollen grains
(A) If Assertion and Reason are true and the reason is the correct explanation of the assertion.
(B) If Assertion and Reason are true but Reason is not an explanation to Assertion.
(C) If Assertion is true and Reason is false.
(D) Both Assertion and Reason are false.
15. Statement A: In plants like water hyacinth and water lily, pollination takes place by water.
Statement B: In most of the water-pollinated species, pollen grains are protected from wetting
by a mucilaginous covering.
(A) Both statement A and B are correct. (C) Statement A is correct, B is incorrect.
(B) Both statement A and B are incorrect. (D) Statement A is incorrect, B is correct.

Latest NEET questions

16. What is the function of tassels in the corn cob? (NEET 2023)
(A) To trap pollen grains (C) To protect seeds
(B) To disperse pollen grains (D) To attract insects
17. Large, colourful, fragrant flowers with nectar are seen in: (NEET 2023)
(A) bird pollinated plants (C) bat pollinated plants
(B) wind pollinated plants (D) insect pollinated plants
18. In angiosperm, the haploid, diploid and triploid structures of a fertilized embryo sac sequentially
are: (NEET 2023)
(A) Antipodals, synergids, and primary endosperm nucleus
(B) Synergids, Zygote and Primary endosperm nucleus
(C) Synergids, antipodals and Polar nuclei
(D) Synergids, Primary endosperm nucleus and zygote
19. Statement I : Cleistogamous flowers are invariably autogamous. (NEET 2022)
Statement II : Cleistogamy is disadvantageous as there is no chance for cross pollination.
(A) Both statement I and II are correct (C) Statement I is correct, II is incorrect
(B) Both statement I and II are incorrect (D) Statement I is incorrect, II is correct
20. Identify incorrect statement related to Pollination : (NEET 2022)
(A) Moths and butterflies are the most dominant pollinating agents among insects
(B) Pollination by water is quite rate in flowering plants
(C) Pollination by wind is more common amongst abiotic pollination
(D) Flowers produce foul odours to attract flies and beetles to get pollinated

*****
KCET / NEET crash course
2025

Topic: Human reproduction & reproductive health

1. Sertoli cells are found
(A) Between the seminiferous tubules (C) in the upper part of fallopian tube
(B) In the germinal epithelium of ovary (D) In the germinal epithelium of seminiferous tubules
2. At which stage of life the oogenesis process is initiated?
(A) Adult (B) Puberty (C) Embryonic development stage (D) Birth
3. Assertion: testis originate in the abdomen but later descend into scrotum under the influence of
testosterone.
Reason: Leydig cells of the testis secrete male sex hormone inhibin.
(A) If Assertion and Reason are true and the reason is the correct explanation of the assertion.
(B) If Assertion and Reason are true but Reason is not an explanation to Assertion.
(C) If Assertion is true and Reason is false.
(D) If Assertion and Reason both are false.
4. Match the following:
Column I Column II
a Parturition 1 Attachment of zygote to endometrium
b Gestation 2 Release of egg
c Ovulation 3 Delivery of baby
d Implantation 4 Period between fertilization & the birth
e Conception 5 Formation of zygote by fusion
6 Stoppage of ovulation
(A) a – 4, b – 3, c – 1, d – 5, e – 2 (C) a – 3, b – 4, c – 2, d – 1, e - 5
(B) a – 3, b – 4, c – 1, d – 5, e – 2 (D) a – 3, b – 4, c – 2, d – 1, e – 6
5. Which event of fertilization involves the presence of hyaluronidase enzyme?
(A) Acrosomal reaction (B) Cortical reaction (C) Amphimixis (D) Activation of egg
6. Acrosomal reaction of the sperm occurs due to:
(A) Its contact with zona pellucida of the ova
(B) Reactions within the uterine environment of the female
(C) Reactions within the epididymal environment of the male
(D) Androgens produced in the uterus
7. Morula is a developmental stage:
(A) Between the zygote and blastocyst (C) After the implantation
(B) Between the blastocyst and gastrula (D) Between implantation and parturition
8. The first movements of the foetus and appearance of hair on the head are usually observed
during the _______ month.
(A) 2nd (B) 3rd (C) 4th (D) 5th
9. The female structures that corresponds (homologous) to the scrotum of the male are
(A) Labia minora (B) Labia majora (C) Clitoris (D) Urethral folds
10. Identical twins are
(A) Monozygotic (B) isozygotic (C) bizygotic (D) All
11. Extrusion of second polar body from egg nucleus occurs
 (A) after entry of sperm before completion of fertilization (C) before entry of sperm
(B) after completion of fertilization (D) without any relation of sperm entry
12. If for some reason, the vasa efferentia in the human reproductive system gets blocked, the
gametes will not be transported from
(A) Epididymis to Vas deferens (C) Vagina to uterus
(B) Testis to epididymis (D) Epididymis to rete testis
13. All these are male accessory glands except
(A) Cowper’s gland (B) Prostate gland (C) Bartholin’s gland (D) Seminal vesicles
14. Which of the following has 23 chromosomes
(A) Spermatogonia (B) 1⁰ Spermatocyte (C) 1⁰ Oocyte (D) Spermatid
15. Which of the following is a hormone releasing IUD?
(A) Vault (B) Multiload 375 (C) Cervical cap (D) LNG – 20

