DNA & RNA: Molecules of Heredity

DNA  deoxyribonucleic acid

Polymer of deoxynucleotide units
Each deoxynucleotide consists of:
- A nitrogenous base (carries genetic
information)
- A sugar, deoxyribose (structural role)
- A phosphate group (structural role)

RNA  ribonucleic acid

Polymer of ribonucleotide units
Each ribonucleotide consists of:
- A nitrogenous base
- A sugar, ribose
- A phosphate group
What is a nucleoside?
Deoxynucleoside is a purine or
Structure of DNA & RNA sugars:
pyrimidine bonded to a sugar with a
beta-glycosidic linkage.

Nitrogenous bases
Planar, aromatic, heterocyclic
molecules, derivatives of purine or
pyrimidine.
 Deoxyadenylic acid
Deoxyguanylic acid
Deoxythymidylic acid
Deoxycytidylic acid

Nucleosides in RNA:
Adenosine
Guanosine
Cytidine
Uridine
Nucleoside vs nucleotide
Nucleosides are phosphorylated in the Nucleotides in RNA
cell, producing nucleotides.
Adenylic acid
A nucleotide is a phosphate ester of a
nucleoside, i.e. ester linkage. Guanylic acid
Cytidylic acid

Nucleoside  nucleotide Uridylic acid

Removal of water during nucleotide

formation (creating an ester linkage) Free nucleotides
At physiological pH, the phosphates are
ionized

Summary:
Nucleosides in DNA:
Deoxyadenosine
Deoxyguanosine
Deoxythymidine
Deoxycytidine ATP
Nucleotides in DNA:
 AZT inhibits reverse transcriptase (a
DNA polymerase) the enzyme that HIV
uses to make a DNA copy of its RNA.
It acts as a chain terminator when
incorporated into DNA (no free 3’ OH for
the next phosphate to attach to).

Adenosine 5’-triphosphate The polymeric nature of nucleic acids

Mg2+ clusters near the phosphates in Nucleotides are joined together to form
cells. DNA/RNA.
The phosphate of the next nucleotide
binds to the 3’ OH of the preceding
What are the functions of free ribose by means of a phosphodiester
nucleotides? bond.
ATP – energy storage & transfer
molecule
Adenosine – part of the coenzyme A
molecule
Metabolic regulators & signal molecules
Synthetic nucleotide analogs – medical
field cancer-fluorouracil
Azidothymidine (AZT) – HIV drug

Azidothymidine (AZT)
DNA is read from 5’ to 3’ (of the ribose_.
This strand has polarity.

How is AZT derived?

AZT is a nucleoside analog of
deoxythymidine-3’. The OH group is
replaced by azido (N3) group.
AZT is taken into the cells & converted
into triphosphates.
Base pairing DNA
DNA is double stranded. Bases of DNA is double stranded (ds), but the
adjacent strands bind together by genomes of some viruses consist of
means of hydrogen bonds to form this single stranded DNA (ss).
double stranded DNA.
Pyrimidine  pyrimidine is energetically
RNA
unfavorable, & the molecules are too
far apart for hydrogen bonding. RNA is ss, but dsRNA forms the genetic
material of some viruses.
Purine  purine is also energetically
unfavorable & the molecules are too RNA molecules can fold upon
close, leading to electrostatic repulsion. themselves forming hairpins, loops &
bulges.

Pyrimidine  Purine ONLY!

Guanine binds to Cytosine (3 H bonds)

Double stranded DNA

Adenine binds to Thymine (2 H bonds)

Chargaff’s rule:
# of adenine = # of thymine
# of guanine = # of cytosine
Secondary structure of DNA and RNA
Watson-Crick DNA Model
Determined by Watson-Crick in 1953:
1. 2 helical polynucleotide chains are
coiled around a common axis, the
chains run in opposite directions
(antiparallel).
2. Bases are inside the helix, phosphate
and deoxyribose units are outside
and form the negatively charged The sugar-phosphate backbone is on
backbone, planes of the bases are the outside. The nitrogen containing
perpendicular to the helix axis. bases are inside, stacking perpendicular
3. Diameter of the helix is 20 A, to the helix axis.
adjacent bases are separated by 3.4
A along the axis, 10 base pairs per
turn. Stacking of these base pairs
leads to most of the helical stability.
4. The chains are held together by
hydrogen bonds.
5. Sequence of bases is not restricted;
the sequence carries genetic
information.

