Scribd
Upload
2 views

Lab report requirements

The lab report consists of two main components: a report on PCR and AGE techniques, including an introduction, experimental operations, and a discussion, worth 10 marks; and homework questions related to PCR, primer design, and gel electrophoresis, also worth 10 marks. Students are required to answer specific questions and demonstrate understanding of the techniques and their applications. The report emphasizes the importance of proper experimental procedures and troubleshooting in molecular biology techniques.

Uploaded by

Haley leung
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as DOCX, PDF, TXT or read online on Scribd
2 views

Lab report requirements

The lab report consists of two main components: a report on PCR and AGE techniques, including an introduction, experimental operations, and a discussion, worth 10 marks; and homework questions related to PCR, primer design, and gel electrophoresis, also worth 10 marks. Students are required to answer specific questions and demonstrate understanding of the techniques and their applications. The report emphasizes the importance of proper experimental procedures and troubleshooting in molecular biology techniques.

Uploaded by

Haley leung
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as DOCX, PDF, TXT or read online on Scribd
You are on page 1/ 1

Your lab report (20 marks) should include the following two components:

Item 1: Report for lab session: (10 marks)


1. Introduction: Briefly introduce PCR and AGE techniques and their biomedical applications. You
are required to answer 4 out of 7 questions you may think about (from the file we uploaded on
blackboard titled “File BMEG 5840 Lab 7 - Manual and lab sheets (2025).pdf”) and include them in
your report.
2. Experimental operation:
1) Describe the process for PCR and AGE
2) Describe the phenomenon during experiment procedure.
3. Discussion and conclusion.

Item 2: Homework: (10 marks)


Answer questions below:
1. Why do we need two primers in PCR? Why do we need to heat up the mixture with 95oC for 5 min
at the beginning, while standard PCR protocol always suggest 1 min for DNA separation? (2 marks)

2. Here is part of a genome containing our gene of interests (highlighted in red):


5’CGGGTTCGCAACTTCGTGGTTAGTTGGCATGCGCTTTCCTTACACTGTGATAACAAAC
ATCGTTAAACCAAATACTTCGTCTTGGCAACTTCACAATAGGTATTCTGGGTTGAACG
TAAGCTCGTTAACATCGCCCGATTCGTGTCTGCGATGAATGTCTACGT -3’ Please design
two primers (one forward and one reverse, 5’ to 3’) to amplify the gene of interests. Also, list all the
considerations when designing the primers. (2 marks)

3. A student found no bands showed up but the DNA ladder after gel electrophoresis, could you
suggest four reasons which lead to such results? (2 marks)

4. A smear, instead of a clear band, was observed on your gel. What would be the most likely
reason(s)? (2 marks)

5. If the gel electrophoresis is performed in water, instead of 1X TAE buffer, would it still work? If
not, please explain why? (2 marks)

You might also like