Latest NEET questions

16. Which of the following statements are correct regarding female reproductive cycle?
a. In non-primate mammals cyclical changes during reproduction are called oestrus cycle.
b. First menstrual cycle begins at puberty and is called menopause. (NEET 2023)
c. Lack of menstruation may be indicative of pregnancy.
d. Cyclic menstruation extends between menarche and menopause.
(A) a and b only (B) a, b and c only (C) a, c and d only (D) a and d only
17. Assertion A : Endometrium is necessary for implantation of blastocyst. (NEET 2023)
Reason R : In the absence of fertilization, the corpus luteum degenerates that causes
disintegration of endometrium.
(A) Both A and R are true but R is NOT the correct explanation of A.
(B) A is true but R is false.
(C) A is false but R is true.
(D) Both A and R are true and R is the correct explanation of A.
18. Given below are two statements: (NEET 2023)
Statement I : Vas deferens receives a duct from seminal vesicle and opens into urethra as the
ejaculatory duct.
Statement II : The cavity of the cervix is called cervical canal which along with vagina forms birth
canal.
In the light of the above statements, choose the correct answer from the options given below:
(A) Both statement I and II are correct. (C) Statement I is correct, II is incorrect
(B) Both statement I and II are incorrect (D) Statement I is incorrect, II is correct
19. Which of the following statements are true for spermatogenesis but do not hold for oogenesis?
(a) It results in the formation of haploid gametes (NEET 2022)
(b) Differetiation of gamete occurs after the completion of meiosis
(c) Meiosis occurs continuously in a mitotically dividing stem cell population
(d) It is controlled by the LH and FSH secreted by the anterior pituitary
(e) It is initiated at puberty
Choose the most appropriate answer from the options given below.
(A) (b) and (c) and (e) only (B) (c) and (e) only (C) (b) and (c) only (D) (b) , (d) and (e) only
20. Lippe’s loop is a type of contraceptive used as: (NEET 2022)
(A) Copper releasing IUD (B) Cervical barrier (C) Vault barrier (D) Non-Medicated IUD
KCET / NEET crash course
2025

Topic: Principles of inheritance & variations

1. In a dihybrid cross AABB x aabb, F2 generation of AABB, AABb, AaBb & AaBB occurs in the ratio
(A) 1:2:2:1 (B) 1:2:4:2 (C) 9:3:3:1 (D) 1:1:1:1
2. Statement I: The ratio of 3:1 in F2 generation is explained by law of independent assortment.
Statement II: In incomplete dominance the genotypic & phenotypic ratios are same in F2
generation.
(A) Both statement I and II are correct (C) Statement I is correct, II is incorrect
(B) Both statement I and II are incorrect (D) Statement I is incorrect, II is correct
3. Two genes A and B are linked in a dihybrid cross involving these two genes, the F1 heterozygote
is crossed with homozygous recessive parental type (aabb). What would be the ratio of offspring
in the next generation
(A) 1:1 (B) 1:1:1 (C) 1:1:1:1 (D) 1:1:1:1:1:1
4. How many are recombinants in Mendelian dihybrid cross?
(A) 25% (B) 62.8% (C) 37.5% (D) 50%
5. Select the incorrect statement about thalassemia.
(A) α-thalassemia is controlled by two closely linked genes HBA1 and HBA2
(B) α-thalassemia is controlled by genes present on chromosome 16
(C) β-thalassemia is controlled by a single gene HBB present on chromosome number 11
(D) Thalassemia is a qualitative problem of synthesizing an incorrectly functioning globin
6. A diseased man marries a normal woman. The couple has 3 daughters & 5 sons. All the
daughters are diseased while the sons are normal. The disease is
(A) Autosomal dominant (B) Autosomal recessive (C) X-linked dominant (D) X-linked recessive
7. Genotype that shows the diseased condition in sickle cell anaemia is
(A) HbA HbA (B) HbA HbS (C) HbS HbS (D) All of these
8. Sickle-cell anaemia happens due to ...A... mutation in which...B... of haemoglobin is affected.
Fill the correct option for A and B.
(A) A-point; B-B-chain (C) A-allele; B-a chain
(B) A-chromosomal; B-a-chain (D) A-non-allele; B-chain
9. Phenylalanine does not changed to tyrosine. This condition is seen in
(A) sickle-cell anaemia (B) phenylketonuria (C) thalassaemia (D) Haemophilia
10. Match the following
Column I Column I
i Chromosomal theory of inheritance P Henking
ii X-body Q T H Morgan
iii 21st trisomy R Sutton and Boveri
iv Linkage S Langdon Down
(A) i-S, ii-Q, iii-R, iv-P (B) i-R, ii-P, iii-S, iv-Q (C) i-Q, ii-R, iii-S, iv-P (D) i-R, ii-Q, iii-S, iv-P
11. In β-thalassaemia, the affected chromosome is
(A) 16th (B) 14th (C) 13th (D) 11th
12. Heterozygous pea plant for the flower colour gene produces gametes. What is the probability
that one of its gametes consist of recessive white allele for flower colour?
 (A) 25% (B) 50% (C) 75% (D) 0%
13. How many different types of gametes can be formed by F1 progeny resulting from the cross
AABBCC X aabbcc
(A) 3 (B) 8 (C) 27 (D) 64
14. A marriage between a colourblind man and a
normal woman results in
(A) 50% colourblind sons, 50% normal sons
(B) 100% colourblind sons, 100% carrier daughters
(C) 100% carrier daughters, 100% normal sons
(D) 100% colourblind daughters, 100% normal sons
15. Given below is a pedigree chart showing the
inheritance of certain sex linked trait in humans.
The trait traced in the above pedigree chart is
(A) X-linked dominant (C) Y-linked dominant
(B) X-linked recessive (D) Y-linked recessive