Bases perpendicular to the helix axis.

The central cross shaped pattern is

indicative of a helical structure. The
heavy dark patterns (top & bottom)
indicate that the bases are stacked
perpendicular to the axis of the
molecule.

Minor & major grooves in the DNA helix

Forms of DNA The process of making new copies of
the DNA molecules.
Majority of the genome is duplex B-DNA
®, which is biologically active.
In reduced humidity, B-DNA changes to Replication as a process:
A-DNA ®, which is wider & flatter, used
Double-stranded DNA unwinds; the
in crystallographic experiments, DNA-
junction of the unwound molecule is a
RNA< enzyme-DNA complexes.
replication fork; a new strand is formed
Z-DNA (L) is more compact, it forms by pairing complementary bases with
behind a RNA polymerase moving the old strand; two molecules are made;
through a DNA double helix during each has one new and one old DNA
transcription, can reliever torsional strand.
strain during transcription.

Replication In vivo is complex

Replication requires he coordinated
regulation of many enzymes &
processes:
- Unwind the DNA
- Synthesize a new nucleic acid
polymer
What is the function of DNA & RNA? - Proof-read
- Repair mistakes
DNA stores genetic information, directs
its own replication, directs the
transcription of complementary RNA. Enzymes in DNA replication
RNA has more varied functions, Helicase  unwinds parental double
facilitates the translation of DNA into helix
protein.
Binding proteins  stabilize separate
strands
DNA & RNA: molecules of Heredity Primase  adds short primer to
Genetic information  carried & stored template strand
in sequence of nucleotides in DNA. DNA polymerase  binds nucleotides to
Genome  the complete set of form new strands
information in DNA. Exonuclease  removes RNA primer &
DNA polymerase I inserts the correct
bases
Where is DNA found?
Ligase  joins Okazaki fragments &
- Nucleus of eukaryotes seals other nicks in the sugar-
- Mitochondria phosphate backbone
- Chloroplasts

DNA Replication
Replication

Helicase protein binds to DNA

sequences called origins & unwinds
DNA strands.
Biding proteins prevent single strands
from rewinding.
Exonuclease enzymes remove RNA
Primase protein makes a short segment primers.
of RNA complementary to the DNA, a
primer.

DNA polymerase I replaces the RNA

primer.
DNA polymerase III enzyme adds DNA
Ligase forms bonds between sugar-
nucleotides to the RNA primer.
phosphate backbone.
DNA polymerases require an underlying
template (and a primer) and cannot
synthesize in the direction 3’ to 5’. That
is, they cannot add nucleotides to a free
5’ end.
DNA polymerase proofreads bases
added & replaces incorrect nucleotides.
Leading strand synthesis continues in a
5’ to 3’ direction.

Discontinuous synthesis in the lagging

strand produces 5’ to 3’ DNA segments
called Okazaki fragments.
DNA replication requirements Differences between replication &
transcription
1. AN unwound & single stranded
template (helicase & SSB protein). Replication Transcriptio
2. An RNA primer (primase, replaced n
with DNA by DNA Pol I). Template Double Single
3. A free 3’ end (synthesis is only ever strands strand
5’-3’, carried out by DNA Pol III). Substrate dNTP NTP
4. Nucleotides (building blocks). Primer yes No
5. Proof-reading (built in nuclease Enzyme DNA RNA
functions of DNA polymerases). polymeras polymerase
e
Product dsDNA ssDNA
Base pair A-T, G-C A-U, T-A, G-
Transcription & Translation C
Central dogma of biology
Transcription of prokaryotes
Initiation phase: RNA-pol recognizes the
promoter & starts the transcription.
Elongation phase: the RNA strand is
continuously growing.
Termination phase: the RNA-pol stops
synthesis & the nascent RNA is
separated from the DNA template.

