Surveillance of Wolbachia Infection in Mosquito Species in Ota,

Ogun State, Nigeria

Mercy Eyitomi Tebamifor1,2, *, Wisdom Deborah Cleanclay1, Collins Ojonugwa Mamudu1,2

Olubanke O. Ogunlana1,2,*

1. Department of Biochemistry, College of Science and Technology, Covenant University, Ota,

Ogun State, Nigeria.
2. Covenant Applied Informatics and Communication - Africa Centre of Excellence (CApIC-
ACE), Covenant University, Ota, Ogun State, Nigeria

Corresponding email: [email protected]

Abstract.
Introduction: In light of climate change, proliferation of mosquito-borne diseases like dengue and
malaria is a mounting concern, driven by expanding mosquito populations as a result of favorable
environment for their survival. Addressing public health challenges caused by mosquitoes de-
mands constant innovation and sustainable solutions.
Objective: This study responds to recent reports of Wolbachia infections in West African mos-
quito species, suggesting their potential as biocontrol agents for disease vectors. We seek to iden-
tify which species has the endosymbiotic bacteria within Ota and identify mosquito species present
in the area.
Method: We conducted a comprehensive mosquito larval surveillance in Ota, Ogun State, Nigeria
using a systematic stratified random sampling method from November 2022 to March 2023 to as-
sess mosquito species distribution and Wolbachia infection. During this period, we surveyed mos-
quito larvae in various sites, rearing them to adulthood. We meticulously identified species, sex,
and capture locations then, stored specimens at -20 °C. Sodium chloride precipitation protocol was
employed to extract DNA from the mosquitoes individually. Polymerase chain reaction (PCR)
analysis was carried out using one microliter of DNA, with distilled water as negative control.
Results: Out of 1265 emerging young adult mosquitoes, 62.1% were females, while 37.1% were
males. Aedes species constituted 22.2%, Anopheles 37.2%, and Culex 40.6% of the population.
DNA analysis identified Wolbachia infection in Ae. albopictus and Ae. aegypti, with wsp gene
sizes ranging from 590 to 632 bp, confirming Wolbachia presence by sequencing.
Conclusion: Our study is the first report on Wolbachia presence in Aedes sp within this region,
which suggests that this mosquito species is a less likely vector for dengue virus and other related
infectious agents. The study highlights the importance of continuous mosquito population and
breeding site monitoring for potential biocontrol interventions against disease vectors.

Keywords: Wolbachia infection, vector control, mosquito species distribution, epidemiological

surveillance

Article Highlights
•The presence of the three primary mosquito species in Ota suggests that the area is predisposed to
diseases carried by these mosquitoes.
 •This represents Nigeria's first report of Wolbachia identification in Aedes species within this re-
gion.
•These results suggest that field populations can be used to evaluate the Wolbachia control strategy
for mosquito control initiatives.

1. Introduction

The incidence and dynamics of mosquito-borne illness transmission is significantly impacted by