Latest NEET questions

16. Frequency of recombination between gene pairs on same chromosome as a measure of the
distance between genes to map their position on chromosome, was used for the first time by
(A) Sutton and Boveri (C) Alfred Sturtevant (NEET 2023)
(B) Henking (D) Thomas Hunt Morgan
17. The phenomenon of pleiotropism refers to (NEET 2023)
(A) presence of two alleles, each of the two genes controlling a single trait.
(B) a single gene affecting multiple phenotypic expression.
(C) more than two genes affecting a single character.
(D) presence of several alleles of a single gene controlling a single crossover.
18. Which of the following statements are correct about Klinefelter's Syndrome? (NEET 2023)
A. This disorder was first described by Langdon Down (1866).
B. Such an individual has overall masculine development. However, the feminine development is
also expressed.
C. The affected individual is short statured.
D. Physical, psychomotor and mental development is retarded.
E. Such individuals are sterile.
(A) C and D only (B) B and E only (C) A and E only (D) A and B only
19. The recombination frequency between the genes a & c is 5%, b & c is 15%, b & d is 9%, a & b is
20%, c & d is 24% and a & d is 29%. What will be the sequence of these genes on a linear
chromosome? (NEET 2022)
(A) a, c, b, d (B) a, d, b, c (C) d, b, a, c (D) a, b, c, d
20. Assertion (A): Mendel’s law of Independent assortment does not hold good for the genes that
are located closely on the same chromosome. (NEET 2022)
Reason (R): Closely located genes assort independently.
(A) If Assertion and Reason are true and the reason is the correct explanation of the assertion.
(B) If Assertion and Reason are true but Reason is not an explanation to Assertion.
(C) If Assertion is true and Reason is false. (D) If Assertion and Reason both are false.
KCET / NEET crash course
2025

