UNITWISE WEIGHTAGE

S. No. UNIT TOTAL WEIGHTAGE

1. Reproduction 16 Marks

2. Genetics and Evolution 15 Marks

3. Biology and Human Welfare 14 Marks

4. Biotechnology and its 10 marks

Applications
5. Ecology and Environment 15 Marks

Total 70 Marks
 UNIT – I
Reproduction
 1. Reproduction
(i) Reproduction in Organisms
Reproduction, a characteristic feature of all organisms for continuation of species; modes of
🠶
reproduction - asexual and sexual reproduction; asexual reproduction – binary fission, sporulation,
budding, gemmule formation, fragmentation; vegetative propagation in plants.
Definition of life span; life span of a few organisms (banana, rice, rose, banyan, butterfly,
🠶
fruit fly,tortoise, crocodile, parrot, crow, elephant, dog, horse, and cow).
Asexual reproduction – definition, types (binary fission in Amoeba and Paramoecium, budding
🠶
in yeast and Hydra, conidia in Penicillium, zoospores in Chlamydomonas, gemmules in sponges),
definition of clone.
Vegetative propagation – definition, vegetative propagules (tuber of potato, rhizome of ginger,
🠶
bulbil of Agave, leaf buds of Bryophyllum, offset of water hyacinth, runner of grass, sucker of
pineapple, bulb of onion).
🠶 Sexual reproduction:
Definition, Plants –, phases of life cycle (juvenile/vegetative, reproductive and senescence), unusual flowering
🠶
phenomenon (bamboo and Strobilanthes kunthiana). Animals – seasonal breeders (definition and examples).
Events in sexual reproduction, prefertilisation (gametogenesis and gamete transfer in plants and animals); chromosome
number in the cells of house fly, fruit fly, butterfly, human beings, rat, dog, maize, apple, onion; fertilization (definition, types -
external and internal), post-fertilisation (embryogenesis), definition and example of parthenogenesis, differences between
asexual and sexual reproduction.
 1. Reproduction
(ii) Sexual reproduction in flowering plants
Flower structure; development of male and female gametophytes; pollination – types,
🠶
agencies and examples; outbreeding devices; pollen-pistil interaction; double
fertilization; post fertilization events - development of endosperm and embryo,
development of seed and formation of fruit; special modes - apomixis, parthenocarpy,
polyembryony; Significance of seed dispersal and fruit formation.
🠶 Pre-fertilisation structures and events.
Structure of microsporangium, T.S. of anther, microsporogenesis, structure and
🠶
development of pollen grain, viability of pollen grain, economic importance of pollen
grain. Pistil – structure of megasporangium (L.S. of anatropous ovule), megasporogenesis,
structure and development of female gametophyte.
Types of pollination (autogamy, chasmogamy, cleistogamy, geitonogamy, xenogamy),
🠶
adaptations in flowers pollinated by wind, water and insects. Advantages of self and
cross-pollination. Contrivances for prevention of self pollination.
🠶 Pollen-pistil interaction in terms of incompatibility/compatibility),
Events leading to fertilisation, definition of triple fusion and double fertilization, changes
🠶
in the ovule and ovary for seed and fruit formation. Significance of double fertilization
 1. Reproduction
(ii) Sexual reproduction in flowering plants
🠶 Flower structure; development of male and female gametophytes; pollination –
types, agencies and examples; outbreeding devices; pollen-pistil interaction; double
fertilization; post fertilization events - development of endosperm and embryo,
development of seed and formation of fruit; special modes - apomixis,
parthenocarpy, polyembryony; Significance of seed dispersal and fruit formation.
🠶 Fruits to be classified into true and false, structure (LS) of a typical fruit (mango and
coconut). Internal structure of dicot (bean) and monocot (maize) seed. Definition
differences and examples albuminous and non-albuminous seed
🠶 Significance of seed and fruit formation. Significance of dispersal of seeds.
🠶 Post-fertilisation events - embryo formation (monocot and dicot); types of
endosperm (cellular, nuclear and helobial); Definition of perisperm.
🠶 Apomixis, polyembryony, parthenocarpy to be explained briefly.
 Sexual Reproduction in flowering plants
Pre-fertilisation structures and events
Structures: Reproductive organs:
Androecium and gynoecium recap
Events: Microsporogenesis (Developments of microspores)
Development of microsporangium (anther)
T. S. of anther (Developments of pollen grain)
Structure and development of pollen grain
(Development of male gametophyte)
 Pollen grains
🠶V i a b i l i t y of pollen grain
🠶H i g h l y variable in different plants
🠶A b o u t 30 minutes in wheat and rice
🠶 A few months to years in Rosaceae, Solanaceae, Leguminosae

🠶E c o n o m i c importance of pollen grain

🠶S o u r c e of allergy
🠶R i c h in nutrients
🠶P o l l e n tablets available as food supplements
🠶K n o w n to increase performance in athletes and race horses
🠶C r y o p r e s e r v e d for crop breeding
STRUCTURE OF OVULE

Helium

Anatropous
STRUCTURE OF OVULE

Nucellus

Anatropous
Embryo sac
 Megasporogenesis
(development of female gametophyte)
 Pollination
🠶 Definition: Transfer of pollen grain from anther to stigma of the same species.
🠶 Autogamy
🠶 Chasmogamy
🠶 Cleistogamy
🠶 Geitonogamy
🠶 Xenogamy
🠶 Types:
🠶S e l f - polination — Cross-pollination
🠶A u t o g a m y : Occurs ● Wind (Anemophily)
by
🠶 Homogamy ● Water (Hydrophily)
🠶Cleistogamy ● Entomophily
• Bud pollination ● Chiropterophily
🠶G e i t o n o g a m y ● Malacophily
Types of pollination
 Adaptations for Wind pollination
🠶F e a t u r e s of wind-pollinated flowers
🠶I n c o n s p i c u o u s (not showy)
🠶D e v o i d of fragrance and nectar
🠶P r o d u c e large amount of pollen grains
🠶V e r s a t i l e anthers
🠶P o l l e n grains are dry, light-weight, winged
🠶L a r g e and feathery stigma
🠶F l o w e r s found in clusters (inflorescence)
Examples of wind pollinated flowers
 Adaptations for Insect pollination

🠶F e a t u r e s of insect-pollinated flowers
🠶B r i g h t l y colored (showy)
🠶F r a g r a n t
🠶W e l l developed nectaries
🠶P o l l e n grains are sticky with rough surface
🠶S t i c k y stigma
🠶F l o w e r s found in clusters (inflorescence)
🠶S p e c i a l mechanisms (Salvia, Dracaena)
 Examples of insect pollinated flowers
🠶 Lever mechanism

🠶 Yucca/
Pronuba
Examples of insect pollinated flowers
Adaptations for Water-pollination
🠶F e a t u r e s of water-pollinated flowers
🠶B u o y a n t
🠶L o n g style
🠶F l o w e r s not colorful
🠶 N o nectar
🠶P o l l e n s protected from getting wet
by mucilaginous covering
 Self-pollination
Advantages Disadvantages
1. Maintains purity of race

2. Sure method

3. No wastage of pollen grains

4.

Cross Self-pollination
Advantages Disadvantages
1. Helps to eliminate harmful traits

2. Gives rise to variations

3. Gives rise to hybrid vigor
(heterosis)
4. Increased adaptability
Contrivances for preventing self-pollination
(Out-breeding devices)
Nature favors cross-pollination: Self
🠶 1 . Dichogamy: Protogyny, protandry
🠶 2 . Herkogamy
🠶 3 . Heterostyly
🠶 4 . Self-incompatibility
🠶 5 . Unisexuality (Dioecy)
 Pollen-pistil interaction
🠶G e n e t i c feature
🠶C h e m i c a l l y mediated
🠶S t i g m a ensures only intra-specific
fertilisation by allowing the germination of
pollen grain of only its own species
 Fertilisation

Significance of double fertilisation

Changes in the ovule and ovary for seed and
fruit formation
🠶 Sepals and petals: Fall off
🠶 Stamens, style and stigma: Fall off (dry) after polination
🠶 Ovary: Forms fruit
🠶 Ovary wall: Pericarp
🠶 Ovule: Seed
🠶 Funicle: Stalk of the seed
🠶 Hilum: Hilum of the seed
🠶 Outer integument: Testa
🠶 Inner integument: Tegmen
🠶 Synergids: Destroyed
🠶 Egg cell: Embryo
🠶 Antipodals: Perish
🠶 Secondary nucleus: Endosperm
Definition bank
1. Double fertilisation
2. Triple fusion
3. Apomixis
🠶 The development of an embryo without meiosis and syngamy
(fertilization).

4. Polyembryony
🠶 The production of two or more embryos in one seed

5. Parthenocarpy
🠶 The process of formation of seedless fruits without fertilisation.

6. Perisperm
POST-FERTLISATION EVENTS
Dicot embryogenesis
Monocot embryogenesis

3 August 15, 2024

5
 Types of Endosperm
🠶N u c l e a r : The first few nuclear divisions are not folowed
by cell wall formation, thus nuclei remain free in the cytoplasm
of the embryo sac. Later cell wall may be formed in a
simultaneous manner or may never be formed. Example:
Polypetalous dicots (Coconut, Arachis hypogea)
🠶C e l l u l a r : Each nuclear division is followed by
wall formation (successive). Example: Gamopetalous
dicots.
🠶H e l o b i a l : Intermediate between nuclear and celular.
In the chalazal chamber very few divisions occur; this region
often degenerates. In the micropylar chamber free nuclear
divisions result in cellular endosperm. Example: Order 3
Helobiale.
August 15, 2024
6
 FRUIT
🠶T R U E / FALSE
🠶S T R U C T U R E OF MANGO AND COCONUT
🠶I N T E R N A L STRUCTURE OF
🠶D I C O T SEED (BEAN)
🠶M O N O C O T SEED (MAIZE)
🠶DEFINITION, DIFFERENCE, EXAMPLES
🠶A L B U M I N O U S / NON-ALBUMINOUS SEEDS
 SEED
🠶F e r t i l i z e d ovule
🠶N o n - albuminous:(Syn Non-endospermic)
🠶D e f i n i t i o n : Endosperm consumed during
development
🠶E x a m p l e s : Pea, ground nut
🠶A l b u m i n o u s : (Syn Endospermic)
🠶D e f i n i t i o n : Endosperm persists
🠶E x a m p l e s : wheat, maize, barley, castor, sunflower
🠶D i f f e r e n c e s in a
tabular fo rm
 Significance
🠶S i g n i f i c a n c e of seed and fruit formation
🠶D i s p e r s a l to new locations
🠶H e l p s to survive during adverse conditions
(Vernalisation)
🠶P r o v i d e s sufficient time for proper development of
the embryo
🠶S i g n i f i c a n c e of dispersal of seeds
🠶A v o i d s over-crowding, thus limits intra-specific
competition
1. For development of 100 grains of wheat, how many meiotic divisions are
required?

100 megaspores and 25 microspores Formula = (n + n/4)

Answer: 125

2. What would be the number of chromosomes in pollen grain, endosperm,

nucellus, synergids, antipodals and embryo of maize (root cells have 20)?
Answer: Pollen grain 10,
endosperm 30,
nucellus 20,
synergids 10,
antipodal 10,
embryo 20
 APPLICATION-BASED QUESTIONS
🠶 I n the anther of China rose, each pollen sac contains
100 microspore mother cells. How many pollen grains
will be formed in the anther?
🠶H o w many microspores will develop from a dithecous
anther, if each microsporangium has 100 PMCs?
🠶 A n anther has 1200 pollen grains. How many polen
mother cells must have been there to produce them?
 APPLICATION-BASED QUESTIONS
🠶 I n the anther of China rose, each pollen sac contains
100 microspore mother cells. How many pollen grains
will be formed in the anther?
🠶H o w many microspores will develop from a dithecous
anther, if each microsporangium has 100 PMCs?
🠶 A typical anther has 1200 pollen grains. How many
pollen mother cells must have been there to produce
them?
Reproduction
(iii)Human Reproduction
 1. Reproduction
(iii)Human Reproduction
Male and female reproductive systems; microscopic anatomy of testis and ovary; gametogenesis
🠶
- spermatogenesis and oogenesis; menstrual cycle; fertilisation, embryo development upto
blastocyst formation, implantation; pregnancy and placenta formation (elementary idea);
parturition (elementary idea); lactation (elementary idea).
Organs of male and female reproductive system and their functions; internal structure of testis and
🠶
ovary to be taught with the help of diagrams
Gametogenesis spermatogenesis (including spermiogenesis and spermiation) oogenesis; hormonal
🠶
control of gametogenesis, structure of sperm and mature ovum
Menstrual cycle – different phases and hormone action, differences between oestrous and
🠶
menstrual cycle, menarche and menopause
🠶 Physico-chemical events during fertilisation, Implantation
Embryonic development up to blastocyst formation, important features of human embryonic
🠶
development (formation of heart, limbs, digits, appearance of hair on head, eyelashes, separation
of eye lids, external genital organs and first movement of foetus; with reference to time period)
placenta and its functions.
🠶 Parturition; lactation – hormonal control and importance.
 REPRODUCTIVE SYSTEM
🠶P r i m a r y reproductive parts – testes & ovaries
🠶A c c e s s o r y reproductive parts – structures which help in transfer
& meeting of sex cells
🠶M a l e Reproductive System
🠶 W h y testes descend before birth? – inguinal canal
🠶L o c a t i o n and Functions of various parts
🠶T e s t e s – Seminiferous tubules
🠶I n t e r s t i t i a l cells (Leydig) / Sertoli cells
🠶S e m i n a l vesicles, prostate glands, Cowper‘s glands, urethral glands
August 15, 2024

7
Cowper’s gland (Bulbourethral gland) It secretes alkaline mucus that lubricates the urethra to
reduce friction during ejaculation of semen.
 August 15, 2024

50
 Female Reproductive System
🠶 Ovaries & other parts & functions

5 August 15, 2024

3
54

August 15, 2024

Parts of a sperm & their function

Definitions
1. SPERMIOGENESIS

2. SPERMIATION 55
August 15, 2024
5
6
 MENSTRUAL CYCLE
🠶M e n s t r u a l phase:
🠶H i g h level of progesterone inhibits production of LH
🠶W i t h d r a w a l of LH causes regression of CL and decline in progesterone
level
🠶E n d o m e t r i a l lining sloughed off
🠶M e n s t r u a l flow starts
🠶F o l l i c u l a r phase: Proliferative phase
🠶S e c r e t i o n of FSH from anterior pituitary
🠶F o r m a t i o n & maturation of Graafian follicle
🠶S e c r e t i o n of estrogen by follicular cells
🠶R e p a i r of endometrium, increase in the thickness
🠶I n c r e a s e d estrogen inhibits FSH production
🠶S t i m u l a t e s pituitary to secrete 5 August 15, 2024
LH 7
 MENSTRUAL CYCLE
🠶O v u l a t i o n
🠶I n d u c e d by LH surge
🠶M a t u r e ovum propelled into uterus
🠶L u t e a l phase: Secretory phase
🠶 L H stimulates formation of corpus luteum
🠶 C L secretes progesterone
🠶E n d o m e t r i u m becomes thicker, vascular
🠶G l a n d s grow rapidly and secrete uterine
milk
🠶P r e p a r e d for implantation
Menarche and Menopause 58 August 15, 2024
August 15, 2024 59
August 15, 2024 60
Differences between menstrual and estrus cycle