climate change, which is characterized by higher temperatures, more rain, and changed weather
patterns [1,2]. The environment for mosquito development, reproduction, and survival is more
favorable as the temperature rises [3,4]. Higher temperatures can hasten the life cycle of the mos-
quito, increasing population levels and hastening the spread of disease. Climate change-related
changes in rainfall patterns can produce mosquito breeding environments [5]. Exclusion barriers
such as mosquito nets, particularly insecticide-treated bed nets (ITNs) and window screens, and
the application of insecticide sprays, particularly indoor residual spraying (IRS), are examples of
efficient and cost-effective mosquito-control methods [6].The World Mosquito Program devel-
oped a novel arboviral disease biocontrol strategy utilizing the maternally transmitted endosym-
biotic bacterium Wolbachia pipientis found in 40–60% of insect species worldwide [7]. Wol-
bachia, an obligatory intracellular alpha proteobacterium belonging to the Rickettsiaceae family,
was first identified in Culex pipiens mosquitoes, it was reported in Nigeria just recently [8]. Wol-
bachia bacteria from various strains, which are carried by many insects and nematodes, can inter-
act with their hosts in a variety of ways by modifying their biology. Parthenogenesis, feminiza-
tion, male death, and cytoplasmic incompatibility are just a few of the phenotypic changes that
Wolbachia strains can cause in insects [9]. An investigation conducted recently in Cameroon re-
vealed the presence of Wolbachia in eight species of field-collected mosquitoes [10]. Wolbachia
be detected using molecular or microbiological techniques. Polymerase chain reaction (PCR) is
commonly used to identify specific Wolbachia genes within mosquito samples. Additionally,
DNA sequencing, fluorescent in situ hybridization (FISH), and immunohistochemistry are em-
ployed to confirm the presence of Wolbachia within host tissues [11,12]. Several studies have
been done on insects within Nigeria to detect Wolbachia as shown in table one and see possible
way of exploiting it for control rather than using chemicals. The first report of Wolbachia in
Nigeria was found in Culex mosquitoes indicated in table one and further research need to be
carried out to ascertain if it is found in other mosquito species.

Table 1: Wolbachia infection detected in insects within Nigeria.

Study area Organism References

Southern Nigeria Whitefly [13]
Northern Nigeria Tse tse fly [14]
Southern Nigeria Mosquito [8]
Rising global temperatures and shifting ecosystems have created fertile ground for the expansion
of mosquito populations and the diseases they transmit, demanding innovative and sustainable
solutions to safeguard public health [15]. This research addresses the pressing need for effective
disease vector control in the face of this mounting threat. Recent reports from West African na-
tions have uncovered Wolbachia-strain infections in field mosquito species, suggesting their po-
tential as biocontrol agents against mosquito-borne diseases. The focal point of this study is Ota,
situated within Nigeria's Ogun State, a region vulnerable to mosquito-borne diseases. The pri-
mary objective is to enhance our understanding of mosquito species distribution and the preva-
lence of Wolbachia infections in the local mosquito populations. In order to achieve these goals,
a rigorous approach was undertaken for over a five-month period. We conducted a comprehen-
sive mosquito larval surveillance in various Ota locations. This included mosquito larval rearing,
sex identification, and the careful documentation of capture sites. Molecular techniques, includ-
ing DNA extraction and PCR analysis and sequencing, were employed to identify the presence
of the Wolbachia surface protein (Wsp) gene in mosquito species. The overarching objectives of
this study are to characterize the mosquito species composition in Ota and assess the prevalence
of Wolbachia infections in these mosquitoes. The results hold the potential to inform future bio-
control interventions, offering a pathway to mitigate mosquito-borne disease transmission in the
region. By pursuing these objectives, this research contributes to the ongoing battle against the
escalating public health threats associated with mosquito-borne diseases.

2. Study locations

Mosquito larval survey was carried out from November 2022 to March 2023, at separate loca-
tions in Ado/Ota Local government area of Ogun State (a tropical savannah climate region), in-
cluding Obasanjo (6.6819° N, 3.1632° E), Atan (6.6864° N, 3.0676° E), Nestle (6.6810° N,
3.1931° E) and Covenant University (6.6726° N, 3.1612° E).
3. Material and Methods
3.1 Collection and Cultivation of Mosquitoes
The acquisition of mosquito larvae was carried out using a conventional dipping method employ-
ing a scoop. In instances where dippers could not be effectively employed, especially in container
settings, the contents of the containers were transferred into plastic bowls for the straightforward
retrieval of mosquito larvae. This process of monthly larval collection persisted for a duration of
six months, covering the transition from the rainy to dry seasons (November 2022 - March 2023).
Various microhabitats, including ground pools, abandoned containers, drainage ditches, and dis-
carded tires, were surveyed for mosquito larvae at each of the research locations. The larvae ob-
tained were reared to adulthood, counted, grouped by species, sex, and locations of capture. Adult
mosquitoes were identified morphologically using the standard taxonomic keys. Identified speci-
mens were labeled and stored at -20 °C.
3.2 DNA extraction
Following homogenization of the female mosquito in livak buffer, DNA was extracted in accor-
dance with a modified livak protocol. Thermo Fisher Scientific's NanoDropTM One/OneC Micro-
volume UV-Vis Spectrophotometer was used to measure the DNA concentration before PCR
(polymerase chain reaction) amplification.
3.3 Species identification
The species of all female mosquitoes were identified using a cocktail PCR. For the Aedes mosqui-
toes’ specie identification, two primers: CP-P1A (F) and CP-P1B (R) as seen in table 2 were em-
ployed to amplify the DNA for Aedes species. 0.2 μM of each of the primers, 5 μL of 5x master-
mix (SOLIS BIODYNE, #04-12-00115), 1.5 μL of template DNA, and 17.5 μL of distilled water
to make up 25 μL total reaction volume per PCR tube. No template DNA was added to the nega-
tive control.