Topic: Molecular basis of inheritance

1. In sea urchin DNA, which is double stranded, 17% of the bases were shown to be cytosine. The
percentages of the other three bases expected to be present in this DNA are :-
(A) G 17%, A 16.5%, T 32.5% (C) G 17%, A 33%, T 33%
(B) G 8.5%, A 50%, T 24.5% (D) G 34%, A 24.5%, T 24.5%
2. Total number of amino acids present in a polypeptide chain is 200. How many mRNA bases will
be required?
(A) 200 (B) 400 (C) 600 (D) 800
3. Capping is the process in transcription of eukaryotes where
(A) Methyl guanosine triphosphate is added at 3' end
(B) Methyl guanosine triphosphate is added at 5' end
(C) 200-300 adenylate residues are added at 3' end
(D) 200-300 adenylate residues are added at 5' end
4. Escherichia coli with completely radioactive DNA was allowed to multiply in non-radioactive
medium for three generations. What will be the percentage of bacteria with radioactive DNA?
(A) 100 % (B) 75 % (C) 50 % (D) 25 %
5. In 3-D view the molecule of tRNA looks
(A) Y shaped (B) L shaped (C) T shaped (D) Z shaped
6. Which of these are involved in the synthesis of mRNA in prokaryotes
(A) RNA polymerase (B) σ factor (C) ρ factor (D) All of the above
st
7. Statement A: According to Wobble hypothesis, degeneracy occurs at 1 base of genetic code.
Statement B: Wobble hypothesis was proposed by Francis Crick
(A) Both statements A & B are correct (C) Both statements A & B are wrong
(B) A is correct, B is wrong (D) A is wrong, B is correct
8. Which of these are salient features of human genome
(A) < 2% of human genome codes for proteins (C) presence of repetitive sequences
(B) The average gene consists of 3000 base (D) All
9. Reverse transcriptase is
(A) DNA dependent DNA polymerase (C) DNA dependent RNA polymerase
(B) RNA dependent DNA polymerase (D) RNA dependent RNA polymerase
10. Under which of the following conditions will there be no change in the reading frame of
following mRNA? 5'AACAGCGGUGCUAUU3'
(A) Insertion of G at 5th position (C) Insertion of A at G at 4th and 5th positions respectively
(B) Deletion of G from 5th position (D) Deletion of GGU from 7th, 8th and 9th positions
11. tRNA attaches amino acid at its:
(A) 3’ end (B) 5’ end (C) Anticodon (D) Loop.
12. The bacteria grown in the medium S35 as lone source of Sulphur show its incorporation into:
(A) DNA (B) Protein (C) RNA (D) None of these
13. If a geneticist uses the blind approach for sequencing whose genome of an organism, followed
by assignment of function to different segments, the methodology adopted by him is called as
(A) Bioinformatics (B) Sequence annotation (C) Gene mapping (D) Expressed sequence tags
14. In an E.coli strain i gene gets mutated and its product cannot bind the inducer molecule If
growth medium is provided with lactose what will be the outcome? (NEET 2022)
(A) RNA polymerase will bind the promoter region (C) Only z gene will get transcribed
(B) z, y, a genes will be transcribed (D) z, y, a genes will not be translated
15. The process of translation of mRNA to proteins begins as soon as
(A) The tRNA is activated and the larger subunit of ribosome encounters mRNA
(B) The small subunit of ribosome encounters mRNA
(C) The larger subunit of ribosome encounters mRNA
(D) Both the subunits join together to bind with mRNA

Latest NEET questions

16. What is the role of RNA polymerase III in the process of transcription in Eukaryotes?
(A) Transcription of tRNA, 5 srRNA and snRNA (C) Transcription of only snRNAs (NEET 2023)
(B) Transcription of precursor of mRNA (D) Transcription of rRNAs (28S, 18S and 5.8S)
17. Expressed Sequence Tags (ESTs) refers to (NEET 2023)
(A) All genes that are expressed as proteins. (C) Certain important expressed genes.
(B) All genes whether expressed or unexpressed. (D) All genes that are expressed as RNA.
18. Given below are two statements: (NEET 2023)
Statement I : In prokaryotes, the positively charged DNA is held with some negatively charged
proteins in a region called nucleoid.
Statement II : In eukaryotes, the negatively charged DNA is wrapped around the positively
charged histone octamer to form nucleosome.
In the light of the above statements, choose the correct answer from the options given below :
(A) Both Statement I and Statement II are true.
(B) Both Statement I and Statement II are false.
(C) Statement I is correct but Statement II is false.
(D) Statement I incorrect but Statement II is true.
19. Which one of the following is the sequence on corresponding coding strand, if the sequence on
mRNA formed is as follows: 5' AUCGAUCGAUCGAUCGAUCG AUCG AUCG 3'? (NEET 2023)
(A) 3' UAGCUAGCUAGCUAGCUA GCUAGCUAGC 5'
(B) 5' ATCGATCGATCGATCGATCG ATCGATCG 3'
(C) 3' ATCGATCGATCGATCGATCG ATCGATCG 5'
(D) 5' UAGCUAGCUAGCUAGCUAGCUAGCUAGC 3'
20. Read the following statements and choose the set of correct statements (NEET 2022)
(a) Euchromatin is loosely packed chromatin
(b) Heterochromatin is transcriptionally active
(c) Histone octomer is wrapped by negatively charged DNA in nucleosome
(d) Histones are rich in lysine and arginine
(e) A typical nucleosome contains 400 bp of DNA helix
Choose the correct answer from the options given below:
(A) (a), (c), (e) only (B) (b), (d), (e) only (C) (a), (c), (d) only (D) (b), (e) only