Menstrual cycle Estrus cycle

Primates Non-primate mammals
Loss of blood No loss
28 days Variable
Receptive throughout Only during heat (estrus)
2. If the length of the menstrual cycle is 38 days, ovulation will take
place on which day?
Length of luteal phase – 14 days
Answer: 38 – 14 = 24th day
Read the graph given below and correlate the uterine events
that take place according to the hormonal levels on:
(a) (i) 6 – 12 days
(ii) 16 – 25 days
(iii) 13th – 14th days (if the ovum is not fertilised.
(b) Specify the sources of the hormones mentioned in the graph
FERTILIZATION

65 August 15, 2024

 PHYSIO – CHEMICAL EVENTS
DURING FERTILISATION
🠶 Insemination, semen clots, enters uterus by peristalsis, liquefied
🠶 The changes which a sperm undergoes to prepare itself for fertilization
are called CAPACITATION
🠶 Sperm releases anti-fertilizin, reacts with fertilizin of ovum
🠶 Acrosome produces hyaluronidase, dissolves intercellular matrix of (corona
radiata) follicle cells
🠶 Plasma membrane of sec. oocyte dissolves
🠶 Sperm enters sec. oocyte
🠶 Formation of fertilisation membrane/ Cortical reaction
🠶 Second meiosis completed, second polar body released
🠶 Sperm nucleus and egg nucleus fuse (amphimixis) to form zygote 66 August 15, 2024
 DEVELOPMENT
🠶C l e a v a g e
🠶M o r u l a
🠶B l a s t o c y s t
🠶F u n c t i o n of amniotic
fluid
🠶I m p l a n t a t i o n

August 15, 2024

67
6 August 15, 2024
8
69 August 15, 2024
🠶E x t r a - embryonic / Foetal membranes
🠶A m n i o n , Chorion, Allantois, Yolk sac
🠶F u n c t i o n of placenta
🠶D i f f u s i o n of respiratory gases, nutrients, elimination of wastes from foetus
to mother, produces oestrogen & progesterone, barrier layer
🠶P a r t u r i t i o n
🠶H o r m o n a l role in parturition – oxytocin, relaxin
🠶L a c t a t i o n
🠶I m p o r t a n c e / Colostrum
🠶H o r m o n e s (Prolactin, oxytocin)
🠶G e s t a t i o n :
🠶H u m a n s (9 months) 7 August 15, 2024
1
 Landmarks of development
🠶A f t e r one month of pregnancy, the embryo’s heart is formed.
🠶 By the end of the second month of pregnancy, the foetus
develops limbs and digits.
🠶 By the end of 12 weeks (first trimester), most of the major organ
systems are formed, for example, the limbs and external
genital organs are well-developed.
🠶T h e first movements of the foetus and appearance of hair on
the head are usually observed during the fifth month.
🠶 By the end of 24 weeks (second trimester), the body is covered
with fine hair, eye-lids separate, and eyelashes are formed.
🠶 By the end of nine months of pregnancy, the foetus is fuly
developed and is ready for delivery.
 Reproduction

(iv) Reproductive Health

 (iv) Reproductive Health
Need for reproductive health and prevention of Sexually Transmitted Diseases (STDs); birth
🠶
control - need and methods, contraception and medical termination of pregnancy (MTP);
amniocentesis; infertility and assisted reproductive technologies - IVF, ZIFT, GIFT (elementary
idea for general awareness).
🠶 Definition of reproductive health
🠶 programs of reproductive health (family planning, RCH)
🠶 population explosion - role of government in controlling the population,
🠶 contraceptives methods and their methods of action
🠶 (natural-periodic abstinence, withdrawal or coitus interruptus, lactational amenorrhea;
🠶 artificial – barriers, IUDs, oral pills, implants and surgical methods
🠶 definition of medical termination of pregnancy (MTP) and reasons for it
🠶 causes of infertility
🠶 Amniocentesis and its role in detecting genetic defects.
Assisted reproductive technologies: IVF, IUT, ZIFT, ICSI, GIFT, artificial insemination (AI, IUI).
🠶
- definition and application only.
🠶 Causes, symptoms and methods of prevention of sexually transmitted diseases
(gonorrhoea,
syphilis, genital herpes, chlamydiasis, genital warts, trichomoniasis, hepatitis- B, AIDS).
 REPRODUCTIVE HEALTH
🠶 Definition of reproductive health:
🠶 Ability of the person to produce healthy offspring
🠶 Total well-being in all aspects of reproduction, i.e., physical, physiological,
psychological and social.
🠶 Programs of reproductive health (family planning, RCH)
🠶 Goals
🠶 Creating awareness about various aspects of reproductive health
🠶 Creating awareness about child health, breast feeding and vaccination
🠶 Providing facilities and support for building a reproductively healthy society
🠶 Agencies
🠶 Government (Dept. of Health and Family Welfare)
🠶 NGOs
 REPRODUCTIVE HEALTH
🠶P o p u l a t i o n Explosion
🠶C a u s e s
🠶Consequences
🠶R o l e of Govt. in Controlling the Population
🠶A w a r e n e s s
🠶Incentives
🠶R a i s i n g marriageable age
 REPRODUCTIVE HEALTH
CONTRACEPTIVE METHODS
Features of ideal contraceptive agent
🠶N a t u r a l :
🠶P e r i o d i c abstinence
🠶Withdrawal (Coitus interruptus)
🠶Lactational amenorrhea
 REPRODUCTIVE HEALTH
CONTRACEPTIVE METHODS
🠶Artificial
🠶Barriers: Condoms, femidoms, diaphragms, c
a
p
s
🠶Spermicidal agents:
🠶t h a t kill spermatozoa (sperm).
🠶C r e a m s , jellies, foams etc.
🠶E x a m p l e : The chemical nonoxynol-9 (N-9).
 REPRODUCTIVE HEALTH
CONTRACEPTIVE METHODS
🠶Artificial
🠶I U D s : Types: Mechanism
🠶N o n - medicated: Lippe’s loop
🠶C o p p e r releasing: CuT, Cu7, Multiload-
375
🠶H o r m o n e releasing: Progestasert, LNG-
20
🠶Advantages:
🠶E f f e c t i v e , Easy to use, Reversible
🠶Disadvantages
 REPRODUCTIVE HEALTH
CONTRACEPTIVE METHODS
🠶Artif i cial
🠶 Pills: Prevent ovulation, fertilisation (thick mucus), and implantation
🠶M i n i pillls: Only progesterone, less side effects, reliable, reversible
🠶C o m b i n e d pills: Synthetic Estrogen +Progesterone
🠶E m e r g e n c y pills
🠶N o n - steroidal: Saheli
🠶 Implants: Sustained release for longer periods
🠶 Surgical methods: Effective but irreversible
🠶T u b e c t om y , Vasectomy
🠶G o n a d ? ? ?
 MEDICAL TERMINATION OF
PREGNANCY
🠶V o l u n t a r y termination before foetus viable
🠶R E A S O N S :
🠶C o n g e n i t a l defect
🠶u n w a n t e d conception
🠶S a f e up to 12 weeks of pregnancy
🠶 METHOD
 REPRODUCTIVE HEALTH
Infertility
🠶 Definition: Inability to reproduce
🠶 Causes:
🠶 Oligospermia, azoospermia
🠶 Poor motility of sperm
🠶 Malformed sperm
🠶 Blockage of oviduct, sperm duct
🠶 pH of uterus, vagina
🠶 Ovulation disorders
🠶 PID, endometriosis
🠶 Genetic disorders (e.g., cystic fibrosis)
🠶 STDs
CAUSES OF INFERTILITY
🠶F e m a l e s
🠶P o o r egg cell production
🠶B l o c k a g e s of oviduct
🠶U n s u c c e s s f u l implantation
🠶M a l e s
🠶L o w sperm count
🠶S p e r m abnormalities
🠶B l o c k a g e s of sperm duct
 AMNIOCENTESIS
🠶A m n i o t i c fluid aspirated, centrifuged, cells cultured
& analysed for karyotype abnormalities
🠶R o l e in detecting genetic defects
🠶A n a l y s i s of karyotype to detect defects
🠶H i g h risk genetic defect can be identified and counseling
can be done
🠶M i s u s e : Foetal sex determination and female foeticide
 ASSISTED REPRODUCTIVE TECHNOLOGIES
ART
🠶I V F – In vitro fertilization
🠶 Carried outside the body in glass container
🠶 Embryo transfer (ET) in uterus through IUT

🠶Z I F T – Zygote intrafallopian transfer

🠶 Transfer of zygote at 8-blastomere stage directly into the fallopian tubes

🠶G I F T – Gamete intra fallopian transfer

🠶 Washed sperms and ova are transferred into the fallopian tube with the help of laparoscope

🠶I C S I – Intra-cytoplasmic sperm injection

🠶 A I (Artificial insemination, IUI)
 REPRODUCTIVE HEALTH
Sexually Transmitted Diseases
🠶 Viral
🠶 Herpes: Herpes simplex virus
🠶 Genital warts: Human papilloma virus (HPV)
🠶 Hepatitis – B: HBV
🠶 AIDS: HIV
🠶 Bacterial
🠶 Gonorrhoea: Neisseria gonorrhoeae
🠶 Syphilis: Treponema pallidum
🠶 Chlamydia infection: Chlamydia trachomatis
🠶 Protozoal
🠶 Trichomoniasis: Trichomonas vaginalis
 REPRODUCTIVE HEALTH
Sexually Transmitted Diseases
STD Causative agent Symptom Prevention

Genital Herpes Herpes simplex virus Ulcers in urethra; pain, itching and sores in genital area Physical barriers

AIDS HIV Weak immune system, loss of body weight, night sweats Avoid sharing of
surgical needles
Genital warts Human papilloma Appearance of several small lumps around genital Physical barriers
virus (HPV) organs, bleeding from anus or genitals
Hepatitis – B Hepatitis B Virus Dark urine, jaundice, nausea Avoid sharing of
surgical needles
Chlamydiasis Chlamydia Discharge from the cervix, pain and swelling in testes Physical barriers
trachomatis
Gonorrhoea Neisseria Discharge of pus from external genitals, swelling at the Physical barriers
gonorrhoeae opening of urethra
Syphilis Treponema pallidum Skin rashes, swollen lymph nodes around genitals Physical barriers

Trichomoniasis Trichomonas Foul smelling discharge from vagina, itching, swelling Physical barriers
vaginalis
2. Genetics and Evolution
(i) Principles of inheritance and variation
 2. Genetics and Evolution
(i) Principles of inheritance and variation
Heredity and variation: Mendelian inheritance; deviations from Mendelism - incomplete dominance, co-
🠶
dominance, multiple alleles and inheritance of blood groups, pleiotropy; elementary idea of polygenic
inheritance; chromosomal theory of inheritance; sex determination ; linkage and crossing over; sex linked
inheritance; Mendelian disorders in humans; chromosomal disorders in humans.
Explanation of the terms heredity and variation; Mendel's Principles of inheritance; reasons for Mendel's
🠶
success; definition of homologous chromosomes, autosomes and sex chromosomes; alleles – dominant
and recessive; phenotype; genotype; homozygous; heterozygous, monohybrid and dihybrid crosses; back
cross and test cross, definitions to be taught with simple examples using Punnett square. Incomplete
dominance with examples from plants (snapdragon - Antirrhinum) and co-dominance in human blood
group, multiple alleles – e.g. blood groups, polygenic inheritance with one example of inheritance of skin
colour in humans (students should be taught examples from human genetics through pedigree charts.
They should be able to interpret the patterns of inheritance by analysis of pedigree chart). Biological
importance of Mendelism. Pleiotropy with reference to the example of Phenylketonuria (PKU) in human
beings and starch synthesis in pea seeds. Chromosomal theory of inheritance; autosomes and sex
chromosomes (sex determination in humans, fruit fly, birds, honey bees and grasshopper), sex-linked
inheritance - with reference to Drosophila (colour of body-yellow and brown; and colour of eyes-red and
white ), and man (haemophilia & colour blindness), definition and significance of linkage and crossing over.
🠶 Mutation: spontaneous, induced, gene (point – transition, transversion and frameshift); chromosomal
aberration: euploidy and aneuploidy;
🠶 human genetic disorders: haemophilia, phenylketonuria, thalassaemia, colour blindness,
sickle cell
anaemia; chromosomal disorders: Down’s syndrome, Klinefelter’s syndrome, Turner’s syndrome.
 MENDELISM
🠶L A W OF DOMINANCE: Of the two alleles of a trait only
o
neis able to express itself in F1-generation (dominant).
🠶L A W OF SEGREGATION: In the formation of gametes,
the paired hereditary determinants separate in such a
way that each gamete is equally likely to contain
either member of the pair.
🠶A l l e l e s of the same trait always enter different gametes.
🠶L A W OF INDEPENDENT ASSORTMENT: Segregation of
the members of any pair of alleles is independent of the
segregation of other pairs during formation of reproductive
cells.
🠶A l l e l e s of different traits are free to assort.
August 15, 2024
90
Contrasting Traits Studied by Mendel in Pea
Characters Contrasting Traits
Dominant Recessive
1. Stem height Tall Dwarf
2. Flower colour Violet White
3. Flower position Axial Terminal
4. Pod shape Inflated Constricted
5. Pod colour Green Yellow
6. Seed shape Round Wrinkled
7. Seed colour Yellow Green 9
1
August 15, 2024
 Reasons for Mendel’s success
🠶 Mendel's success can be attributed to his careful selection
of experimental organism, the garden pea, Pisum sativum.
🠶 1. There were several varieties available which had quite distinct
characteristics.
🠶 2. The plants were easy to cultivate.
🠶 3. The reproductive structures were completely enclosed by the petals
so that the plant was normally self-pollinating.
🠶 4. Artificial cross-breeding between varieties was possible and resulting
hybrids were totally fertile.
🠶 5. Mendel was fortunate that the genes coding for seven pair of
contrasting characters were on different chromosomes.
🠶 6. Mendel worked on one trait at a time. 92
🠶 7. Mendel kept a meticulous record of the observations he made during
his experiments. August 15, 2024
Term Definition
Homologous Chromosome of similar shape and size having similar
chromosomes sequence of alleles
Autosomes The chromosomes similar in males and females

Sex The chromosomes responsible for sex determination

chromosomes
Dominant allele An allele that expresses itself in homozygous as well as
heterozygous condition
Recessive allele An allele that expresses itself only in homozygous condition

Phenotype The appearance or manifestation of a character

Genotype Set of alleles that an individual possesses

93 August 15, 2024
Term Definition
Homozygous An individual possessing two of the same alleles at a locus

Heterozygous An individual possessing two different alleles at a locus

Monohybrid cross Cross involving inheritance of only one trait

Dihybrid cross Cross involving inheritance of two traits together

Back cross F1 progeny crossed with either of the parents

Test cross F1 progeny crossed with the recessive parent

9 August 15, 2024

4
 BACK CROSS
Cross between offspring & parents

9
5 August 15, 2024
 INCOMPLETE DOMINANCE
F1 neither dominant nor recessive -
intermediate

August 15, 2024

96
 CO-DOMINANCE
🠶 I n the ABO blood group system, the
IA and IB alleles are co-dominant to each
other.
🠶I n d i v i d u a l s who are heterozygous for
the IA and IB alleles express the AB blood
group phenotype, in which both A- and B-
type antigens are present on the surface
of red blood cells. 97

August 15, 2024

 Multiple alleles
ABO blood group system
as an example of multiple allelism
🠶S o m e genes have more than two allelic forms. These
different forms of a single gene are referred to as multiple
alleles.

🠶M u l t i p l e alleles can result in the blending of phenotypes.

9
8

August 15, 2024

 Possible phenotypes & genotypes
The three alleles of the gene are represented by the symbols IA, IB & io
The alleles IA & IB are co-dominant
Both are dominant to the io allele
(IA = IB > io)

Phenotypes Genotypes
A IAIA, IAiO
B IBIB, IBiO
AB IAIB
O iOiO
August 15, 2024 99
 Polygenic phenotypes
Phenotypic ratio
1 : 6 : 15 : 20 : 15 : 6 : 1

Polygenic inheritance is responsible for many phenotypic traits.