Table 2: List of species identification primers and Wolbachi detection primers (Adapted from
MR4)

Primer Primer sequence Expected size

name

CP-P1A (F) GTGGATCCTGTGAACTGCAGGACA-

CATG
CP-P1B (R) GTGTCGACATGCTTAAATTTAGGGGGTA 600bp/365bp (Al-
bopictus/Aegypti)
UN (F) GTGTGCCCCTTCCTCGATGT

AR AAGTGTCCTTCTCCATCCTA 313bp
GA CTGGTTTGGTCGGCACGTTT 390bp
ME TGACCAACCCACTCCCTTGA 466bp

QDA CATAATGAGTGCACAGCATA 415bp

wsp81F TGG TCC AAT AAG TGA TGAw AGA AAC

wsp691R AAA AAT TAA ACG CTA CTC CA 590-632bp

The PCR cycling conditions include 1 cycle of initial denaturation at 94 o C/5 minutes, 35 cycles
of denaturation (94 o C/ 30 seconds), annealing (54 o C/40 seconds), and elongation (72 o C/ 1
minute), 1 cycles of final elongation at 72 o C/5 minutes and hold at 4 o C. Identification of
Anopheles species, a multiplex PCR was performed employing five primers including: UN, AR,
GA,ME, and QDA.
3.4 PCR amplification and DNA sequencing
By using PCR amplification, the samples collected from each location were examined for the
presence of Wolbachia. The Wolbachia surface protein gene was amplified using the generic wsp
primers wsp81F and wsp691R to determine whether the organism was present. Depending on the
Wolbachia strain, the resulting DNA fragments varies in size from 590 to 632 bp. Sequence
analysis of 15ul amplicons positive samples was performed at Inqaba Biotech West Africa,
Ibadan, Nigeria. Sequences gotten were subjected to run in Basic Local Alignment Search Tool
(BLAST) to identify the organism.
3.5 Statistical Analysis and Ethical Consideration
We performed statistical analysis using SPSS Version 20.0 (Statistical Package for Social
Sciences) for Windows by SPSS Inc., Chicago, IL, USA, and Microsoft Excel 2016. The data
obtained from our studies was presented as percentages in tables and charts.
The research presented in this article involves investigations into the use of Wolbachia-based
strategies to control mosquito populations and mitigate the transmission of mosquito-borne
diseases. These studies necessitate ethical considerations to ensure responsible and conscientious
scientific practices. The Covenant University Health Research Ethics Committee (CUHREC)
approved the study. Approval I.D is NHREC/CU-HREC/11/04/2023

4. Results and Discussion

Sampling of mosquito breeding sites in Ota yielded several mosquito species, larvae were ob-
tained from two sites and recognized as belonging to the Anopheles species and the other two as
Aedes and Culex, making use of morphological indices [16,17]. A total larva of 1265 emerged as
young adults, out of which 62.1% were identified morphologically as females, while 37.1% were
males. Figure 1 shows the distribution within sites, mosquitoes collected varied by species ac-
cording to sites.
 Males Female
350
315
300
Number of mosquitoes

250
214
200
200

150 127
120
97 106
100 86

50

0
Covenant university Obassanjo Atan Nestle
Sites

Figure 1: Mosquito collection according to sites

Obasanjo site accounts for the collection in which culex species was found predominantly in that
area, although at the Atan site culex was found sparingly but not collected, only anopheles’
larvae were collected from this site. Aedes species accounted for a total of 183 (15%) mosquitoes
found within covenant university environment as indicated in figure 2, Anopheles gambiae 748
(59%), while culex species made up the remaining 334 (26%) of the total population.