*****
KCET / NEET crash course
2025

Topic: Evolution
1. Weismann cut off tails of mice generation after generation but tails neither disappeared nor
shortened showing that
(A) Darwin’s theory was wrong (C) Mutation theory was wrong
(B) Lamarck’s theory was wrong (D) Synthetic theory was wrong
2. Evolutionary convergence is the development of
(A) Common set of characters in a groups of different ancestry
(B) Common set of characters in closely related groups
(C) Development of characters by random mating
(D) Dissimilar characters in closely related groups
3. What can you infer about the structures shown in figure?
(A) Homologous organs
(B) Analogous organs
(C) Divergent evolution
(D) Both A & C
4. Stabilizing selection favours
(A) both extreme forms of a tract.
(B) intermediate forms of a tract.
(C) environmental differences.
(D) one extreme form over the other extreme form and over intermediates forms of a tract.
5. Statement A: Interbreeding between one population to another is called gene flow.
Statement B: The sum total of all the genes of a population is known as genetic drift.
(A) Both statement A and B are correct (C) Statement A is correct, B is incorrect
(B) Both statement A and B are incorrect (D) Statement A is incorrect, B is correct.
6. Statement A: Lamarck’s theory of evolution is also known as theory of acquired inheritance.
Statement B: Lamarck theory of evolution also explained use and disuse of organs.
(A) Both statement A and B are correct (C) Statement A is correct, B is incorrect
(B) Both statement A and B are incorrect (D) Statement A is incorrect, B is correct
7. Jurassic period of the Mesozoic era is characterized by
(A) Gymnosperms are dominant plants & first birds appear
(B) Radiation of reptiles & origin of mammal like reptiles
(C) Dinosaurs become extinct & angiosperms appear
(D) Flowering plants & first dinosaurs appear
8. Hardy-Weinberg principle can be expressed as
(A) (p + q)2 = 1 (B) (p + q)3 = 1 (C) (p + q)2 > 1 (D) (p + q)2 < 1
9. Factors affecting Hardy-Weinberg equilibrium are
(a) Gene flow (b) Genetic drift (c) Mutation (d) Genetic recombination (e) Natural selection
(A) a & b (B) a, b & c (C) b, c & d (D) a, b, c, d & e
10. The chronological order of human evolution from early to the recent is:
(A) Ramapithecus ----- Homo habilis ------- Australopithecus ----- Homo erectus
(B) Australopithecus ----- Homo habilis----- Ramapithecus ----- Homo erectus
(C) Australopithecus ----- Ramapithecus ----- Homo habilis ----- Homo erectus
(D) Ramapithecus ----- Australopithecus ----- Homo habilis ----- Homo erectus
11. Who proposed the concept of intraspecific and interspecific struggle?
(A) de Vries (B) Malthus (C) Cuvier (D) Darwin
12. Which one cannot be explained by Darwinism?
(A) Over-specialisation (C) Occurrence of unchanged forms
(B) Persistence of vestigial organs (D) All the above
13. A population exhibiting Hardy-Weinbeg equilibrium possesses 25% recessive traits. Find out the
frequency of recessive alleles in the gene pool of the same population.
(A) 0.3 (B) 0.25 (C) 0.75 (D) 0.5
14. Single step large mutation leading to speciation is also called
(A) Founder effect (B) saltation (C) branching descent (D) natural selection
15. At a particular locus, frequency of A allele is 0.6 & that of a is 0.4. what would be the frequency
of heterozygotes in a randomly mating population of equilibrium?
(A) 0.16 (B) 0.36 (C) 0.48 (D) 0.24

Latest NEET questions

16. Select the correct group/set of Australian Marsupials exhibiting adaptive radiation. (NEET 2023)
(A) Numbat, Spotted cuscus, Flying phalanger (C) Lemur, Anteater, Wolf
(B) Mole, Flying squirrel, Tasmanian tiger cat (D) Tasmanian wolf, Bobcat, Marsupial mole
17. Natural selection where more individuals acquire specific character value other than the mean
character value, leads to: (NEET 2022)
(A) Random change (B) Stabilising change (C) Directional change (D) Disruptive change
18. Which of the following statements is not true? (NEET 2022)
(A) Flippers of penguins and dolphins are a pair of homologous organs
(B) Analogous structures are a result of convergent evolution
(C) Sweet potato and potato is an example of analogy
(D) Homology indicates common ancestry
19. The factor that leads to Founder effect in a population is: (NEET 2021)
(A) Natural selection (B) Genetic recombination (C) Mutation (D) Genetic drift
20. Match the following: (NEET 2021)
Column I Column II
a) Adaptive radiation i. Selection of resistant varieties due to
excessive use of herbicides and pesticides
b) Convergent evolution ii. Bones of forelimbs in Man and Whale
c) Divergent evolution iii. Wings of Butterfly and Bird
d) Evolution by anthropogenic action iv. Darwin’s finches
(A) a-iii, b-iv, c-ii, d-i (B) a-i, b-iv, c-ii, d-iii (C) a-iv, b-iii, c-ii, d-i (D) a-i, b-iii, c-ii, d-iv