Examples include skin pigmentation, height, intelligence and stature.
(note that these traits all result from the interaction of the genes with environmental factors)

August 15, 2024 100

 Skin Colour
🠶 Determination of skin colour is an example of polygenic inheritance
(Davenport)
🠶 Skin colour is determined by at least three pairs of genes (possibly m
a
ny
more).
🠶 For example, let the allelic forms of the three genes be: A/a, B/b, C/c

Phenotype Genotype
(skin colour)
Dark skin AA, BB, CC
Intermediate skin Aa, Bb, Cc
Light skin aa,bb,cc

August 15, 2024 101

 Pedigree charts to explain the
examples from human genetics

104 August 15, 2024

 Pedigree charts to explain the
examples from human genetics

105 August 15, 2024

 PY SPECIMEN QUESTION PAPER
QUESTION 4 (MODIFIED)

I A B

II O

III

(iii) Find out the genotype of the parents

(iv) Find out the phenotype of II - 1
 Biological importance of Mendelism

🠶U s e d by plant breeders to produce

crops with desired characters
🠶U s e d by animal breeders to improve
the quality of poultry and cattle
🠶E u g e n i c s and pedigree
analysis
humansn i 1
0
🠶F o u n d a t i o n of molecular genetics9
August 15, 2024
 Pleiotropy
🠶 Definition: One gene with many unrelated effects
🠶 Examples: Phenylketonuria (PKU), Starch synthesis (in
plants)

BB bb
Smooth seed coat
Large size X Wrinkled seed coat
Small size
Bb
Smooth seed coat
Intermediate size
B b
B BB Bb
Smooth seed coat Smooth seed coat
Large size Intermediate size
b Bb Bb
Smooth seed coat Wrinkled seed coat 110

Intermediate size Small size

August 15, 2024

 Pleiotropy
🠶 Definition: One gene with many unrelated effects
🠶 Examples: Phenylketonuria (PKU), Starch synthesis (in
plants)

PP pp
Normal X Sufferer
Pp
Carrier
P p
P PP Pp
Normal Normal / carriers
p Pp pp
Normal / Carriers Sufferers
111
Cause: Deficiency of the enzyme phenylalanine hydroxylase
Symptoms: Stunted body growth, mental retardation, kidney dysfunction
August 15, 2024
 QUESTIONS

Both the parents are carriers of PKU, what is the probability of their children
being sufferers?
(a) 25% (b) 50% (c) 75% (d) 100%

Mr. Kapoor has Bb autosomal gene pair and sex-linked ‘d’ allele. What will be the
proportion of Bd in sperms?
(a) 25% (b) 50% (c) 75% (d) 100%
 The Chromosomal Theory of Inheritance
🠶P r o p o s e d by Walter Sutton and Theodore Boveri
🠶S i m i l a r i t i e s between behaviour of chromosomes
& mendelian characters
🠶 1 . Chromosomes occur in pairs like the alleles of
a Mendelian factor (genes)
🠶 2 . Homologous chromosomes separate during meiosis
like alleles at the time of gamete formation
🠶 3 . They separate independently during meiosis
🠶 4 . Paired condition of both is restored during fertilisation
11
🠶 5 . Both maintain their individuality from generation3to
generation
August 15, 2024
 SEX CHROMOSOMES & AUTOSOMES
🠶 Autosomes are the first 22 homologous pairs of human
chromosomes that do not influence the sex of an individual.
🠶 Sex Chromosomes are the 23rd pair of chromosomes that determine
the sex of an individual
🠶 XO TYPE – e.g. – Insects (grasshopper) Males have only one X
chromosome so XO, Females have two X so XX.
🠶 XY TYPE – e.g. – Humans, Drosophila
🠶 ZZ TYPE – e.g. - Birds Females have dissimilar referred as ZW & males
have ZZ
🠶B e c a u s e normally females XY & males XX
🠶 Haplo-diploidy in Honey bee: Males drones (haploid), females
(workers and queens: diploid) 11
August 15, 2024
4
 SEX – LINKED INHERITANCE
🠶H e m o p h i l i a and colour blindness in humans are
X- linked recessive
🠶 T . H. Morgan studied the inheritance of eye colour in
Drosophila melanogaster
🠶D i s c o v e r e d a male fly with white eyes when normal
eye colour of fruit fly is red
🠶N o t i c e d that inheritance of eye colour was associated
with the sex of the parents

11 August 15, 2024

5
116

August 15, 2024

 LINKAGE
🠶L i n k a g e is defined as the failure of two genes
to assort independently.
🠶L i n k a g e occurs when two genes are close
to each other on the same chromosome.
🠶T w o genes on the same chromosome are caled
linked genes.
🠶G e n e s far apart on the same chromosome assort
independently: they are not strongly linked.
🠶S i g n i f i c a n c e
🠶R e d u c e s the possibility of variability in gam1etes
unless crossing over separates the linked ge 1 nes
7
August 15, 2024
 CROSSING OVER
🠶M u t u a l exchange of corresponding parts between n
o
n
-
sister chromatids of homologous chromosomes.
🠶S i g n i f i c a n c e
🠶 I t results in new combination of alleles of the linked genes.
🠶R o l e in evolution

11
8
August 15, 2024
 Mutations

Chromosomal Gene (Point)

aberrations mutations

Structural Numerical
Substitution Frameshift
aberrations aberrations

Aneuploidy Euploidy Transition Transversion

 MUTATIONS
120
• Definition – Sudden change in genotype

• Observed by De Vries in Oenothera lamarckiana

• Role of mutation in evolution

• Provides variations, which act as the raw
material for natural selection
• Types:
• Spontaneous
• Induced
• Point: Transition, transversion, and frame-shift
August 15, 2024
 Mutations
121 • Three types of mutation involving single nucleotides (point
mutation):
• Deletion (loss)
• Insertion (addition)
• A deletion or insertion causes a frame-shift mutation
• Thus the sequences that follow no longer code for a functional gene
product (nonsense mutation)

• Substitution: It may alter a codon so that a wrong

amino acid is present at this site but has no effect on
the reading frame
• Transition: Exchange of purine for purine or of pyrimidine for pyrimidine
• Transversion: exchange of a purine for a pyrimidine, or vice versa
August 15, 2024
 HUMAN GENETIC DISORDERS
122
Disorder Cause Symptom
Phenylketonuria Lack of phenylalanine Abnormal pigmentation,
hydroxylase mental retardation,
Thalassaemia Frame-shift mutation leading Severe anaemia
to abnormal haemoglobin

Colorblindness Defective cones Inability to distinguish between

red and green colors

Sickle cell Replacement of glutamic Low RBC count due to sickling

anaemia acid by valine in beta-chain and destruction

August 15, 2024

123
CHROMOSOMAL DISORDERS
Disorder Cause Symptom

Down‘s Non-disjunction of 21st chromosome Moon-like face, open mouth,

syndrome (trisomy of 21st) chromosome (2n+1) protruding tongue, low I.Q.
(Mongolism)

Klinefelter‘s Trisomy of sex-chromosomes Sterile male, gynaecomastia,

syndrome (44+XXY) Barr body

Turner‘s Monosomy of X-chromosome Short statured sterile females,

syndrome (44+XO) webbed neck, low I.Q.

August 15, 2024

 2. Genetics and Evolution
(ii) Molecular basis of Inheritance
🠶 Chromosomes and genes; Search for genetic material; DNA as genetic material; structure
of DNA and RNA; DNA packaging; DNA replication; central dogma; transcription, genetic
code, translation; gene expression and regulation - lac operon; human and rice genome
projects; DNA fingerprinting.
🠶 Structure of eukaryotic chromosomes with reference to nucleosome; properties of genes
such as ability to replicate, chemical stability, mutability and inheritability. Search for DNA
as genetic material - Griffith’s experiment, Hershey and Chase’s experiment, Avery,
McLeod and McCarty’s experiment; double helical model of DNA (contributions of
Miescher, Watson and Crick, Wilkins, Franklin and Chargaff); Differences between DNA
and RNA, types of RNA (tRNA, mRNA and rRNA, snRNA, hnRNA); central dogma –
concept only; reverse transcription (basic idea only), Meselson and Stahl’s experiment,
replication of DNA (role of enzymes, namely DNA polymerase and ligase), transcription,
post-transcriptional processing in eukaryotes (splicing, capping and tailing).
 2. Genetics and Evolution
(ii) Molecular basis of Inheritance
🠶I n t r o n , exon, cistron, recon, muton (definitions only). Discovery
and essential features of genetic code. Definition of codon. Protein
synthesis – translation in prokaryotes. Gene expression in
prokaryotes; lac operon in E. coli.
🠶H u m a n Genome Project: goal; methodologies [Expressed Sequence
Tags (EST), Sequence Annotation], salient features and
applications.
🠶R i c e Genome Project (salient features and applications).
🠶 D N A finger printing – technique, application and ethical issues
to be discussed briefly.
 EUKARYOTIC CHROMOSOMES

🠶T h e y are highly coiled structures and can be seen only in division

phase of the cell.
🠶D N A of eukaryotic chromosomes is linear.
🠶C o n s i s t s of DNA and histone proteins.
🠶H i s t o n e s are basic proteins of five types - H1, H2A, H2B, H3 and
H4.
🠶H i s t o n e s bind the DNA by forming Nucleosomes.
 Properties of genes
🠶A b i l i t y to replicate
🠶C h e m i c a l stabilty
🠶Mutability
🠶Inheritability

How many nucleosomes are present in the nucleus of a diploid eukaryotic cell which possesses 6.6 x 109 bp?
(a) 3.3 x 107 (b) 6.6 x 106 (c) 2.2 x 108 (d) 1.1 x 109

How many nucleosomes are present in E. coli if its DNA has 4.6 x 109 bp?
(a) 2.3 x 107 (b) 3.3 x 106 (c) 2.2 x 108 (d) None of these

Q3. What will be the number of histone molecules in a chromatin fiber having 50 nucleosomes?
(ii) Molecular basis of Inheritance

🠶S e a r c h for DNA
as Genetic
Material
 1
3
August 15, 2024

1
 DNA as genetic material
🠶G r i f f i t h concluded – some factor ‘transforming principle’
in heat killed S-cells was transferred

🠶 I t transformed R-cells into live S cells

🠶 R - cells synthesized smooth polysaccharide coat a

n
d
became virulent

1
3 August 15, 2024
2
13
3

August 15, 2024

🠶T h e bacteria infected with viruses that
h
a
dradioactive proteins were not
radioactive
🠶T h i s indicated that protein did not enter the bacteria
from the virus
🠶O n l y phage DNA entered the bacterial cell
🠶D N A alone is responsible for synthesis of new viruses
inside the bacterial cells
🠶H E N C E DNA & NOT PROTEIN IS THE HEREDITARY
MATERIAL
13
4
August 15, 2024
 Experiments by Avery, McLeod and McCarty

🠶W h e n polysaccharide capsule as well as protein

fraction was removed from heat killed S cells + R cells
the mice died
🠶A d d e d DNAase enzyme into heat killed S cells
+ R cells – Mice survived
🠶E n z y m e disintegrated the DNA & so R-cells were
nottransferred – DNA of heat killed bacteria
transformed R-bacteria into live S-bacteria
🠶P R O V E D DNA IS THE GENETIC MATERIAL
1
3 August 15, 2024

5
🠶F r i e d r i c h Miescher:
🠶 I n 1869, Friedrich Miescher isolated "nuclein," DNA
with associated proteins, from cell nuclei. He was the first
to identify DNA as a distinct molecule.
🠶E r w i n Chargaff ―Chargaff‘s rule‖
🠶P u r i n e = Pyrimidine in dsDNA
🠶R o s a l i n d Franklin and Maurice Wilkins
🠶 X - ray crystallography of DNA
 NUCLEIC ACIDS
137

🠶 Chemical composition of DNA

🠶 DNA is a polymer of deoxyribonucleotides.
🠶 A nucleotide is made up of three different molecules
🠶 A pentose (5-C sugar): deoxyribose.
🠶 A nitrogenous base:
🠶F o u r different nitrogenous bases, viz., adenine, guanine, cytosine and thymine.
🠶A d e n i n e and guanine are purines whereas cytosine and thymine are pyrimidnes.
🠶P u r i n e s have double rings whereas pyrimidines have only single ring.
🠶 A t its C-1 position the deoxyribose sugar joins a nitrogenous base to form
a nucleoside. The four bases form four different nucleosides.
🠶 Phosphate
15 August 2024
 Watson and Crick’s model of DNA
138 🠶 The most accepted molecular model, proposed by Watson and Crick (1953).
🠶 Based on the X-ray crystallography studies carried out by Wilkins and Franklin.
🠶 Watson and Crick along with Wilkins were awarded Nobel Prize in 1964.
🠶 The salient features of this model are:
🠶 The backbone of the helix is formed by deoxyribose and phosphate
interlinked by phospho-di-ester bonds.
🠶 The steps of the helix are formed by nitrogenous bases.
🠶 The two arms of helix are coiled in such a manner that they form
alternating major and minor grooves.
🠶 Both the arms run parallel (anti) to each other maintaining a uniform
distance of 20 Å throughout their course.
🠶 One complete turn involves 10 base pairs and extends from one major
groove to the next, covers a distance of 34 Å.
🠶 The distance between two successive nucleotide base pairs is 3.4 Å.
15 August 2024

🠶 Both the strands are complementary to each other

139

15 August 2024
 QUESTION
🠶 I n a double-stranded DNA the molar concentration ofT
is 23%, find out the percentage of A, C and G.
🠶C o n c of A 23% = T 23% = 46% - 100 = 54% / 2
🠶 C 27% = G 27 %
🠶A n s :
🠶 C - 27%
🠶 A - 23%
🠶 G - 27%
 APPLICATION BASED QUESTIONS
🠶 In a 3.6 kb long piece of DNA, 920 adenine bases were found.
What would be the number of cytosine bases?
🠶 No. of base pairs 3600
🠶 920 A + 920 T = 1840
🠶 3600 – 1840 = 1760
🠶 1760 / 2 = C + G
🠶 Ans: 880
142 Ribose Nucleic Acid (RNA)
🠶R N A is found both in nucleus as well as in cytoplasm
🠶R N A is non-genetic, but in certain viruses, it acts as
a genetic material.
Chemical Composition
🠶 I t is a polymer of ribonucleotides.
🠶E a c h nucleotide has a nitrogenous base, a pentose
sugar and a phosphate group.
🠶N i t r o g e n o u s bases are adenine, guanine, cytosine
a
nduracil.
🠶T h e pentose sugar present in RNA is ribose.
15 August 2024
 Types of RNA
143
🠶 There are three different kinds of RNAs-viz. mRNA), tRNA), and rRNA.
Messenger RNA
Structure of mRNA
🠶 mRNA has a cap at its 5’end which bears methylated guanosine
(mG);
🠶 The 3’-end is protected by a polyadenylate (Poly–A) tail.
🠶 Single stranded
🠶 It is made in the nucleus from where it passes through nuclear pore to the
ribosome.
🠶 It transcribes the genetic information coded in the DNA molecule.

15 August 2024
 tRNA
144 🠶 I t s structure (clover leaf model) was proposed by Holley et.
al. (1965).
🠶 T h e single strand of RNA is folded upon itself to form five arms.
🠶E a c h arm consists of a stem and ends in a loop which is not paired.
🠶 T h e arms are:
🠶( i ) Acceptor Arm: The amino acid molecule binds to the 3‘-end of the CCA sequence,
🠶( i i ) D-arm: It Bears a DHU loop or Dihydrouridine loop at its end.
🠶( i i i ) Anti-codon arm: Bears anticodon loop. It recognizes the complementary codons on
m-
RNA.