14%
26%
Aedes
Anopheles
Culex

59%

Figure 2: Mosquito collection according to species

In this study we screened Anopheles, Aedes and Culex from each site for Wolbachia infection
gene encoding for Wolbachia surface protein. From Covenant university site (Aedes sp.) some of
the mosquitoes analyzed showed the presence of Wolbachia-infection using PCR (figure 3). The
findings revealed that the Wsp gene was present in Ae. albopictus, proving that Wolbachia was
present in some of these mosquitoes. According to our results, the overall infection rate of tested
mosquitoes was 10.30%. Sub specie identification was done to ascertain the exact species
harboring the Wolbachia.

Figure 3: Agarose gel (1.5%) of Wolbachia surface protein amplification products (expected
amplicon size is 590 to 632bp).

The sequencing results for Wsp gene yielded fragments of 590bp after sequencing. To confirm
the presence of the gene, the sequence obtained was blasted, significant alignment was gotten
after base calling using bio edit software. Sequence-based analysis used to confirm the wsp gene
exhibited high-scoring alignments and 96% similarity with the wsp gene of the Wolbachia
endosymbiont found in Aedes sp.Wolbachia, a genus of intracellular bacteria, has garnered
significant attention in recent years due to its potential for controlling mosquito-borne diseases.
Aedes mosquitoes are major vectors of diseases like dengue, Zika, and chikungunya [18]. The
analysis conducted on Aedes mosquitoes collected from an urban area within Ota revealed the
presence of Wolbachia bacteria in a proportion of the mosquito population.

In order to detect invasive mosquito species and implement mosquito control strategies,
surveillance is crucial to comprehending the risk of disease transmission in populations in sub-
Saharan Africa. The identification of important mosquito species in Ota that are vectors for
several diseases, including malaria, necessitates additional research to determine their level of
significance in mosquito-borne illnesses in the population. The presence of Wolbachia was
confirmed through polymerase chain reaction (PCR) assays targeting specific Wolbachia surface
protein. This finding is significant for several reasons; Wolbachia is known to interfere with the
reproduction of its host mosquitoes. It can reduce the ability of mosquitoes to transmit diseases
by limiting their capacity to reproduce effectively. This biological control mechanism has the
potential to reduce the mosquito population and disease transmission rates. Wolbachia-infected
mosquitoes have been shown to have reduced vector competence for certain pathogens [19]. As a
result, the presence of Wolbachia in Aedes mosquitoes can significantly decrease the
transmission of diseases such as dengue and Zika to human populations. Wolbachia-based
control methods are considered environmentally friendly and sustainable compared to chemical
insecticides, which have adverse effects on ecosystems and often lead to insecticide resistance.
This discovery could potentially offer a promising avenue for sustainable mosquito population
management within this community. It has the potential to benefit public health by reducing the
burden of mosquito-borne diseases and could lead to a decrease in the number of cases,
hospitalizations, and fatalities associated with mosquito-borne diseases [20]. The discovery of
Wolbachia in Aedes mosquitoes in this area is a significant development in the field of vector-
borne disease control [21]. It opens several possibilities for reducing disease transmission and
improving public health. This finding paves the way for the development of Wolbachia-based
mosquito control programs in areas with high mosquito population. Such programs may involve
the release of Wolbachia-infected mosquitoes to establish a population with reduced disease
transmission potential. Successful implementation of Wolbachia-based control methods will
require community engagement and support. Public education campaigns will be essential to
ensure that communities understand the benefits and safety of these methods. Continuous
monitoring and evaluation of Wolbachia-infected mosquito populations will be crucial to assess
the long-term effectiveness of this control strategy and its impact on disease transmission rates
[22]. Further research is needed to understand the dynamics of Wolbachia infections in Aedes
mosquitoes, including factors influencing the spread of Wolbachia and potential interactions with
other mosquito control methods.