****
KCET / NEET crash course
2025

Topic: Human health & diseases

1. Which class of antibodies is abundant in body secretions?
(A) Ig G (B) Ig A (C) Ig M (D) IgE
2. Each immunoglobulin has two heavy chains & two light chains, the antigen binding site is present in
(A) variable region of light chain (C) variable region of heavy chain
(B) variable region of both heavy and light chain (D) constant region of both light and heavy chain.
3. Select the incorrect statement with respect to acquired immunity.
(A) Acquired immunity is non-specific type of defense present at the time of birth.
(B) Primary response is produced when our body encounters a pathogen for the first time.
(C) Anamnestic response is elicited on subsequent encounters with the same pathogen.
(D) Anamnestic response is due to memory of first encounter.
4. Inflammatory response in allergy is due to the release of ________ from mast cells.
(A) Antibody (B) Anti histamines (C) Histamines (D) Antigen
5. Damage of thymus in a child may lead to
(A) Reduction in haemoglobin content in blood (C) loss of antibody mediated immunity
(B) Reduction in amount of plasma proteins (D) loss of cell mediated immunity
6. Colostrum provides the infant with
(A) Autoimmunity (B) Passive immunity (C) Active immunity (D) Innate immunity
7. Assertion (A): Interferons are a type of antibodies produced by body cells infected by bacteria.
Reason (R): Interferons stimulates inflammation at the site of injury.
(A) If Assertion and Reason are true and the reason is the correct explanation of the assertion.
(B) If Assertion and Reason are true but Reason is not an explanation to Assertion.
(C) If Assertion is true and Reason is false.
(D) If Assertion and Reason both are false.
8. Statement I: HIV is un-enveloped retrovirus
Statement II: HIV contains one molecule of ss RNA and one molecule of reverse transcriptase.
(A) Both statement I and II are correct (C) Statement I is correct, II is incorrect
(B) Both statement I and II are incorrect (D) Statement I is incorrect, II is correct
9. Drug called 'Heroin' is synthesized by:
(A) methylation of morphine (C) acetylation of morphine
(B) glycosylation of morphine (D) nitration of morphine
10. Statement I: Heroin is commonly called as Smack.
Statement II: Cocaine is commonly called as crack.
(A) Both statement I and II are correct (C) Statement I is correct, II is incorrect
(B) Both statement I and II are incorrect (D) Statement I is incorrect, II is correct
11. Antivenom injection contains preformed antibodies while polio drops that are administered into
the body contain
(A) Activated pathogens (B) Harvested antibodies (C) γ globulin (D) Attenuated pathogens
12. Chronic auto immune disorder affecting neuro-muscular junction leading to fatigue, weakening
and paralysis of skeletal muscle is called as:
(A) Arthritis (B) Muscular dystrophy (C) Myasthenia gravis (D) Gout
13. Transplantation of tissues/organs fails often due to non-acceptance by the patient's body.
Which type of immune-response is responsible for such rejections?
(A) Cell - mediated immune response (C) Hormonal immune response
(B) Physiological immune response (D) Autoimmune response
14. Cancerous cells spread through
(A) lymph (C) secondary growth of malignant tumour
(B) blood (D) All of the above
15. Which one of the following is the correct statement regarding the particular psychotropic
drug specified?
(A) Hashish causes alteration in thought, perceptions and hallucinations
(B) Opium stimulates nervous system and causes hallucinations
(C) Morphine leads to delusions and disturbed emotions
(D) Barbiturates causes relaxation and temporary euphoria

Latest NEET questions

16. Which one of the following common sexually transmitted diseases is completely curable when
detected early and treated properly? (NEET 2023)
(A) Gonorrhoea (B) Hepatitis-B (C) HIV Infection (D) Genital herpes
17. Which one of the following techniques does not serve the purpose of early diagnosis of a
disease for its early treatment? (NEET 2023)
(A) Serum and Urine analysis
(B) Polymerase Chain Reaction (PCR) technique
(C) Enzyme Linked Immuno-Sorbent Assay (ELISA) technique
(D) Recombinant DNA Technology
18. Match List I with List II. (NEET 2023)
List I List II
a. Heroin I. Effect on cardiovascular system
b. Marijuana II. Slow down body function
c. Cocaine III. Painkiller
d. Morphine IV. Interfere with transport of dopamine
Choose the correct answer from the options given below:
(A) a-I, b-II, c-III, d-IV (C) a-IV, b-III, c-II, d-I
(B) a-III, b-IV, c-I, d-II (D) a-II, b-I, c-IV, d-III
19. In which blood corpuscles, the HIV undergoes replication and produces progeny viruses?
(A) B-lymphocytes (B) Basophils (C) Eosinophils (D) TH cells (NEET 2023)
20. Statements I: Autoimmune disorder is a condition where body defense mechanism recognizes
its own cells as foreign bodies. (NEET 2022)
Statements II: Rheumatoid arthritis is a condition where body does not attack self-cells.
(A) Both statement I and II are correct (C) Statement I is correct, II is incorrect
(B) Both statement I and II are incorrect (D) Statement I is incorrect, II is correct