🠶( i v ) Variable arm: It is a very small, it may have 5 base pairs.

🠶( TψC
loopvon)it are arm
involved (Ribothymidinene
in binding tRNA to ribosomes.Pseudouridine Cytidine): This arm an
d
15 August 2024

the
 tRNA (sRNA/adaptor)
145

15 August 2024
 Types of RNA
146 Ribosomal RNA
🠶 It makes up about 80% of the total RNA in a cell.
🠶 Ribosomal RNA is manufactured in the nucleus under the control of nucleolus.
🠶 It enters the cytoplasm and binds with protein molecules to form ribosomes.
Heterogeneous nuclear RNA (hnRNA)
🠶 In mammalian cells, a precursor RNA is first synthesized in the nucleoplasm
🠶 This precursor RNA is called hnRNA.
🠶 This precursor is then degraded by a nuclease to mature mRNA
🠶 It can take the form of the other RNAs as well; therefore it is also caled
Cinderella among the nucleic acids.
Small nuclear RNA (snRNA)
🠶 It is one of the small RNAs.
🠶 It forms spliceosomes which play important role in RNA splicing.
15 August 2024
147 DNA RNA
1. It is mostly double-stranded. 1. It always single stranded.

2. It has thymine as one of the nitrogenous 2. It has uracil in place of thymine.

bases.
3. Its pentose sugar is deoxyribose. 3. It has ribose in place of deoxyribose.

4. It mostly acts as genetic material. 4. It is mostly non-genetic material.

5. It synthesizes different kinds of RNA. 5. It may synthesize DNA only when DNA is
absent (as in retro-viruses).
6. Pairing of bases is throughout the length of the 6. Pairing of bases is only in the helical region of
molecule. t-RNA.
7. Adenine pairs with thymine. 7. Adenine pairs with uracil.
8. Mostly located in nucleus. 8. Mostly located in cytoplasm.
9. Large number of nucleotides (approximately 9. Relatively fewer nucleotides (upto 12,000).
4.3 million).
10. It is of six types viz-A, B, C, D, Z and RL. 10. It is of three types-viz m-RNA, t-RNA and r-
15 August 2024
RNA.
CENTRAL DOGMA

Reverse
transcription
 Reverse transcription
(Teminism)
🠶G e n e t i c RNA to DNA
🠶R e v e r s e transcriptase (RNA
dependent DNA polymerase)
🠶 I n retroviruses
🠶E x c e p t i o n to Central dogma
🠶T e m i n and Baltimore 149

🠶N o b e l Prize (1975) August 15, 2024

15
August 15, 2024
0
 APPLICATION BASED QUESTIONS

🠶 According to Meselson and Stahl experiment, if DNA of E. coli was

extracted after 60 minutes in the 14NH4Cl medium; what would be the
relative DNA densities of light (N14N14) and hybrid (N14N15) strands?
🠶 75% light (N14N14) and 25% hybrid (N14N15)
The mechanism of DNA replication
🠶I n i t i a t i o n
🠶 Origin of replication
🠶 Helicases weaken hydrogen bonds
🠶 Topoisomerases cut and reseal one strand of DNA
🠶 SSBP prevent recoiling
🠶 Formation of RNA primer – by Primase

🠶E l o n g a t i o n
🠶 Synthesis of new complementary strand - new nucleotides added
with the
help of DNA polymerase III
🠶 Leading strand, lagging strand, Okazaki fragments

🠶T e r m i n a t i o n
🠶P r o t e i n s release the replication complex
🠶Ligase
2 August 15, 2024
15
Okazaki fragments

August 15, 2024

3
 Proteins involved in replication
Protein Function
DNA polymerases Deoxynucleotide polymerization

Helicases Unwinding of DNA

Topoisomerases Relieve torsional strain that results from helicase-
induced unwinding
DNA primase Initiates synthesis of RNA primers
Single-strand binding Prevent premature reannealing of dsDNA
protein
DNA ligase Seals the single strand nick between the nascent
chain and Okazaki fragments on lagging strand
August 15, 2024
 Transcription
🠶C o p y i n g genetic information from one strand
of DNA into RNA.
🠶O n l y one strand of DNA is copied during
transcription or else two different RNA molecules
will get formed
🠶C o d e for proteins & sequence of amino acids
would be different hence one segment of DNA
would code for two different proteins
🠶D o u b l e stranded RNA would be formed – p 1revent
RNA from being translated into protein 5
5 August 15, 2024
 Initiation
• In bacteria, transcription begins with the
binding of RNA polymerase to the promoter
in DNA.
• At the start of initiation, the core enzyme is
associated with a sigma factor that aids in
finding the appropriate -35 and -10 base
pairs upstream of start site.
• TATA box (Pribnow box – prokaryotes,
Goldberg-Hogness box – eukaryotes) 15 August 15, 2024

6
 Elongation
•One strand of the DNA, the template strand
[non-coding or anti-sense strand], is used as a
template for RNA synthesis.
•As transcription proceeds, RNA polymerase
moves along the template strand and uses
base pairing complementarity with the DNA
template to create an RNA copy.
•This produces an RNA molecule from 5' → 3',
an exact copy of the coding strand (except
that T is replaced with U). 1
5 August 15, 2024

7
 Termination
• In Rho-independent termination, RNA transcription stops
when the newly synthesized RNA molecule forms a G-C-rich
hairpin loop followed by a run of Us.

• In the Rho-dependent termination, a protein factor called

"Rho" destabilizes the interaction between the template
(DNA) and the mRNA, thus releasing the newly synthesized
mRNA from the elongation complex.

158 August 15, 2024

 APPLICATION BASED QUESTION
🠶 If the sequence of coding strand in a transcription unit
is as follows:
🠶ATGCATGCATGCATGCATGCATGCATGC -
🠶W r i t e down the sequence of mRNA.
🠶AUGCAUGCA U GCA U GCA U GCA U GC AG C -

🠶 If the sequence of the template strand in a transcription

unit is as follows:
🠶ATGCATGCATGCATGCATGCATGCATGC -
• Write down the sequence of mRNA.
🠶U A C G U A C G U A C G UACG UACG UACG
 DIAGRAM BASED QUESTION
Name the parts A' 'B' and 'C' of the transcription unit
given below and give their role in transcription. [3]
 Post Transcriptional Processing of Primary Transcript
161
🠶 The primary transcript of mRNA is hnRNA (in eukaryotes). It is
subjected to many changes before functional mRNA is formed. It includes:
🠶 1. 5‘-Capping
🠶 The 5‘ end of mRNA is capped with 7-methyl guanosine.
🠶 This cap is required for translation and stabilization of the structure of mRNA.
🠶 2. Poly-A Tail
🠶 An adenine nucleotide chain is added at the 3‘ end. It is called Poly-A tail.
🠶 It is added to stabilize the mRNA.
🠶 3. Splicing of Introns (Define: Exon/Intron/Cistron)
🠶 Introns are the intervening sequences in mRNA which do not code for proteins.
🠶 Exons on mRNA are responsible for synthesis of proteins.
🠶 The removal of introns is promoted by small nuclear ribonucleo proteins (snRNPs).
🠶 When snRNAs gets associated with hnRNA at exon-intron junction it is called
spliceos15oAm est.2024
ugu
DISCOVERY OF GENETIC CODE

🠶 Gamow
🠶 Nirenberg
🠶 H. G. Khorana
🠶 Ochoa
 CHARACTERISTICS OF GENETIC CODE
🠶 Codon is triplet
🠶 Non – overlapping
🠶 Degeneracy
🠶 Some amino acids are coded by more than one codons
🠶 Known as synonymous codons e.g. GGU, GGC, GGA, GGG code
for
glycine (Wobble effect)
🠶 Universality
🠶 Same codon for same amino acid in every form of life
🠶 Initiation codon/Starting codon – AUG
🠶 Nonsense/ termination codons: UAA, UAG & UGA
🠶 are Collinearity:
collinear. The genetic map and the amino acid1 sequence
🠶 No punctuations 6 August 15, 2024
4
 PROTEIN SYNTHESIS
Pre-initiation
(a) Activation of amino acid: The activation of amino acid
needs ATP and the enzyme amino acyl synthetase to
form the amino acyl adenylate - enzyme-complex and
inorganic pyrophosphate.
(b) Transfer of amino acid to tRNA or charging of tRNA:
The amino acyl adenylate-synthetase complex reacts with
a particular t-RNA to form the amino acyl-tRNA16complex
5
or charged tRNA. August 15, 2024
 PROTEIN SYNTHESIS
Initiation
(i) The methionine binds itself to met-tRNA
(ii) The met-tRNA complex undergoes formylation by
transformylase.
(iii) The 30S sub-unit of 70S ribosome binds at 5‘-end
of m-RNA
(iv) The 30S subunit + m-RNA complex then binds
50 S sub-unit of ribosome. In this process a molecule
16
of GTP is converted to GDP 6
August 15, 2024
 PROTEIN SYNTHESIS
Elongation of polypeptide chain
🠶 T h e initiating codon AUG unites with f-met-tRNA complex on P-site
🠶 T h e incoming amino acyl t-RNA binds to A-site of the ribosome. The
starting amino acid N-formyl methionine lies at the P-site of the ribosome.
🠶 A peptide bond is formed between —COOH group of peptidyl tRNA and
—NH2 group of amino acyl tRNA by the enzyme peptidyl transferase.
🠶 T h e ribosome moves on to mRNA in 5’-3’ direction. This movement is
referred to as translocation. During translocation the acylated tRNA moves
from A-site to P-site. The deacylated t-RNA is ejected out from the P-site of
the ribosome.
16
🠶P o l y s o m e 7
August 15, 2024
 PROTEIN SYNTHESIS
Termination of polypeptide chain
🠶T h e termination of polypeptide chain is brought
about by the terminating codons (UAA, UAG and
UGA)
🠶T h e formyl group of methionine is removed
by the enzyme deformylase
🠶T h e chain undergoes secondary and tertiary
folding. 16
8
August 15, 2024
ACTIVITY CREATED BY MR. AMAR
MY COMPUTER
🠶 WELCOME TO ENTER THE mRNA
sequence
 Definitions

1. Introns: Non-coding (intervening) sequences

2. Exons: Expressed sequences
3. Cistron: The functional unit of gene
4. Recon: The unit of recombination
5. Muton: The unit of mutation
🠶T h e terms cistron, recon, and muton have b
en
coined by Benzer

1
August 15, 2024
7
0
THE lac OPERON
 Operons
🠶 A n operon is a group of genes that are
transcribed at the same time.
🠶T h e y usually control an important
biochemical process.
🠶 A n operon is a cluster of functionally-
related genes that are controlled by a
shared operator.
🠶O p e r o n s consist of multiple genes
grouped together with a promoter and an
operator. Jacob, Monod &
Lwoff
17
2
August 15, 2024
 The lac Operon
 Repressor gene: Codes for repressor protein
 Operator gene: Binding of RNA polymerase
 Promoter site: Binding of repressor protein
 Three structural genes
 Gene lacZ codes for the enzyme β-galactosidase
 Function: Hydrolyses lactose into glucose and galactose
 Gene lacY codes for the enzyme permease
1
 Function: Transmembrane pump; allows the cell to import l7
actose
3
 Gene lacA codes for transacetylase
 Function: Precise function not understood. Transfers acetyl group from
acetyl-CoA to galactosides August 15, 2024
The control of the lac operon

174

August 15, 2024

 175 1. When lactose is absent
🠶 A repressor protein is continuously synthesised. It sits on a sequence
of DNA just in front of the lac operon, the Operator site
🠶 The repressor protein blocks the Promoter site where the R NA
polymerase settles before it starts transcribing

Repressor RNA
protein Blocked polymerase

DNA
I
O z y a
Regulator Operator
lac operon
gene site
August 15, 2024
176 2. When lactose is present
🠶 A small amount of a sugar allo-lactose is formed within
the bacterial cell. This fits onto the repressor protein at
another active site (allosteric site)
🠶T h i s causes the repressor protein to change its shape (a
conformational change). It can no longer sit on the
operator site. RNA polymerase can now reach its promoter
site

DNA

I O z y a August 15, 2024

1
7
7 August 15, 2024
Human Genome
Project
 GOALS / OBJECTIVES OF
179
HUMAN GENOME PROJECT
🠶I d e n t i f y all 20,000 to 25,000 genes in human DNA
🠶D e t e r m i n e sequences of the 3 billion base pairs that m
ak
e
up human DNA
🠶S t o r e this information in databases
🠶I m p r o v e tools for data analysis
🠶T r a n s f e r related technologies to other sectors such
as industries
🠶A d d r e s s the ethical, legal & social issues that may arise
from the project August 15, 2024
 METHODOLOGIES
🠶T w o major approaches
🠶O n e involved identification of all the genes that are
expressed as RNA (referred to as Expressed Sequence Tags
(ESTs).
🠶T h e other involves the blind approach of simply
sequencing the whole set of genome that contained all the
coding and non-coding sequence, and later assigning
different regions in the sequence with functions (termed as
Sequence Annotation).
180 August 15, 2024
 SALIENT FEATURES OF HUMAN
181
GENOME
🠶C o n t a i n s more than 3 x 109 bp
🠶T o t a l no. of functional genes is estimated around 20,000
🠶D y s t r o p h i n : Largest human gene with 2.4 million bases
🠶C h r o m o s o m e 1 is largest with largest number of genes (2968)
& Y has the least (231)
🠶F u n c t i o n of more than 50% of discovered genes is unknown
🠶L e s s than 2% of genome sequences code for protein (Rest
is Junk)

August 15, 2024

 SALIENT FEATURES OF HUMAN 182

GENOME
🠶R e p e t i t i v e sequences that do not code for proteins make up
at least 50%
🠶A p p r o x i m a t e l y one million repeated sequences are clustered
around centromeres and telomeres – represent junk DNA
🠶R e p e t i t i v e sequences do not have coding functions but useful
in understanding chromosome structure & evolution.
🠶G e n e s associated with numerous human diseases (e.g., for
breast cancer, blindness, deafness etc.) have been identified.
🠶1 . 4 million single base differences – SNPs (single nucleotide
polymorphisms) are identified August 15, 2024
 183

APPLICATIONS
🠶D e s c r i b i n g a human being genetically
🠶D i a g n o s i s & treatment of diseases by improving diagnosis,
detecting genetic predisposition to diseases, creating
drugs, designing custom drugs specific based on
individuals genetic profile
🠶D e t e r m i n i n g genetic heritage
🠶H e l p s in identifying suspects
🠶E s t a b l i s h i n g paternity & other relationships
🠶M a t c h i n g organs for transplant
🠶E s t a b l i s h i n g evolutionary relationship with other animal
groups August 15, 2024
 Ethical Issues
🠶P r i v a c y
🠶C h a n c e s of misuse of DNA profile
🠶C h a n c e s of genetic discrimination in marriage,
education, social relations etc.
🠶C h a n c e s of misuse of data by law enforcing agencies
 RICE GENOME PROJECT
🠶I n t e r n a t i o n a l Rice Genome Sequencing Project (IRGSP) started
in September 1997
🠶W o r l d ’ s first crop genome to be sequenced
🠶M a j o r participating countries: Japan, Korea, China, UK, USA, India
🠶R e a s o n s for selecting Rice
🠶M a i n staple food for half the population of world
🠶S m a l l e s t genome size among cereals
🠶S h o w s high diversity
🠶S h o w s substantial collinearity with other cereals (maize, wheat, sorghum)
 RICE GENOME PROJECT
Technique
🠶S i m i l a r to other genome sequencing projects
🠶 B A C or PAC libraries from Nipponbare variety
🠶 Major findings
🠶A p p r o x i m a t e l y 12Mb has been sequenced and released to DDBJ
🠶A b o u t PACs/BACs have been annotated
🠶A b o u t 5,000 EST markers have been generated
🠶 Applications
🠶L a r g e number of rice mutants have been developed artificially
🠶H e l p s in enhancing molecular products
🠶P r o v i d e s information on the effects of repetitive elements on genome
organisation and evolution in plants
🠶P r o v i d e s resource for eukaryotic genome sequencing projects in future
 DNA FINGERPRINTING
🠶E v e r y person’s DNA is unique.
🠶E v e r y cell contains DNA.
🠶F e w cells sufficient to detect individual.
🠶U s e d to identify various crimes
🠶I n t r o d u c e d by Sir Alec Jeffreys
187