In red: conforms to dogma

Classes of RNA
In blue: does not conform to dogma
Messenger RNA (mRNA): short lived,
complement of DNA ‘coding’ strand,
Transcription directs translation of proteins.

Synthesis of an RNA copy from a DNA Ribosomal RNA (rRNA): most abundant
template. RNA (90%); major component of
ribosome -has enzyme activity.
- DNA dependent RNA polymerase
(DdRp) Transfer RNA (tRNA): complementary to
- Single stranded RNA copy of a gene mRNA codons; delivers amino acids to
sequence the ribosome – needs an enzyme to
- Complimentary base pairing attach the amino acids to the RNA.

Similarity between replication & Translation (Protein synthesis)

transcription: Synthesis of a polypeptide chain from
- Both use DNA as a template an mRNA sequence, such that the
- Phosphodiester bonds formed mRNA nucleotide sequence is
- Synthesis is from 5’ to 3’ translated into an amino acid sequence
(protein).
 UAA, UAG and UGA are termination or
stop codons.
mRNA travels to the ribosome in the
cytoplasm & binds to the small subunit The start and stop codons define a
of the ribosome. reading frame.
tRNA adapts genetic info from
nucleotides to amino acids, carries
amino acids to the ribosome.
At lease one tRNA for each amino acid,
3 nucleotides represent one amino acid.

The genetic code

Defined as the code that describes the
link between the nucleotide & protein
sequence.

Characteristics
1. Almost (universal) – few, rare
exceptions (in mt DNA].
2. Continuous – no nucleotide gaps as
‘punctuation’ Adaptor Hypothesis
3. Non-overlapping
4. Degenerate/redundant – more than 1 The adaptor hypothesis postulates that
codon per amino acid the genetic code is read by molecules
5. NOT ambiguous (a particular codon that recognize a codon and carry the
always only codes for 1 amino acid). corresponding amino acid.

Codon  a unit of three adjacent

nucleotides on DNA or mRNA that
indicates a specific amino acid to be
incorporated into a polypeptide.
Anticodon  a unit of three adjacent
nucleotides on a tRNA that is tRNA
complimentary to and base pairs with 1. Information adapter molecule
the codon on the mRNA. 2. Small RNA 75-95 nucleotides
3. tRNAs share a common secondary
structure that resembles a cloverleaf
Special codons 4. carries amino acid
AUG (which specifies methionine) is a 5. carries anti-codon sequence
start codon.
It also specifies internal methionines,
which is the only amino acid specified
by just one codon.
Ribosomal Structure

Questions from self-study exercise:

1. One of the differences between
DNA & RNA, and the reason for
the difference in their names, lies
in the sugar molecule component
of their primary structure.
Demonstrate this difference by
drawing the structure of their
respective sugars. Please number
the carbons.
5. What is the bond adjoining
adjacent nucleotides called and
where on the nucleotide does this
occur? Use a diagram to illustrate
your answer. How does this give
directionality to a DNA strand?
A phosphodiester bond which
forms between the 3’ carbon of
the deoxyribose in one nucleotide
and the phosphate on the 5’
carbon of the deoxyribose of the
next nucleotide give directionality
to the DNA strand (5’ to 3’ or 3’ to
5’).

2. Apart from that given in Q1, give

2 other differences between DNA
and RNA.
Thymine in DNA and Uracil in
RNA.
Double-stranded DNA versus
(largely) single stranded RNA.