*****
KCET / NEET crash course
2025

Topic: Microbes in human welfare

1. Which of the following is not used as biopesticide?

(A) Bacillus thuringiensis (C) Nuclear Polyhedrosis Virus (NPV)
(B) Xanthomonas campestris (D) Trichoderma harzianum
2. Azolla is used as biofertilizer because it
(A) Has association of mycorrhiza (C) Multiplies at faster rate to produce massive biomass
(B) Has association of nitrogen fixing Rhizobium (D) Has association of nitrogen fixing Cyanobacteria
3. Assertion: Nitrogen fixing bacteria of legume root nodules survive in oxygen depleted cells.
Reason: Leghaemoglobin completely removes oxygen from nodule cells.
(A) If Assertion and Reason are true and the reason is the correct explanation of the assertion.
(B) If Assertion and Reason are true but Reason is not an explanation to Assertion.
(C) If Assertion is true and Reason is false. (D) Both Assertion and Reason are false
4. The domestic sewage in large cities
(A) Has a high BOD as it contains both aerobic & anaerobic bacteria
(B) Is processed by aerobic & then anaerobic bacteria in the secondary treatment in sewage
treatment plants (STPs)
(C) When treated in STPs doesn’t require aeration step as sewage contains adequate oxygen
(D) Has very high amounts of suspended solids & dissolved salts
5. Methanogenic bacteria are not found in
(A) Activated sludge (C) bottom of water logged paddy fields
(B) Rumen of cattle (D) gobar gas plant
6. Which of the following is wrongly matched?
Microbe Product Application
(A) Trichoderma polysporum Cyclosporin A Immunosuppressive drug
(B) Monascus purpureus Statins Lowering of blood cholesterol
(C) Streptococcus Streptokinase Removal of clot from blood vessel
(D) Clostridium butylicum Lipase Removal of oil stains
7. Trichoderma harzianum is useful for
(A) Biological control of soil borne plant pathogens (C) Reclamation of waste lands
(B) Bioremediation (D) Gene transfer
8. Match the following:
Column I Column II options
(a) Lady bird beetle 1 Methano bacterium (A) a – 2, b – 4, c – 3, d – 1
(B) a – 3, b – 4, c – 2, d – 1
(b) Mycorrhiza 2 Trichoderma
(C) a – 4, b – 1, c – 2, d – 3
(c) Biological control 3 Aphids
(D) a – 3, b – 2, c – 1, d – 4
(d) Biogas 4 Glomus
9. Conversion of milk to curd improves its nutritional value by increasing the amount of
(A) Vitamin D (B) Vitamin A (C) Vitamin B12 (D) Vitamin E
10. Roquefort cheese is formed by ripening with the fungi for a particular
(A) Colour (B) Flavour (C) Shape (D) Taste
11. What gases are produced in anaerobic sludge digestors? (AIPMT 2014)
(A) Methane, hydrogen sulphide & carbon dioxide (C) M ethane, hydrogen sulphide & oxygen
(B) Hydrogen sulphide & carbon dioxide (D) Methane & carbon dioxide only
12. In gobar gas, the maximum amount is that of : (AIPMT 2012)
(A) Methane (B) Propane (C) Carbon dioxide (D) Butane
13. The antibiotic Streptomycin is obtained from
(A) Streptomyces griseus (C) Streptococcus pyogenes
(B) Lactobacillus lactis (D) Streptococcus thermophllus
14. The most common fungal partners of mycorrhiza are ______ species.
(A) Azotobacter (B) Glomus (C) Azolla (D) Frankia
15. Biochemical Oxygen Demand (BOD) may not be a good index for pollution for water bodies
receiving effluents from
(A) Petroleum industry (B) Sugar industry (C) Domestic sewage (D) Dairy industry

Latest NEET questions

16. Identify the microorganism which is responsible for the production of an immunosuppressive
molecule cyclosporin A: (NEET 2022)
(A) Streptococcus cerevisiae (B) Trichoderma polysporum (C) Clostridium butylicum (D) Aspergillus niger
17. Which one of the following produces nitrogen fixing nodules on the roots of Alnus? (NEET 2022)
(A) Beijernickia (B) Rhizobium (C) Frankia (D) Rhodospirillum
18. Match List - I with List - II. (NEET 2021)
List I List II
a. Aspergillus niger I. Acetic Acid
b. Acetobacter aceti II. Lactic Acid
c. Clostridium butylicum III. Citric Acid
d. Lactobacillus IV. Butyric Acid
Choose the correct answer from the options given below:
(A) a-I, b-II, c-III, d-IV (C) a-III, b-I, c-IV, d-II
(B) a-III, b-IV, c-I, d-II (D) a-II, b-I, c-IV, d-III
19. Which of the following is put into Anaerobic sludge digester for further sewage treatment?
(A) Floating debris (C) Effluents of primary treatment (NEET 2020)
(B) Activated sludge (D) Primary sludge
20. Pinus seed cannot germinate and establish without fungal association. This is because
(A) its embryo is immature (NEET 2019)
(B) it has very hard seed coat.
(C) it has obligate association with mycorrhizae.
(D) its seeds contain inhibitors that prevent germination