August 15, 2024

 The technique of DNA fingerprinting
188

Alec Jeffreys
1. Isolation of DNA
2. Amplification by PCR
3. Digestion of DNA by restriction endonucleases
4. Separation of DNA fragments by electrophoresis
5. Transferring (blotting) of separated DNA fragments to
synthetic membranes, such as nitrocellulose
6. Hybridisation using labelled VNTR probe, and
7. Detection of hybridised DNA fragments by autoradiography
August 15, 2024
 APPLICATIONS OF DNA FINGERPRINTIN189
G

1. Identification of criminals
2. Helps in exonerating persons wrongly accused of crimes
3. Used to infer the blood relationship in members of the
same family
4. Paternity disputes
5. Parentage determination of a lost child
6. Sex of an individual – identified in badly damaged bodies
in accidents
7. Addressing patent related issues
August 15, 2024
 2. Genetics and Evolution
(iii) Evolution
Origin of life; biological evolution and evidences for biological evolution (palaeontology,
🠶
comparative anatomy, embryology and molecular evidences); Darwin's contribution, modern
synthetic theory of evolution; mechanism of evolution - variation (mutation and recombination) and
natural selection with examples, types of natural selection; gene flow and genetic drift; Hardy -
Weinberg‘s principle; adaptive radiation; human evolution.
Origin of life - abiogenesis and biogenesis, effect of oxygen on evolution to show that reducing
🠶
atmosphere is essential for abiotic synthesis. Important views on the origin of life (panspermia,
spontaneous generation), modern concept of origin of life, Oparin Haldane theory (definition of
protobionts, coacervates), Miller and Urey experiment.
Evidences of evolution: morphological evidences, definition and differences between homologous
🠶
and analogous organs (two examples each from plants and animals), vestigial organs. Embryological
evidences – theory of recapitulation, definition and differences between ontogeny and phylogeny.
Palaeontological evidence – definition of fossils and radioactive carbon dating. Geological time
scale (with reference to dominant flora and fauna) Biogeographical evidence – definition of
biogeography, molecular (genetic) evidences -for example genome similarity, universal genetic
code; Adaptive radiation (Darwin's finches and marsupials).
 2. Genetics and Evolution
(iii) Evolution
🠶 Lamarckism: brief idea of Lamarck's theory, evidences in favour of Lamarckism such as
evolution of long neck of giraffe to be discussed. Darwinism: salient features of Darwinism,
contribution of Malthus, criticism of Darwinism. Examples of natural selection – long neck of
giraffe, industrial melanism, resistance of mosquitoes to DDT and resistance of bacteria to
antibiotics, Lederberg’s replica plating experiment, Neo-Darwinism (Modern Synthetic Theory);
Variation - causes of variation, Hugo de Vries theory of mutation - role of mutation in evolution;
Mutation – spontaneous, induced, gene (transition, transversion and frame shift); Hardy
Weinberg’s principle, (numericals on Hardy Weinberg’s equilibrium) , factors affecting Hardy
Weinberg equilibrium: gene migration or gene flow, genetic drift (Founder’s effect, bottle-neck
effect), mutation, genetic recombination and natural selection, types of natural selection
(directional, disruptive and stabilizing).
🠶 Evolution of man – three features of each of the ancestors Dryopithecus, Ramapithecus,
Australopithecus, Homo habilis, Homo erectus, Homo neanderthalensis, Cro-Magnon man and
Homo sapiens leading to man of today.
ORIGIN OF
LIFE
 Brief idea of theories of origin of life
194 • Special creation: Creation of God: Father Suarez
• Panspermia: Arrhenius
• Cosmozoic: Richter
• Catastrophism: Cuvier
• Abiogenesis: (Spontaneous Generation): From non – living material
• Van Helmont – Dirty shirt + wheat → Mice

• Experiments of Redi, Spallanzani and Pasteur

• Concept of Biogenesis
• Francesco Redi – Meat in open flask → Larvae
• Meat in closed flask → No Larvae

• Life from pre-existing life

• Concept given by Louis Pasteur August 15, 2024
196 Oparin Haldane theory
Modern concept of origin of life
1. Free atom
2. Inorganic molecules
3. Simple organic molecules
4. Complex organic molecules
5. Protobionts/Coacervates
6. Eobionts
7. Free genes
8. 1st primitive cell
August 15, 2024
 Protobionts
197 1. Abiotically produced protein aggregates OR
2. Pre-cells containing self reproducing molecules enclosed in a
(lipoid) membrane, OR
3. A complex of organic molecules surrounded by a membrane-
like structure
Types: Microspheres, coacervates
Microspheres
By Sydney M. Fox
• Coated by a selectively permeable protein membrane
• Undergo osmotic swelling or shrinkage
• Store energy in the form of membrane potential

August 15, 2024

 Coacervates
198
🠶C l u s t e r of molecular aggregates in colloidal fo
rm
(bounded by a lipoid membrane)
🠶D r o p l e t s that self assemble when a solution of
polysaccharides, polypeptides and nucleic acids is
shaken
🠶T h e system can incorporate proteins or enzymesif
present in the medium
🠶G r o w s by absorbing substrates from their surrounding
and release the products of the reactions catalyzed by
the enzymes
🠶C o u l d divide by budding August 15, 2024
199

Coacervates

August 15, 2024

 Miller & Urey Experiment
🠶S u g g e s t s abiotic origin of life
🠶H e a t e d a mixture of CH4, NH3, H2, water vapour
🠶B u i l d i n g blocks of cells (nucleotides, amino acids)
could have been formed on primitive earth
🠶C o m b i n e d to form proteins & nucleic acids
🠶P r e s e n c e of reducing atmosphere
🠶A b u n d a n c e of O2 today prevents abiotic origin
of life
201

o
o

August 15, 2024

EVOLUTION
203 Evidences of Evolution
Morphological evidences
Homologous organs Analogous organs
1. Different functions 1. Similar functions
2. Different appearance 2. Similar appearance
3. Same basic plan 3. Different basic plan
4. Common origin 4. Different origin
5. Divergent evolution 5. Convergent evolution

Convergent and divergent

evolution with examples

August 15, 2024

204
Examples
(two examples from animals)
Homologous organs Analogous organs
🠶A r m s of man, fore 🠶 Wings of insects, birds, bat, flying
limbs of horse, wings lizard
of birds, flippers of 🠶 Fins of fish, flippers of whale
whale 🠶 Gills of fish, gills of crustaceans
🠶L e g s of insects (coxa, 🠶 Stings of honey bee (ovipositor)
and scorpion (last abdominal
trochanter, femur, segment)
tibia, tarsus)
🠶 Camera-type eyes in b o
th
🠶M o u t h parts of insects molluscs and vertebrates
August 15, 2024
205
Examples
(two examples from plants)
Homologous organs Analogous organs
🠶 Phylloclade of 🠶L e a v e s of plants,
Opuntia, cladode of Cladode of Ruscus
Ruscus or Asparagus
🠶 Thorns of
🠶T e n d r i l s of grapes
Bougainvillea, tendrils
of Passiflora (stem) and pea
(leaf)
🠶 Leaf tendril of pea
plant and leaf spine of 🠶S w e e t potato (root
barberry tuber) and potato
🠶 Rhizome of ginger (stem tuber) August 15, 2024

a
n
dtuber of potato
 Vestigial organs
206 • Well developed & functional in ancestors
• Rudimentary & non-functional in present day animals
• Examples
• In man
• Vermiform appendix
• Coccyx
• ear muscles
• nictitating membrane
• wisdom tooth
• segmental muscles of abdomen
• body hair.
August 15, 2024
207 • EVIDENCE FROM EMBRYOLOGY
• ERNST HAECKEL – Ontogeny recapitulates phylogeny
• Every organism during its embryonic development
(Ontogeny)
• Passes through its ancestral history (Phylogeny)
• Examples: Tadpole, protonema

August 15, 2024

208
Palaeontology
🠶P a l a e o n t o l o g y : Study of fossils
🠶D e f i n i t i o n of fossil: Remains of organisms of the past
in ancient rocks

August 15, 2024

210
Geological time scale
• Tabulated form showing sequence and duration of eras
and periods.
• Azoic – without life
• Archaeozoic – ancient life
• Proterozoic – primitive life
• Palaeozoic – cradle of ancient life
• Mesozoic – age of reptiles
• Coenozoic – age of mammals

August 15, 2024

212
Biogeographical
regions (Realms)
Biogeography: Study of distribution of animals &
plants in different parts of the world.
• Oriental: Mostly Asia
• Nearctic: North America
• Palaearctic: Asia and Europe
• Neotropical: Central and South America
• Australian: Australia, New Zealand
• Ethiopian: South Africa and deserts of Sahara
August 15, 2024
213
Biogeographical
regions

August 15, 2024

 Molecular (Genetic) Evidences
214

• 1. Similar chromosome number

• Human (2n = 23 pairs) and apes (2n = 24 pairs)
• Tiger, cats and lion (19 pairs)
• Cow, goat (30 pairs)
• 2. Similar banding pattern of chromosomes
• 3. Universal genetic code

August 15, 2024

215
Darwin’s finches
• Galapagos islands
• Observed that birds resembled those of
South America mainland
• Different species differ mainly in size & shape
of beak
• Migrated from mainland to Galapagos islands
• Adapted differently in feeding habits &
developed different types of beaks
• Adaptive radiation
August 15, 2024
219
Theories of evolution
Lamarckism
🠶 Brief idea of Lamarck's theory to be given for better understanding of
evolution
🠶 Examples in favour of Lamarckism such as evolution of long neck
girafe to be discussed.
🠶 Three examples favouring criticism of Lamarckism

August 15, 2024

220 Darwinism
🠶 Salient features (Basic postulates) of Darwinism
🠶 Selected examples of natural selection – long neck of giraffe, industrial
melanism, resistance of mosquitoes to DDT, antibiotics, Lederberg's expt.
🠶 Criticism (drawbacks) of Darwinism
🠶 Neo Darwinism (Modern Synthetic Theory)
🠶 Variations - causes of variation
🠶 De Vries theory of mutation – definition and its role in evolution
🠶 Mutation: Spontaneous, induced, gene (point – transition, transversion, frame
– shift)
🠶 Hardy – Weinberg’s equilibrium: gene migration or gene flow, genetic
drift (Founder effect, Bottle neck effect), mutation, genetic recombination
and natural selection.
🠶 Types of natural selection (directional, disruptive and stabilising) August 15, 2024
221
Darwinism
Salient features of Darwinism (point-wise)
1. Organisms have enormous fertility
2. Limited supply of food and space (Malthus)
3. Struggle for existence
a. Intraspecific – same species
b. Interspecific – different species
c. Extra specific – with environment
4. Adaptations/ Variations
5. Survival of the fittest (Spencer)
6. Natural selection
7. Origin of new species
August 15, 2024
222 Darwinism
• Supported by the Long neck of giraffe
i. Two types of giraffes (long necked and short
necked) existed right from the beginning
ii. No problems till sufficient vegetation on land
iii. When grass was lost from the ground, short necked
giraffes could not feed, while long necked giraffes
survived by feeding on the branches of trees
iv. Natural selection of the best adapted variety

August 15, 2024

 Industrial melanism
🠶T w o varieties of peppered moth
🠶B i s t o n betularia – white / (dull) gray
🠶 B . carbonaria – black
🠶B e f o r e industrialisation: More of white
🠶A f t e r industrialisation: More of black
🠶L i c h e n s
🠶S e l e c t i v e feeding by the birds
🠶D i r e c t i o n a l selection
 DDT resistance
224

i. Original population – DDT resistant and sensitive

individuals
ii. No additional adaptability
iii. When DDT sprayed, natural selection favored
resistant variety
iv. Gradually entire population became DDT
resistant
Antibiotic resistance in microbes

August 15, 2024

225 Lederberg’s replica plating experiment

August 15, 2024

TYPES OF NATURAL SELECTION
• Stabilising
• Favours average or normal phenotypes
• Eliminates extreme variants & new mutations

• Directional
• Regular change in gene pool of a population in one direction
– progressive

• Disruptive
• Favours individuals at both extremes of the distribution
curve – eliminates intermediate types
227
Types of natural
selection

August 15, 2024

228
Natural selection Artificial selection
Nature selects best Man selects

Longer time for Shorter time for

development of new development of new
species species
Operates on a wide scale Involves selective
breeding of a few crops

Led to great diversity in Evolution of very few

nature economically important
plants and animals
August 15, 2024
 Drawbacks of Darwinism
229 • Failed to explain
• arrival of the fittest
• causes of variations
• over-specialization: Tusk (elephant ) and antlers
• vestigial organs
• connecting links
• Inheritance of small variations
• Did not differentiate between Somatic & germinal
variations
• Considered individual as the unit of natural selection
August 15, 2024
230
Neo-Darwinism
• Population is the unit of evolution
• The whole breeding population of species is considered instead of
individuals
• The population has a gene pool which shows various combinations &
recombinations
• New variations arise due to mutation
• Definitions
• Gene pool: Sum total of genes of all the individuals of a
population
• Gene flow: Movement of alleles from one population to another.
• Genetic drift: Sudden & random changes in the allele frequency
occurring in small populations by chance alone. August 15, 2024
 EXAMPLES OF GENETIC DRIFT
1. Founder’s effects
A founder effect occurs when a new colony is started
by a few members of the original population. This small
population size means that the colony may have:
• reduced genetic variation from the original population.
2. Bottleneck Effect
Population bottlenecks occur when a population's size is
reduced for at least one generation.
Bottleneck can reduce a population's genetic variation
by a lot, even if the bottleneck doesn't last for many
generations.