3. Give the FULL name for the

following nucleotide: 6. If 16% of Dr de la Mare’s DNA is
composed of guanines, what
percentage of her DNA is
composed of adenines?
number of Gs = number of Cs
therefore G+C makes up 32%.
Therefore, the rest is made up of
deoxythymidylic acid
As and Ts (68%).
But, number of As = number of
4. Draw the structure of guanylic
Ts, therefore number of As is
acid
 34%. DNA contains one template
strand and one newly synthesized
7. The G-C content of a DNA strand.
molecule raises the melting point Dispersive/distributive  here,
of that DNA molecule meaning parental strand and progeny
that it takes more energy to break strand become interspersed such
the bonds between guanine & that both strands contain both
cytosine, why is this? template and newly synthesized
There are three hydrogen bonds DNA.
between guanine and cytosine in Living systems employ a semi-
adjacent DNA strands as opposed conservative mechanism of DNA
to the 2 hydrogen bonds between replication.
the adenines & thymines.
11. What are the functions of
8. What is AZT, what it is used for the following in DNA replication:
and how does it act? a) Helicase
AZT is a modified free nucleoside unwinds the DNA and
containing an azido group on the separates the strands
3’ carbon of ribose in place of a b) Primase
hydroxyl group. It is used as an adds an RNA primer to which
HIV drug due to its ability to DNA polymerase III can add
terminate reverse transcription as nucleotides in a 5’ to 3’
there is no free 3’ hydroxyl group direction
for the next nucleotide to add to. c) DNA polymerase III
adds deoxynucleotides (by
9. B-DNA occurs most commonly in complementary base pairing
the cell. How does this form differ with the template) in a 5’ to 3’
from Z-DNA? direction starting at the RNA
B-DNA forms a right-handed turn primer.
whereas Z-DNA forms a left- d) Exonuclease
handed turn. Z-DNA is more removes the RNA primers
compact than B-DNA and has a e) Ligase
narrower diameter and shallower creates a phosphodiester bond
grooves. to seal the nick after
replacement of the RNA primer
10. What are the three possible with DNA
mechanisms for DNA replication? f) DNA polymerase I
Briefly describe each of the three replaces the RNA primer with
and state which is the mechanism DNA
employed in living systems.
Conservative  parental double 12. What are Okozaki fragments
helix remains intact (totally and why are they formed?
conserved), and directs the These are short stretches of DNA
synthesis of a ‘progeny’ double synthesized on the lagging strand
helix composed of two newly during discontinuous DNA
synthesized strands. replication. This is because DNA
Semi-conservative  the DNA polymerase can only add
strands separate and each nucleotides to a free 3’ hydroxyl
separate strand acts as a group of a growing DNA strand.
template for DNA replications These are not available when RNA
such that the new copy of the primers are added to the end of
 the lagging strand, thus requiring transcription
multiple RNA primers to be added - The product in DNA replication is
to the template and resulting in double stranded DNA, in
DNA being synthesized in short transcription is it single stranded
stretches on the lagging strand. RNA.
- In DNA replication, adenine base
13. Draw a fully annotated pairs with thymine. In
diagram illustrating the central transcription adenine base pairs
dogma of information flow of with uracil.
known examples of information
flow that does not conform to the 15. Transcribe the following
dogma. (template) DNA sequence into
RNA:
5’-
CGCGAACACTGGCGGATATATAGC
TTGCA-3’

16. Describe what is meant by

the statement that the genetic
code is degenerate but not
ambiguous.
The degeneracy in the code
refers to the fact that an amino
14. Provide three similarities and acid can be specified by multiple
three differences between the codons; however, the code is not
processes of DNA replication and redundant as a given codon still
transcription: only ever specifies one amino
similarities: acid.
- both processes use DNA as a
template
- phosphodiester bonds are
formed in both cases
- both synthesis directions are
from 5’ to 3’
differences:
- DNA is replicated by the enzyme
DNA-dependent DNA polymerase,
while transcription is carried out
by DNA dependent RNA
polymerase
- RNA polymerase (transcription)
does not require a primer as does
DNA polymerase (replication)
- DNA replication works from a
double stranded template, RNA is
transcribed from one strand
- the substrate in DNA replication
in dNTPs while NTPs are used in