5. Conclusion and Recommendations

The identification of Wolbachia in Aedes mosquitoes residing in the Ota region signifies a
significant breakthrough in the battle against mosquito-borne diseases. This revelation offers a
promising avenue for curtailing disease transmission, setting the stage for the development of
sustainable and ecologically responsible mosquito control approaches with far-reaching public
health implications. Nevertheless, unlocking the full potential of this discovery in the crusade
against vector-borne diseases demands concerted efforts. Collaboration between scientists,
public health authorities, and local communities is imperative. Such partnerships are essential for
further research, the refinement of strategies, and the effective implementation of biocontrol
interventions. As we collectively harness the power of this finding, we move one step closer to
reducing the burden of mosquito-borne diseases and safeguarding the well-being of vulnerable
populations. The journey towards a world less threatened by vector-borne diseases is ongoing,
and the promise of Wolbachia serves as a beacon of hope, guiding our path toward a healthier
future.

Acknowledgment
We wish to express our heartfelt gratitude to CApIC-ACE (Covenant Applied Informatics and
Communication – Africa Centre of Excellence) for their unwavering support throughout our
research endeavor. Their financial assistance and research guidance played a pivotal role in
making this study possible. We also extend our sincere appreciation to CUCRID (Covenant
University Centre for Research, Innovation and Development) for their valuable support in the
publication of this research. Their commitment to fostering collaboration and promoting research
excellence has greatly contributed to the dissemination of our findings.

Competing interests

The authors declare no competing interests.

Authorship Contribution Statement

Mercy Tebamifor: Conceptualization, Investigation, Writing – original draft. Collins

Mamudu: Investigation. Wisdom Cleannclay: Supervision and editing. Olubanke Ogunlana:
Conceptualization (supporting) and supervision.

Data availability

The datasets generated during and/or analysed during the current study are available from the
corresponding author on reasonable request.

References

[1] Semenza J C, Rocklöv J and Ebi K L 2022 Climate Change and Cascading Risks from
Infectious Disease Infect. Dis. Ther. 11 1371–90

[2] Wang Y, Yim S H L, Yang Y and Morin C W 2020 The effect of urbanization and climate
change on the mosquito population in the Pearl River Delta region of China Int. J.
Biometeorol. 64 501–12

[3] Adedeji E O, Ogunlana O O, Fatumo S, Aromolaran O T, Beder T, Koenig R and Adebiyi

E 2023 The Central Metabolism Model of Anopheles gambiae: A Tool for Understanding
Malaria Vector Biology Biotechnol. Approaches Sustain. Dev. Goals 229–48

[4] Ogden N H and Gachon P 2019 Climate change and infectious diseases: What can we
expect? Can. Commun. Dis. Rep. Releve Mal. Transm. Au Can. 45 76–80
[5] Filho W L, Scheday S, Boenecke J, Gogoi A, Maharaj A and Korovou S 2019 Climate
change, health and mosquito-borne diseases: Trends and implications to the pacific region
Int. J. Environ. Res. Public. Health 16

[6] Efunshile A M, Ojide C K, Igwe D, Onyia B, Jokelainen P and Robertson L J 2021

Mosquito control at a tertiary teaching hospital in Nigeria Infect. Prev. Pract. 3 100172–
100172

[7] Jeffries C L and Walker T 2016 Wolbachia Biocontrol Strategies for Arboviral Diseases
and the Potential Influence of Resident Wolbachia Strains in Mosquitoes Curr. Trop. Med.
Rep. 3 20–20