August 15, 2024 231

232 Hardy–Weinberg principle
🠶 The Hardy–Weinberg principle/ equilibrium states that both allele a
n
d
genotype frequencies in a population remain constant from
generation to generation; provided that, within a given population:
1. Mating is random
2. No mutations are arising
3. No gene flow
4. No selection
5. Population size is infinitely large
🠶 Genotype Frequency = (p+q)2 = p2 + 2pq + q2
🠶 p= Frequency of dominant allele
🠶 q= Frequency of recessive allele
🠶 FACTORS AFFECTING HWE
August 15, 2024
 HWE
🠶 I n a population of 1000 individuals, 360 belong ot
genotype AA, 480 to Aa, and the remaining 160 to aa.
Base on this data, the frequency of allele A in the
population is:
🠶( a ) 0.4 (b) 0.5 (c) 0.6 (d) 0.7
🠶T h e r e is a randomly mating population of Drosophila
in the lab. The frequency of an autosomal recessive
lethal gene is 0.4. Calculate the number of carrier flies
in this population.
 HWE
🠶 I n corn in a random sample of 1000 kernels, 9
are yellow 9 (y), and 91 are purple (Y). What is
the frequency of yellow allele in the population?
🠶( a ) 0.3 (b) 0.27 (c) 0.54 (d) 0.42
🠶T h e frequency of recessive allele ‗b‘ is 0.8 in a
population of crabs in HWE. What is the frequency
of homozygous dominant individuals?
 Variations
235
• Types
• Somatogenic / Blastogenic
• Continuous / Discontinuous
• Determinate / Indeterminate
• Meristic (quantitative)/ Substantive (qualitative)
• Causes of variations
• Mutations
• Genetic recombinations
• Migration
• Genetic drift
• Gene flow August 15, 2024

• Selection
 HUMAN
EVOLUTION
237
Evolution of man
🠶T h r e e features of each of the ancestors
🠶D r y o p i t h e c u s
🠶R a m a p i t h e c u s
🠶A u s t r a l o p i t h e c u s
🠶H o m o habilis
🠶H o m o erectus
🠶H o m o neanderthalensis
🠶C r o - Magnon, and
🠶H o m o sapiens leading to man of today. August 15, 2024
🠶
Dryopithecus
🠶A r m s & legs of equal length
🠶S e m i erect posture
🠶L a r g e canines
🠶F r o n t a l l y broadened jaws
🠶A u s t r a l o p i t h e c u s • Australopithecus
🠶S i m i l a r i t i e s with Apes • Similarities with man
🠶S m a l l in size – 4 ft • Walked nearly straight
🠶F a c e prognathous • Distinct lumbar curve
🠶C h i n absent, forehead • Pelvis broad and basin like
low • Teeth manlike with dental
🠶B u l g e of occipital region arch
small • Canine man like – did not
🠶E y e b r o w s projected over project beyond the level of
eyes other teeth
🠶C r a n i a l capacity– 450 • Simian gap between
to 600 cc incisors and canines absent
🠶H o m o erectus
🠶 5 ft tall
🠶C r a n i a l capacity 900 to 1100 cc
🠶F o o t arched to support body weight
🠶H a n d s had perfected the ‘precision
grip’ for holding twigs
🠶S l o p i n g forehead and thick eyebrows
🠶H u n t e r s & food gatherers
🠶U s e d stone tools
🠶L i v e d in caves & used fire for cooking
Homo sapiens neanderthalensis
🠶F o r e head low & slanting
🠶H e a v y eyebrow ridges
🠶C r a n i a l capacity 1450 c
🠶 1 . 5 metres height
🠶S e m i erect stooping posture
🠶 Cro-Magnon man (Homo sapiens fossils)
🠶1 . 8 metres tall
🠶E r e c t posture
🠶B o d y less hairy
🠶B r o a d and flat forehead
🠶C h i n prominent & nose narrow & elevated
🠶F a c e prognathous
🠶C r a n i a l capacity 1650 cc
🠶C a v e dwellers & hunters
🠶L e a r n t drawing & painting pictures
🠶B u r i e d their dead
August 15, 2024
 🠶H o m o sapiens sapiens
🠶E r e c t posture
🠶A r m s shorter than legs
🠶B r a i n box bout 1450 cc
🠶I n t e l l i g e n t logical developed speech
for communication
🠶F o r e h e a d more straight with slight eyebrow ridges
and prominent chin
🠶L e a r n t to cultivate plants & domesticate animals
of economic importance
 3. Biology and Human Welfare
(i) Human Health and Diseases
🠶
Pathogens; parasites causing human diseases (viruses, bacteria, protozoans, helminths and fungi) and their control;
Basicconcepts of immunology - vaccines; cancer, HIV and AIDS; Adolescence - drug and alcohol abuse.
🠶
Communicable and non-communicable diseases; modes of transmission, causative agents, symptoms and prevention;
viral diseases (common cold, chikungunya and dengue), bacterial diseases (typhoid, pneumonia, diphtheria and plague),
protozoal diseases (amoebiasis, and malaria, graphic outline of life cycle of Plasmodium), helmintic diseases (ascariasis,
and filariasis); fungal (ringworm); cancer - types of tumour (benign, malignant), causes, diagnosis and treatment,
characteristics of cancer cells (loss of contact inhibition and metastasis).
🠶
Immunity (definition and types – innate and acquired, active and passive, humoral and cell-mediated), Interferons –
definition, source and function, structure of a typical antibody molecule, types of antibodies – IgG, IgA, IgM, IgD and
IgE (function and occurrence, e.g., in serum, saliva, colostrum), vaccination and immunisation, allergies and allergens –
definitions and general symptoms of allergies; autoimmunity, primary and secondary lymphoid organs and tissues, brief
idea of AIDS – causative agent (HIV), modes of transmission, diagnosis (ELISA), symptoms, replication of retrovirus in
the infected human cell (including diagram) and prevention.
🠶 Alcoholism and smoking - effects on health.
🠶 Drugs: effects and sources of opioids, cannabinoids, cocaine and barbiturates.
🠶 Reasons for addiction; prevention and control of alcohol and drug abuse.
 (i) Human Health and Diseases
🠶H e a l t h : State of complete physical,
mental and social well-being
🠶D i s e a s e s
🠶C o m m u n i c a b l e
🠶N o n - communicable
(i) Human Health and Diseases

• Communicable diseases
🠶M o d e s of transmission
🠶C a u s a t i v e agents
🠶S y m p t o m s
🠶P r e v e n t i o n
 VIRAL DISEASES
Disease Causative Mode of Symptoms Preventive
Agent transmission Measures
Common cold Rhino viruses Droplet infection Nasal congestion and Maintenance
discharge, sore throat, of personal and
hoarseness, cough, public hygiene
headache, tiredness
Cikungunya Chikungunya Bite of female Fever and joint pain, Mosquito
virus (CHIKV) Aedes aegypti muscle pain, joint control
swelling and rashes on Gambusia fish
skin, headache

Dengue Dengue virus Through bite of Dehydration; high fever Elimination

(DEN) or female Aedes with neurological of mosquitoes
(Flavi virus) aegypti disturbances and febrile
single-stranded seizures; severe
August 15, 2024
RNA virus haemorrhage 2
4
 BACTERIAL DISEASES 248
Disease Causative Agent Mode of Nature and Symptoms Preventive
transmission Measures
Typhoid Salmonella typhi Contaminated Damages the intestinal wall. Causes Proper sanitation
food and water fever and weakness. Fever may last a and
few weeks. Relapse of fever is very Immunization.
common. TAB Vaccine
Pneumonia Streptococcus Droplet infection alveoli of the lungs get filled with fluid Maintenance of
pneumoniae leading to severe problems in personal and
and respiration. Fever, chills, cough and public hygiene
Haemophilus headache.
influenzae
Diphtheria Corynebacterium Droplet infection A sheet of thick, grey matter covers the Proper sanitation
diphtheriae back of the throat, thus creating and
difficulty in breathing, sore throat, fever, Immunization.
swollen lymph nodes

Plague Yersinia pestis Bite of rat flea Swollen lymph nodes in the groin, Elimination of
armpit or neck. Others symptoms rats, fleas
include fever, chills, headache, fatigue August 15, 2024

and muscle aches.

 PROTOZOAL DISEASES
Disease Causative Agent Mode of Symptoms Preventive
transmission Measures

Amoebiasis Entamoeba Contaminated Abdominal pain, Avoid

histolytica food and water burning, dysentery, contaminated
diarrhoea, food and water

Malaria Plasmodium spp Bite of female High fever with chill, Elimination of
Anopheles anemia, splenomegaly mosquito

August 15, 2024

2
4
Life cycle of Plasmodium
 HELMINTIC DISEASES
Disease Causative Agent Mode of Symptoms Preventive Measures
transmission
Ascariasis Ascaris Contaminated food Abdominal pain, Maintenance
lumbricoides and water burning, dysentery, of personal and public
diarrhoea, hygiene

Filariasis Wuchereria Bite of female Culex Swelling of feet Elimination of mosquito

Or bancrofti
Elephantiasis

FUNGAL DISEASES
Ring worm Microsporum, Skin-to-skin Reddish or brownish Maintenance
Trichophyton, contact, sharing patches of personal and public
Epidermophyton comb, towel, from hygiene
pets etc.
August 15, 2024

2
5
 CANCER
🠶C a u s e d by uncontrolled division of cells
🠶T y p e s of tumours
🠶B e n i g n
🠶M a l i g n a n t
🠶C h a r a c t e r i s t i c s of cancer cells
🠶T h e y do not show the property of contact inhibition
🠶T h e y may show metastasis
🠶C a n c e r o u s cells are immortal
🠶C a n c e r o u s cells are less differentiated (not undifferentiated2)
5 August 15, 2024
2
 CANCER
🠶T Y P E S ⚫ CAUSES
⚫ Physical: Radiations,
🠶S a r c o m a Mechanical injuries
🠶 Carcinoma ⚫ Chemicals (carcinogens):
Nicotine, pesticides, coal
🠶M e l a n o m a
⚫ Oncogenes
🠶 Leukaemia ⚫ Defective TSG

⚫ DIAGNOSIS ⚫ TREATMENT
⚫ GBP ⚫ Surgery
⚫ Biopsy ⚫ Chemotherapy
⚫ Radiography ⚫ Radiotherapy
⚫ Immunotherapy 2
5 August 15, 2024
3
 254

IMMUNITY
🠶 Types of Immunity
🠶I n n a t e : Non-specific, inborn, present since birth,
inherited
🠶A c q u i r e d : Specific, developed during life time
🠶T y p e s of acquired immunity
🠶C e l l mediated
🠶H u m o r a l
🠶A c t i v e
🠶P a s s i v e
August 15, 2024
 DIFFRENCES BETWEEN HUMORAL AND
CELL MEDIATED IMMUNITY
Humoral immunity Cell Mediated immunity
1 Mediated by B-lymphocytes Mediated by T-lymphocytes

2 Operates through formation of Operates through phagocytic cells.

antibodies
3 It acts on pathogens that invade Operates against those pathogens
body fluids which invade body cells

4 It hardly has any effect against It operates against cancer cells and
cancers and transplants. transplants.
 Differences between T-cells and B-cells
T-cells B-cells
1. Components of cell mediated immunity Component of humoral immunity

2. Mature in thymus Mature in bone marrow

3. Longer life span Short life span
4. Respond to cancerous cells and transplanted No response to cancer and transplanted
cells/organs cells/organs

Differences between Active and Passive immunity

Active immunity Passive immunity
1. Antibody produced by body’s own cells Antibodies are produced in some other
animal

2. Long lasting Short lived 25

6
August 15, 2024
3. Takes long to develop Develops quickly
 257

ANTIGEN: A foreign substance that stimulates the immune system

August 15, 2024

 TYPES OF ANTIBODIES
Function Occurrence
IgG Stimulate phagocytes and Most common
complement system, antibody in body
passive immunity to foetus fluids
IgA Protect from inhaled and ingested Main antibody found
antigens at mucosal sites
IgM Activates B-cells Membrane bound
IgD Present on lymphocyte surface as Membrane bound
receptors. Activates B-cells

IgE Mediate allergic responses Membrane bound

 259
INTERFERONS
🠶D e f i n i t i o n : Specific anti-viral proteins
released by virus-infected cells
🠶S o u r c e : Virus-infected cells
🠶F u n c t i o n : Protect other cells
by interfering with viral
replication
August 15, 2024
260
Antibodies Interferon
🠶S l o w acting 🠶Q u i c k acting
an
dlong lasting a
n
dtemporary
🠶 A c t outside the 🠶I n s i d e the cell
cell 🠶A g a i n s t virus
🠶A g a i n s t bacterial only
and viral infection

August 15, 2024

 Vaccination Immunization

Vaccination is the process of Immunization is the process of the

Definition introducing the body to a body building up natural defenses
weakened form of the virus. against the bacteria.

Immunization is the process that

Vaccine exists outside the body
Process happens within the body after the
and is later introduced to the body
vaccine is introduced to the body.
🠶A l l e r g y : Response of the body to entry
of allergens
🠶 A n allergen is a substance that starts the alergic
reaction
🠶S y m p t o m s :
🠶R a s h e s on skin,
🠶i t c h i n g ,
🠶i n f l a m m a t i o n of mucous membrane,
🠶d i f f i c u l t y in breathing,
🠶w a t e r y eyes
🠶I n v o l v e m e n t of IgE and histamine
🠶S o m e forms of allergy: Hay fever and
Anaphylactic 2s6h
2ock
 Autoimmunity
🠶D e f i n i t i o n : When one‘s own immune system atacks
his/her own body cells/molecules
🠶D i s e a s e s due to autoimmunity
🠶I n s u l i n - dependent diabetes mellitus
🠶M u l t i p l e sclerosis
🠶R h e u m a t o i d arthritis
🠶M y a s t h a e n i a gravis
🠶T r e a t e d by immuno-suppressants (also used in organ
transplantation)
 Primary and Secondary lymphoid organs and Tissues
🠶 Lymphoid organs - associated with maturation and proliferation of lymphocytes
and
lymph.
🠶 2 types:
🠶 Primary lymphoid organs (Both T-cells and B-cells) form in bone marrow but
whereas B cells also mature in bone marrow, the T cells have to migrate to thymus
for maturation
🠶 The organs in which T-lymphocytes and B-lymphocytes mature.
🠶E x a m p l e s : Thymus and bone marrow
🠶 Secondary or peripheral lymphoid organs: These are the sites of lymphocyte
activation by antigens. Activation leads to clonal expansion and affinity maturation.
🠶 The lymphocytes migrate to these lymphoid organs after maturation.
🠶E x a m p l e s : Spleen, tonsils, MALT(mucosal associated lymphoid tissues), GALT
265 🠶
AIDS
Transmitted by three main routes:
🠶 Sexual contact
🠶 Exposure to infected body fluids or tissues
🠶 From mother to child during pregnancy, delivery, or breastfeeding (vertical
transmission)
🠶 Symptoms: Non-functional immune system
🠶 Prolonged fevers
🠶 sweats (particularly at night)
🠶 Swollen lymph nodes, Chills
🠶 Weakness and weight loss.
🠶 Diarrhoea
🠶 Psychiatric and neurological symptoms
🠶 Cancers
🠶 Diagnosis: ELISA August 15, 2024

🠶 Prevention
 ADOLESCENT ISSUES
🠶A l c o h o l i s m : Dependence on alcohol
🠶R e a s o n s
🠶P e e r pressure
🠶S o c i a l status
🠶D e s i r e for excitement
🠶E s c a p e from failures
🠶R e m o v a l of inhibitions
🠶 Effects on health
🠶 Fatty liver syndrome
🠶 Neurological problems 267

🠶 Immuno-suppression August 15, 2024

 DRUG ADDICTION
🠶R E A S O N S
🠶P e e r pressure
🠶C u r i o s i t y
🠶E a s i l y available
🠶E u p h o r i a
🠶R e l i e v e s tension
🠶E F F E C T S ON HEALTH
🠶D a m a g e to liver, brain, kidney
🠶S l o w reflexes, inability to take decisions
🠶I m p a i r e d secondary sexual characters
🠶A g g r e s s i v e behaviour, social maladjustment
268

🠶P R E V E N T I O N
August 15, 2024
 Different types of addictive drugs
Type of drug Example Source Effects
Opioids Opium, morphine, Papaver somniferum Relieve pain, suppress
heroin, pethidine, Latex of the unripe brain functions
methadone fruits

Cannabinoids Bhang, charas, Cannabis sativa Euphoria, deep sleep

ganja, marijuana Leaf

Barbiturates Phenobarbital, Derivatives of Anxiolytic, Addiction,

Seconal, Nembutal barbituric acid allergenic

Coca Cocaine (Coke, Erythroxylum coca Euphoria,

alkaloids crack) hallucination
269 August 15, 2024
The image of a flowering branch of a plant is shown below. It is a source
of a drug that acts as:

Answer: Hallucinogen
 3. Biology and Human Welfare
(ii) Strategies for enhancement in food production
Improvement in food production: plant breeding, tissue culture, single cell protein, biofortification, apiculture and
🠶
animal husbandry.
🠶 Measures for proper maintenance of dairy farms and poultry farms; apiculture and pisciculture – definition,
brief
idea and advantages of each.
Animal breeding - brief idea of inbreeding, out-breeding, cross-breeding and artificial insemination, Multiple
🠶
Ovulation Embryo Transfer Technology (MOET). Advantages of artificial insemination.
Plant breeding – a brief reference to green revolution. Steps in plant breeding (germplasm collection, evaluation,
🠶
selection, cross hybridisation or artificial hybridisation (concept of emasculation and bagging), selection and
testing of superior recombinants, testing, release and commercialisation of new cultivars),
🠶 advantages of mutation
breeding
🠶 examples of some Indian hybrid crops like wheat, rice, maize, sugarcane, millet.
🠶 Definition of heterosis.
Application of plant breeding for disease resistant (examples of some disease resistance varieties of crops for
🠶
example wheat (Himgiri), Brassica (Pusa swarnim), cauliflower (Pusa shubhra, Pusa snowball K – 1), Cow pea (Pusa
komal), chilli (Pusa sadabahar), insect resistance (examples of some insect resistant varieties of crops – Brassica
(Pusa Gaurav), flat bean (Pusa sem 2, Pusa sem 3), okra (Pusa sawani, Pusa A–4))
🠶 improved food quality (biofortification) protoplasmic fusion.
 3. Biology and Human Welfare
(iii) Microbes in Human Welfare
🠶 In household food processing, industrial production, sewage treatment, energy generation
and microbes as biocontrol agents and biofertilisers. Antibiotics; production and judicious use.
🠶 Use of microbes in:
🠶 Household products: Lactobacillus (curd), Saccharomyces (bread), Propionibacterium (Swis
cheese);
🠶 Industrial products: beverages (with and without distillation), antibiotics (Penicillin – discovery
and use); sources (microbes) and uses of organic acids, alcohols and enzymes (lipase,
pectinase, protease, streptokinase) in industry, source (microbes) and applications of
Cyclosporin-A, Statins.
🠶 Sewage treatment – primary and secondary treatment; production of biogas (methanogens,
biogas plant, composition of biogas and process of production); microbes as biocontrol
agents (microbes –Bacillus thuringiensis Trichoderma, Nucleopolyhedrovirus (Baculovirus), and
ladybird, dragonfly.
🠶 Harmful effects of chemical pesticides; IPM
🠶 Microbes as biofertilisers (Rhizobium, Azospirillum, Azotobacter, Mycorrhiza, Cyanobacteria).
 (iii) Microbes in Human Welfare
🠶U s e of microbes in household products
🠶L A B : Lactic acid bacteria (Lactobacillus): Curd,
Vitamin B12, inhibit the growth of harmful microbes
in gut
🠶S a c c h a r o m y c e s spp: Fermented food products
and beverages, e.g., beer, bread, yogurt, cheese,
idli, dosa, toddy
🠶P r o p i o n i b a c t e r i u m shermanii: Swiss cheese
(iii) Microbes in Human Welfare
Use of Microbes in Industrial Products
🠶F e r m e n t e d beverages: Quality depends on the
type of raw material used for fermentation and the type
of processing (with or without distillation)
🠶Saccharomyces spp: Wine, beer, whisky, brandy, rum
🠶W i n e and beer: without distillation
🠶W i n e : (grape Vitis labrusca and V. vinifera), berries, apples, cherries,
dandelion, palm and rice
🠶B e e r : Cereal grains usually barley, corn or rice
🠶W h i s k y , brandy and rum: By distillation of fermented broth
(iii) Microbes in Human Welfare
Use of Microbes in Industrial Products
🠶A n t i b i o t i c s : Chemical substances produced
by some microbes and can kill or retard the growth of
other (disease-causing) microbes
🠶P e n i c i l l i n from Penicillium notatum (serendipity)
🠶A l e x a n d e r Fleming discovered accidentally while working on
Staphylococcus
🠶E r n e s t Chain and Howard Florey realised its potential
🠶N o b e l Prize 1945
🠶I n d i s c r i m i n a t e use has resulted in development of drug-
resistant strains of bacteria
 (iii) Microbes in Human Welfare
Industrial Products: Chemicals, enzymes and other bioactive mols.

Product Micro-organism used Uses

Citric acid Aspergillus niger Food additive

Acetic acid Acetobacter aceti Production of vinyl acetate monomer

Butyric acid Clostridium butylicum Precursor to biofuel, industrial solvent

Lactic acid Lactobacillus Food preservative, curing agent, flavoring agent

Lipase Aspergillus oryzae Food, detergent, pharmaceutical, leather, textile,

cosmetic and paper industries
 (iii) Microbes in Human Welfare
Product Micro-organism used Uses
Pectinase Aspergillus niger Extraction of fruit juice, wine production
(clearing agent), retting of fibers
Proteases Streptomyces In bakery to reduce mixing time, to
microflavus, Bacillus decrease dough consistency, to reduce
spp, Aspergillus gluten strength, to control bread texture
candidus, A. oryzae and to improve flavour
Streptokinase Streptococcus Break down clots in some cases of
myocardial infarction, pulmonary
embolism and arterial thromboembolism
Cyclosporin A Trichoderma Immunosuppressant
polysporum
Statins Monascus purpureus Lower cholesterol
 (iii) Microbes in Human Welfare
Use of Microbes in Sewage Treatment
🠶S e w a g e : Municipal waste-water containing human excreta
🠶S T P : Sewage treatment plant
🠶P r i m a r y treatment: Physical removal of particles through filtration
and sedimentation. Primary sludge is removed, effluents are subjected to
secondary treatment
🠶S e c o n d a r y (biological) treatment: aeration causes formation of flocs
(masses of bacteria e.g., Nitrosomonas, Pseudomonas, Nitrospira associated
with fungal filaments to form mesh-like structures)
🠶 I t reduces the BOD (Biochemical Oxygen Demand):
🠶B O D : The amount of oxygen that would be consumed if all the organic matter
in one litre of water were oxidised by bacteria
 (iii) Microbes in Human Welfare
Use of Microbes in Biogas production
Biogas: A mixture of gases produced as a result of action of anaerobic microbes on domestic and
agricultural waste.
Main constituents Methane (50-80%), CO2 (15-40%) and H2S (1-5%)
(iii)Microbes in Human Welfare
Use of Microbes in Biogas production
Significance: Advantages of Biogas
1. Renewable source of energy
2. Cheap and easy to produce
3. Provide organic fertilizers
4. Reduce pollution
 (iii) Microbes in Human Welfare
Use of Microbes as Bio-control Agents
🠶B i o - control: Control of pest using micro-organisms or their
products.
🠶B i o - control agents are important part of IPM
🠶B a c i l l u s thuringiensis:
🠶S p o r e s
🠶B t - crops
🠶Trichoderma spp: Against fungal diseases of plants
🠶Baculoviruses (Nucleopolyhedro virus): Species-specific. U
e
s
d
against insects and other arthropods
 (iii) Microbes in Human Welfare
Use of NON-Microbes as Bio-control
Agents
🠶L a d y b i r d , also called ladybug (Coccinella septumpunctata)
is a predator insect. It feeds on aphids which damage the
crops. In this way, these predatory ladybirds, protect the
crops in a natural way.
🠶S i m i l a r l y , nymphs of the dragonfly (Brachytron pratense)
feed selectively on the larvae of Anopheles mosquito. It helps
in controlling malaria.
 (iii) Microbes in Human Welfare
Use of Microbes as Biofertilisers
Biofertilisers: Microbes which increase the fertility of soil
Symbiotic bacteria: Rhizobium
Symbiotic fungi: Glomus (Mycorrhiza), absorb phosphorus
Free-living bacteria: Azospirillum, Azotobacter
Cyanobacteria: Nostoc, Anabaena, Oscillatoria
 Integrated Pest Management
286 🠶 A technique which integrates the various cultural and biological
methods of pest control to ensure continued production of the crops
without the excessive use of pesticides.
🠶 Involves following methods
🠶C u l t u r a l methods: Crop rotation, early or late planting, mulching,
modifying soil reaction, use of trap crops, proper spacing,
weeding
🠶P h y s i c a l and mechanical methods: Catching and killing insects
and rodents,
🠶U s e of resistant varieties
🠶B i o l o g i c a l methods: use of parasites and predators
🠶S a n i t a t i o n : removal / burning of infected residues
🠶D e c r e a s e d usage of chemical/synthetic pesticides August 15, 2024
 4. Biotechnology and its Applications
(i) Biotechnology - Principles and processes
🠶 Genetic Engineering (recombinant DNA technology).
🠶 Definition and principles of biotechnology;
Isolation of genomic (chromosomal) DNA (from bacteria/plant cell/animal cell, by cell lysis), isolation
🠶
of gene of interest (by electrophoresis),
🠶 Steps of formation of recombinant DNA
🠶 Discovery, nomenclature, features and role of restriction enzymes (EcoRI, HindII), ligase;
Cloning vectors (features of a good cloning vector, examples of cloning vectors like pBR322,
🠶
Agrobacterium, retroviruses, bacterial artificial chromosome (BAC), yeast artificial chromosome
(YAC))
🠶 Methods of transfer of rDNA into a competent host, e.g. by direct method (temperature shock),
microinjection, gene gun
🠶 Methods of selection of recombinants (antibiotic resistance, insertional inactivation/blue-
white selection)
🠶 Cloning of recombinants, i.e., gene amplification (by in vivo or in vitro method - using PCR
technique),
bioreactor (basic features and uses of stirred tank and sparged tank bioreactors), downstream
🠶
288 (i) Biotechnology - Principles and processes
🠶B i o t e c h n o l o g y : deals with techniques of using
live organisms or enzymes from organisms to
produce products and processes useful to
humans. E.g., making curd, bread or wine.
🠶T h e definition given by European Federation
of Biotechnology (EFB) is as follows:
🠶‘ T h e integration of natural science and organisms,
cells, parts thereof, and molecular analogues for
products and services’.
August 15, 2024
289 (i) Biotechnology - Principles and processes
🠶T w o core techniques of modern biotechnology are:
🠶( i ) Genetic engineering: Techniques to alter the DNA
and RNA, to introduce these into host organisms and thus
change the phenotype of the host organism.
🠶( i i ) Maintenance of sterile ambience to enable growth
of only the desired microbe/eukaryotic cell in large
quantities for the manufacture of biotechnological
products like antibiotics, vaccines, enzymes, etc.
August 15, 2024
290 PROCESSES OF RECOMBINANT DNA TECHNOLOGY
🠶 Recombinant DNA technology involves several steps in specifc
sequence such as
🠶 isolation of DNA
🠶 fragmentation of DNA by restriction endonucleases
🠶 isolation of a desired DNA fragment
🠶 ligation of the DNA fragment into a vector
🠶 transferring the recombinant DNA into the host
🠶 Selecting the transformed host
🠶 culturing the host cells in a medium at large scale and
🠶 extraction of the desired product.
🠶 Let us examine each of these steps in some details.
August 15, 2024
 human
chromosome bacterial
interferon gene
291 plasmid
same restriction
enzyme splits both
types of DNA

interferon gene
joins with plasmid
by sticky ends Plasmid with
interferon gene

plasmid is taken interferon

up by bacterium injected
into patient
bacterium

each daughter
bacterium inherits August 15, 2024
interferon gene
interferon-producing bacterial population
292 Isolation of the Genetic Material (DNA)
🠶R e m o v a l of cell wall and membrane by treating the bacterial
cells/plant or animal tissue with enzymes such as lysozyme
(bacteria), cellulase (plant cells), chitinase (fungus).
🠶 T h e RNA is removed by treatment with ribonuclease
🠶P r o t e i n s are removed by treatment with protease.
🠶P u r i f i e d DNA is precipitated out by addition of chiled
ethanol.
🠶 I t can be spooled out as fine threads on a capillary tube.
August 15, 2024
 Separation and isolation of DNA fragments
293
🠶 The cutting of DNA by restriction endonucleases results in the fragments of DNA.
🠶 DNA fragments are negatively charged. They can be separated by agarose
gel electrophoresis
🠶 The DNA fragments separate according to their size.
🠶 The smaller the fragment size, the farther it moves.
🠶 The separated DNA fragments can be seen as Bright orange coloured bands after
staining the DNA with ethidium bromide followed by exposure to UV radiation.
🠶 The separated bands of DNA are cut out from the agarose gel and
extracted fromthe gel piece. This step is known as elution.
🠶 The DNA fragments purified in this way are used in constructing recombinant
DNA by joining them with cloning vectors.
August 15, 2024
 Construction of recombinant DNA
296

🠶T h e construction of the first recombinant DNA emerged from

the possibility of linking a gene encoding antibiotic resistance
with a native plasmid of Salmonella typhimurium.
🠶S t a n l e y Cohen and Herbert Boyer accomplished this ni
1972 by isolating the antibiotic resistance gene by cutting out
a piece of DNA from a plasmid which was responsible for
conferring antibiotic resistance.
🠶T h e cutting of DNA at specific locations became possible
with the discovery of ‘molecular scissors’– restriction
enzymes. August 15, 2024
 TOOLS OF RECOMBINANT DNA TECHNOLOGY
297
Restriction Enzymes
🠶 In the year 1963, the two enzymes responsible for restricting the growth
of bacteriophage in Escherichia coli were isolated.
🠶 One of these added methyl groups to DNA, while the other cut DNA.
The latter was called restriction endonuclease.
🠶 The first restriction endonuclease – Hind II, was isolated and characterised
five years later.
🠶 It was found that Hind II always cuts DNA molecules at a particular point
by recognising a specific sequence of six base pairs. This specific base
sequence is known as the recognition sequence for Hind II.
🠶 Besides Hind II, today we know more than 900 restriction enzymes that
have been isolated from over 230 strains of bacteria each of which recognise
different recognition sequences.
August 15, 2024
 Nomenclature of restriction enzymes
298
🠶T h e first letter of the name comes from the genus and
the second two letters come from the species of the
prokaryotic cell from which they were isolated.
🠶F o r example, EcoRI comes from Escherichia coli RY
13.
🠶 E = Escherichia (Genus)
🠶 c o = coli (species)
🠶 R = Type of strain.
🠶R o m a n numeral = the order of isolation from that strain
of bacteria. August 15, 2024
 Action of RE
299
🠶E a c h restriction endonuclease functions
by ‗inspecting‘ the length of a DNA
sequence.
🠶O n c e it finds its specific recognition sequence,
it will bind to the DNA and cut each of the two
strands of the double helix at specific points in
their sugar-phosphate backbones
🠶E a c h restriction endonuclease recognises a
specific palindromic nucleotide sequences in the
DNA.
 RESTRICTION ENZYMES
300
🠶 For example, the following sequences reads the same on the two strands
in 5'  3' direction. This is also true if read in the 3'  5' direction.
5' —— GAATTC —— 3'
3' —— CTTAAG —— 5'
🠶 Restriction enzymes cut the strand of DNA a little away from the centre
of the palindrome sites, but between the same two bases on the opposite
strands. This leaves single stranded portions at the ends. There are
overhanging stretches called sticky ends on each strand.
🠶 These are named so because they form hydrogen bonds with their
complementary cut counterparts. This stickiness of the ends facilitates the
action of the enzyme DNA ligase.
🠶 When cut by the same restriction enzyme, the resultant DNA fragments
have the same kind of ‗sticky-ends‘ and, these can be joined together (end-
to-end) using DNA ligases August 15, 2024
 ACTION OF REs
301