*****
KCET / NEET crash course
2025

Topics: Ecology: Organisms & populations, Ecosystem, Biodiversity & conservation

1. Who has proposed the term Ecosystem?

(A) Calvin (B) Odum (C) Tansley (D) Gardner
2. The formula for exponential growth is
(A) dt/dN (B) dN/rN = dt (C) rN/dN = dt (D) dN/dt = rN.
3. Female mosquitoes sucking human blood at intervals are
(A) Permanent parasites (B) Endoparasites (C) Hemiparasites (D) Intermittent parasites
4. Which of the following equations is correct for Verhulst-Pearl logistic growth?
𝑑𝑁 𝑑𝑁 𝑟−𝑁 𝑑𝑁 𝐾−𝑁
(A) = 𝑟𝑁 (B) = 𝐾𝑁 ( ) (C) = 𝑟𝑁 ( ) (D) None of these
𝑑𝑇 𝑑𝑇 𝑟 𝑑𝑇 𝐾
5. A logistic growth curve depicting a population that is limited by a definite carrying capacity is
shaped like the letter
(A) L (B) J (C) S (D) M
rt
6. In the exponential growth equation Nt = N0e , e represents (NEET 2021)
(A) The base of number logarithms
(B) The base of exponential logarithms
(C) The base of natural logarithms
(D) The base of geometric logarithms
7. Interaction of population with the environment is known as
(A) Ecosystem (B) Autecology (C) Synecology (D) Community
8. Assertion: Removal of keystone species cause serious disruption in functioning of community.
Reason: Keystone species are low in abundance (or biomass) than the dominant species.
(A) If Assertion and Reason are true and the reason is the correct explanation of the assertion.
(B) If Assertion and Reason are true but Reason is not an explanation to Assertion.
(C) If Assertion is true and Reason is false.
(D) Both Assertion and Reason are false
9. Alexander Von Humbolt described for the first time
(A) Laws of limiting factor (C) Species area relationships
(B) Population Growth equation (D) Ecological Biodiversity
10. Which one of the following is related to Ex-situ conservation of threatened animals and plants?
(A) Biodiversity hot spots (B) Himalayan region (C) Amazon rainforest (D) Wildlife safari parks
11. Detritivores breakdown detritus into smaller particles. This process is called:
(A) Decomposition (B) Catabolism (C) Fragmentation (D) Humification
12. In-situ conservation refers to:
(A) Conserve only extinct species (C) Conserve only high risk species
(B) Protect and conserve the whole ecosystem (D) Conserve only endangered species
13. The sacred groves in India are related with
(A) cultural tradition
(B) the place where threatened species are protected
(C) the place where only artificial animal breeding is allowed
(D) forest patches around the places of worship
14. Rivet popper hypothesis explains the importance of
(A) species in an ecosystem (B) population (C) genetic variability (D) none of these
 15. In grass-deer-tiger food chain, grass biomass is one tonne. The tiger biomass shall be
(A) 100 kgs (B) 10 kgs (C) 200 kgs (D) 1 kg.

Latest NEET questions

16. Match the following: (NEET 2023)

Column I (Interaction) Column II(Species A and B)
a) Mutualism i. +(A), O(B)
b) Commensalism ii. –(A), O(B)
c) Amensalism iii. +(A), –(B)
d) Parasitism iv. +(A), +(B)
(A) a-iv, b-i, c-iv, d-ii (B) a-i, b-iv, c-ii, d-iii (C) a-iv, b-ii, c-i, d-iii (D) a-iv, b-i, c-ii, d-iii
17. Identify the correct statements : (NEET 2023)
a. Detrivores perform fragmentation.
b. The humus is further degraded by some microbes during mineralization.
c. Water soluble inorganic nutrients go down into the soil and get precipitated by a process
called leaching.
d. The detritus food chain begins with living organisms.
e. Earthworms break down detritus into smaller particles by a process called catabolism.
Choose the correct answer from the option given below :
(A) b, c, d only (B) c, d, e only (C) d, e, a only (D) a, b, c only
18. Among ‘The Evil Quartet’, which one is considered the most important cause driving extinction
of species? (NEET 2023)
(A) Over exploitation for economic gain (C) Co-extinctions
(B) Alien species invasions (D) Habitat loss and fragmentation
19. In the equation “GPP – R = NPP” (NEET 2023)
GPP is Gross Primary Productivity , NPP is Net Primary Productivity
R here is ____.
(A) Respiratory quotient (C) Reproductive allocation
(B) Respiratory loss (D) Photosynthetically active radiation
20. Which of the following statements is correct? (NEET 2023)
(A) Biomagnification refers to increase in concentration of the toxicant at successive trophic
levels.
(B) Presence of large amount of nutrients in water restricts 'Algal Bloom'
(C) Algal Bloom decreases fish mortality
(D) Eutrophication refers to increase in domestic sewage and waste water in lakes.

****