[8] Ogunbiyi T S, Eromon P, Oluniyi P, Ayoade F, Oloche O, Oguzie J U, Folarin O, Happi C

and Komolafe I 2019 First report of Wolbachia from field populations of Culex mosquitoes
in south-western Nigeria Afr. Zool. 54 181–5

[9] Nugapola N W N P, De Silva W A P P and Karunaratne S H P P 2017 Distribution and

phylogeny of Wolbachia strains in wild mosquito populations in Sri Lanka Parasit. Vectors
10

[10] Bamou R, Diarra A Z, Mayi M P A, Djiappi-Tchamen B, Antonio-Nkondjio C and Parola

P 2021 Wolbachia detection in field-collected mosquitoes from cameroon Insects 12

[11] Bellone R, Lechat P, Mousson L, Gilbart V, Piorkowski G, Bohers C, Merits A, Kornobis

E, Reveillaud J, Paupy C, Vazeille M, Martinet J-P, Madec Y, De Lamballerie X, Dauga C
and Failloux A-B 2023 Climate change and vector-borne diseases: a multi-omics approach
of temperature-induced changes in the mosquito. J. Travel Med. 30

[12] Zhou W, Rousset F and O’Neill S 1998 Phylogeny and PCR-based classification of
Wolbachia strains using wsp gene sequences Proc. R. Soc. B Biol. Sci. 265 509–15

[13] Ghosh S, Bouvaine S and Maruthi M 2015 Prevalence and genetic diversity of
endosymbiotic bacteria infecting cassava whiteflies in Africa BMC Microbiol. 15

[14] Mfopit Y M, Engel J S, Chechet G D, Ibrahim M A M, Signaboubo D, Achukwi D M,

Mamman M, Balogun E O, Shuaibu M N, Kabir J and Kelm S 2023 Molecular detection of
Sodalis glossinidius, Spiroplasma species and Wolbachia endosymbionts in wild population
of tsetse flies collected in Cameroon, Chad and Nigeria BMC Microbiol. 23 260–260

[15] Adegbite G, Edeki S, Isewon I, Dokunmu T, Rotimi S, Oyelade J and Adebiyi E 2022
Investigating the epidemiological factors responsible for malaria transmission dynamics
IOP Conf. Ser. Earth Environ. Sci. 993 012008–012008

[16] Coetzee M 2020 Key to the females of Afrotropical Anopheles mosquitoes (Diptera:
Culicidae) Malar. J. 19 70
[17] Rueda L M 2004 Pictorial keys for the identification of mosquitoes (Diptera: Culicidae)
associated with Dengue Virus Transmission Zootaxa 589

[18] Hassan M R, Azit N A, Fadzil S M, Ghani S R A, Ahmad N and Nawi A M 2021

Insecticide resistance of Dengue vectors in South East Asia: a systematic review Afr.
Health Sci. 21 1124–40

[19] Gonçalves D D S, Hooker D J, Dong Y, Baran N, Kyrylos P, Iturbe-Ormaetxe I, Simmons

C P and O’Neill S L 2019 Detecting wMel Wolbachia in field-collected Aedes aegypti
mosquitoes using loop-mediated isothermal amplification (LAMP) Parasit. Vectors 12 1–5

[20] Semenza J C and Suk J E 2018 Vector-borne diseases and climate change: A European
perspective FEMS Microbiol. Lett. 365

[21] Messina J P, Brady O J, Golding N, Kraemer M U G, Wint G R W, Ray S E, Pigott D M,

Shearer F M, Johnson K, Earl L, Marczak L B, Shirude S, Davis Weaver N, Gilbert M,
Velayudhan R, Jones P, Jaenisch T, Scott T W, Reiner R C and Hay S I 2019 The current
and future global distribution and population at risk of dengue Nat. Microbiol. 4 1508–15

[22] Surasiang T, Chumkiew S, Martviset P, Chantree P and Jamklang M 2022 Mosquito larva
distribution and natural Wolbachia infection in campus areas of Nakhon Ratchasima,
Thailand Asian Pac. J. Trop. Med. 15 314–21