August 15, 2024

 CLONING VECTORS
🠶 A vector is used to transfer the foreign DNA into a suitable
host and to form many copies of the foreign DNA.
🠶 A DNA fragment must be inserted into a cloning vector.
🠶 A cloning vector is a DNA molecule that has an origin
of replication and is capable of replicating in a bacterial
cell.
🠶S o m e of the most commonly used vectors are
🠶 Retroviruses
🠶 Plasmids (pBR322)
🠶 Agrobacterium (Ti plasmid)
🠶 Bacterial artificial chromosomes (BAC)
🠶 Yeast artificial chromosomes (YAC)
30 August 15, 2024

3
 CLONING VECTORS
304
🠶 T h e following are the features that are required to facilitate cloning into
a vector.
🠶 (i) Origin of replication (ori) : This is a sequence from where replication
starts and any piece of DNA when linked to this sequence can be made to
replicate within the host cells. This sequence is also responsible for
controlling the copy number of the linked DNA.
🠶 (ii) Selectable marker : Helps in identifying and eliminating non-
transformants and selectively permitting the growth of the transformants.
🠶 (iii) Cloning sites: In order to link the alien DNA, the vector needs to have
very few, preferably single, recognition sites for the commonly used
restriction enzymes. Presence of more than one recognition sites within the
vector will generate several fragments, which will complicate the gene
cloning.
August 15, 2024
Plasmid Cloning Vectors

🠶 Plasmids are circular, double-stranded DNA molecules

that
exist in bacteria and in the nuclei of some eukaryotic cells.
🠶 They can replicate independently of the host cell.
🠶 The size of plasmids ranges from a few kb to near 100
kb
🠶 Can hold up to 10 kb fragments
🠶 Plasmids have an origin of replication, antibiotic
resistance
genes as markers, and several unique restriction sites.
🠶
After culture growth, the cloned fragment can be recovered
easily. The cells are lysed and the DNA is isolated and
purified.
🠶
A DNA fragment can be kept indefinitely if mixed
withglycerol in a –70O C freezer.
305 August 15, 2024
 Competent Host
306
(For Transformation with rDNA)
🠶S i n c e DNA is a hydrophilic molecule, it cannot pass through
cell membranes. Why?
🠶 I n order to force bacteria to take up the plasmid, the bacterial cells
mustfirst be made ‘competent’ to take up DNA.
🠶T h i s is done by treating them with a specific concentration of a divalent
cation, such as calcium, which increases the efficiency with which DNA
enters the bacterial cell.
🠶R e c o m b i n a n t DNA can then be forced into such cells by incubating
the cells with recombinant DNA on ice, followed by placing them
briefly at 420C (heat shock), and then putting them back on ice. This
enables the
bacteria to take up the rDNA. August 15, 2024
 Vectorless Or Direct Methods Of
Transformation
🠶 Electroporation: Temporary holes in plasma membrane
by using electric current
🠶T r a n s f e c t i o n : Treating bacterial cells with specific
concentration of CaCl 2 to facilitate entry of foreign
DNA
🠶M i c r o i n j e c t i o n : Introduced directly into nucleus
by using micropipettes
🠶B i o l i s t i c or gene gun: Microparticles of gold or tungsten
coated with foreign DNA are bombarded into target
host cells with high velocity
30
August 15, 2024
7
308 Selection of recombinants
Direct Selection Method
🠶T h e selection of recombinant relies on the presence of an
antibiotic resistance gene (ARG) on the plasmid vector, e.g.
Ampicillin resistant gene (ampr).
🠶 I f the host cells transformed with this plasmid are grown on
a medium containing ampicillin only those cells which
contain the plasmid will be able to grow and form colonies.
🠶B u t at this stage we would not be able to know which
of these colonies contain the recombinant plasmid with
the designed gene and contain only the re-ligated
vector plasmid.
August 15, 2024
309
Selection of recombinants
Insertional inactivation
🠶 Plasmid pBR322 contains the genes for resistance against tetracycline &
ampicillin.
🠶 If the target gene is inserted into a restriction enzyme‘s site located in one
of these resistance genes, it will inactivate that particular gene, e.g., the gene
for resistance against ampicillin
🠶 As a result the host cell which contains the recombinant plasmid will become
sensitive to ampicillin but retains resistance against tetracycline.
🠶 So they will be able to grow in the medium containing tetracycline only
and
not ampicillin.
🠶 In contrast non-recombinant will be resistant to both ampicillin
and tetracycline.
August 15, 2024
310

August 15, 2024

 Blue White Selection
311

August 15, 2024

Selection of recombinants
Blue White Method
🠶T h i s method is based on the insertional
inactivation of Lac Z gene present on the vector
which can cleave a colourless X-gal into a blue
coloured product.
🠶T h u s in the presence of X-gal the host cells which
carry the recombinant plasmid molecules will
form white coloured colonies and those which
carry non recombinant DNA molecules will form
blue coloured colonies.
August 15, 2024
 Amplification of Gene of Interest using PCR
313 (Polymerase Chain Reaction)
🠶 Steps
🠶 Denaturation (90oC)
🠶 Primer annealing (50oC)
🠶 Primer extension (70oC)
🠶 In this reaction, multiple copies of the gene of interest is synthesised
in vitro using two sets of primers and Taq DNA polymerase.
🠶 The enzyme extends the primers using the nucleotides provided in
the reaction and the genomic DNA as template. If the process of
replication of DNA is repeated many times, the segment of DNA can
be amplified to approximately billion times.
🠶 Taq DNA polymerase (isolated from bacterium, Thermus aquaticus),
remains active during high temperature induced denaturation
(thermostable) of double stranded DNA.
August 15, 2024

🠶 The amplified fragment can be ligated with a vector for further cloning
 Bioreactors
315
🠶S m a l l volume cultures cannot yield appreciable
quantities of products. To produce in large quantities, the
development of bioreactors, where large volumes (100-
1000 litres) of culture can be processed, was required.
🠶T h u s , bioreactors can be thought of as vessels in which
raw materials are biologically converted into specific
products, individual enzymes, etc., using microbial plant,
animal or human cells.
🠶 A bioreactor provides the optimal conditions for
achieving the desired product by providing optimum
growth conditions (temperature, pH, substrate, salts,
vitamins, oxygen). August 15, 2024
 Bioreactors
316 🠶 The most commonly used bioreactors are of stirring type.
🠶 A stirred-tank reactor is usually cylindrical or with a curved base.
🠶 The stirrer facilitates even mixing and oxygen availability throughout
the bioreactor.
🠶 Alternatively air can be bubbled through the reactor (sparged)
🠶 A bioreactor has
🠶a n agitator system
🠶 a n oxygen delivery system
🠶 a foam control system
🠶 a temperature control system
🠶 p H control system
🠶s a m p l i n g ports so that small volumes of the culture can be August 15, 2
0
2
4

withdrawn periodically.
 Downstream Processing
319 🠶A f t e r completion of the biosynthetic stage, the product
has to be subjected through a series of processes before it
is ready for marketing as a finished product.
🠶T h e processes include separation and purification,
whichare collectively referred to as downstream
processing.
🠶T h e product has to be formulated with suitable
preservatives.
🠶S u c h formulation has to undergo clinical trials as in case
of drugs.
🠶S t r i c t quality control testing for each product is also
required.
🠶T
from h eproduct
downstream processing and quality control testing v
to product. a
ry
August 15, 2024
 4. Biotechnology and its Applications
(ii) Biotechnology and its applications
🠶 Applications of biotechnology in health and agriculture: human insulin and vaccine
production, stem cell technology, gene therapy; genetically modified organisms - Bt crops;
transgenic animals; biosafety issues, biopiracy and biopatents.
🠶 In agriculture: for production of crops tolerant to abiotic stresses (cold, drought, salt,
heat); pest-resistant crops (Bt-crops, RNAi with reference to Meloidogyne incognita);
biofortification crops with enhanced nutritional value (golden rice, wheat – Atlas 66, maize
hybrids, iron fortified rice).
🠶 In medicine: insulin, and vaccine production, definition of stem cells and application
of stem cell technology, gene therapy – with reference to treatment of SCID, molecular
diagnosis by PCR, ELISA ((the details of technique of ELISA are not required) and use of
DNA/RNA probe.
🠶 Transgenic animals for bioactive products like alpha-1-antitrypsin for emphysema, alpha-
lactalbumin; vaccine safety testing, chemical safety testing; study of diseases.
🠶 Role of GEAC; Definition and two examples of biopiracy, biopatent; ethical issues.
321
APPLICATIONS OF BIOTECHNOLOGY
🠶 Organisms carrying foreign genes(DNA) are termed as GMO or transgenic
🠶 These organisms could be bacteria, fungi, plants or animals whose genes are
manipulated
🠶 Useful in many ways to mankind
🠶 Transgenic crops contain genes which have been artificially inserted
instead of hybridisation.
🠶 The gene which is inserted is known as TRANSGENE
🠶 GM plants have been useful in many ways. Genetic modification has:
🠶 (i) made crops more tolerant to abiotic stresses (cold, drought, salt, heat).
🠶 (ii) reduced reliance on chemical pesticides (pest-resistant crops).
🠶 (iii) helped to reduce post harvest losses.
🠶 (iv) increased efficiency of mineral usage by plants (this prevents early
fertility of soil). exhaustion of
August 15, 2024

🠶 (v) enhanced nutritional value of food, e.g., Vitamin ‘A’ enriched rice.
 APPLICATION IN AGRICULTURE
322
🠶I n c r e a s e in food production brought about by
🠶A g r o c h e m i c a l based agriculture – plant breeding
techniques like hybridization with use of agrochemicals &
better management practices
🠶O r g a n i c agriculture – reducing need for chemical
fertilizers & pesticides but expensive
🠶G e n e t i c a l l y engineered crops – increasing yield

August 15, 2024

 PRODUCTION OF INSECT RESISTANT
323 Bt crops
🠶T h e r e are a number of cry genes in Bacillus thuringiensis which
code for an insecticidal protein called cry protein
🠶 T h e choice of genes depends upon the crop and the targeted pest,
as most Bt toxins are insect-group specific
🠶 F o r example
🠶 T h e genes cryIAc and cryIIAb control the cotton bollworms
🠶 T h e gene cryIAb controls corn borer
🠶T h i s toxin gene has been cloned from bacteria and transferred
to many plants
🠶E x a m p l e s are Bt cotton Bt rice, Bt tomato, Bt potato, Bt soybe August 15,

an
2024
 WHY Bt TOXIN DOES NOT KILL BACTERIA
324
🠶F o r m protein crystals during a particular phase
of growth
🠶C r y s t a l s contain toxin called Bt toxin or Cry toxin
🠶E x i s t s in inactive form in bacteria
🠶O n l y when ingested by insect converted to active
form due to alkaline pH of the gut which solubilises
the crystal.
🠶H e n c e kills the insect which ingests it

August 15, 2024

 Pest Resistant Plants
325 Several nematodes parasitise a wide variety of plants and animals including human
🠶
beings. A nematode Meloidogyne incognita infects the roots of tobacco plants and
causes a great reduction in yield. A novel strategy was adopted to prevent this
infestation which was based on the process of RNA interference (RNAi).
RNAi takes place in all eukaryotic organisms as a method of cellular defense.
🠶
T
h
ismethod involves silencing of a specific mRNA due to a complementary dsRNA
molecule that binds to and prevents translation of the mRNA (silencing).
The source of this complementary RNA could be from an infection by viruses
🠶
having RNA genomes or mobile genetic elements (transposons) that replicate via an
RNA intermediate.
Using Agrobacterium vectors, nematode-specific genes were introduced into the
🠶
hostplant. The introduction of DNA was such that it produced both sense and anti-sense
RNA in the host cells. These two RNA’s being complementary to each other formed a
double stranded (dsRNA) that initiated RNAi and thus, silenced the specific mRNA of
the nematode.
The consequence was that the parasite could not survive in a transgenic host
🠶
expressing specific interfering RNA. The transgenic plant therefore got itself protected
from the parasite.

August 15, 2024

 RNAi 326

RNA silencing refers to a group of techniques by which the expression of a gene is

suppressed by the introduction of an antisense RNA molecule.
🠶 Discovered by Andrew Fire and Craig C. Mello (Nobel Prize, 2006)
🠶 Worked on the nematode worm C. elegans
🠶 The most common and well-studied example is RNA interference.
🠶 In this technique, endogenously expressed microRNA or exogenously derived smal
interfering RNA induces the degradation of complementary mRNA.
🠶 RNA interference has an important role in defending cells against
parasitic nucleotide sequences – viruses and transposons – but also in directing
development as well as gene expression in general.
🠶 Enzymes detect double stranded RNA (that is not normally found in cells) and digest
it into small pieces that are not able to cause disease.
August 15, 2024
Dicer

RNA induced
Silencing complex
 Biofortification 328

🠶B i o f o r t i f i c a t i o n is the idea of breeding crops to increase

their nutritional value.
🠶T h i s can be done either through conventional selective
breeding, or through genetic engineering.
🠶 Example: Golden rice to fight night blindness.

August 15, 2024

 APPLICATIONS IN MEDICINE
Production of Genetically Engineered Insulin

🠶M u t a n t strains of E. coli used to avoid bacteria attacking ―foreign‖

genes
🠶I n s u l i n gene inserted next to B-galactosidase gene of E. coli which
controls transcription
🠶B a c t e r i a l cells replicate and make copies of insulin gene
🠶I n s u l i n protein is purified (B-galactosidase removed)
🠶C h a i n s are mixed and disulfide bridges form
🠶F i n a l product is Humulin - chemically identical to human insulin
 Vaccine production
🠶R e c o m b i n a n t vaccines are made using bacterial or yeast
cells.
🠶 A small piece of DNA from the virus or bacterium against
is inserted into the host cells.
🠶F o r example, to make the hepatitis B vaccine, part of the
DNA from the hepatitis B virus is inserted into the DNA of
yeast cells.
🠶T h e s e yeast cells are then able to produce one of the surface
proteins from the hepatitis B virus, and this is purified and
used as the active ingredient in the vaccine.
 Stem cell technology
🠶 Definition: Stem cells have the ability to repair damaged cells. They can evolve
into any type of cell.
🠶 Applications of Stem Cells
🠶 Following are the important applications of stem cells:
🠶 Tissue Regeneration: The stem cells can be used to grow a specific type of tisue
or organ. This can be helpful in kidney and liver transplants.
🠶 Treatment of Cardiovascular Disease: Scientists have developed
blood vessels in mice using human stem cells.
🠶 Treatment of Brain Diseases: Stem cells can also treat diseases such as
Parkinson’s disease and Alzheimer’s. These can help to replenish the damaged
brain cells.
🠶 Blood Disease Treatment: The adult hematopoietic stem cells are used to
treat cancers, sickle cell anaemia, and other immunodeficiency diseases. These
stem cells can be used to produce red blood cells and white blood cells in the
body.
 Gene Therapy
334 🠶 Gene therapy is a collection of methods that allows correction of a gene defect.
🠶 Correction of a genetic defect involves delivery of a normal gene into the individual
or embryo to take over the function of and compensate for the non-functional gene.
🠶 The first clinical gene therapy was given in 1990 to a 4-year old girl with adenosine
deaminase (ADA) deficiency. The disorder is caused due to the deletion of the gene for
ADA.
🠶 In some children ADA deficiency can be cured by bone marrow transplantation.
🠶 Lymphocytes from the blood of the patient are grown in a culture outside the body.
🠶 A functional ADA cDNA (using a retroviral vector) is then introduced into these
lymphocytes, which are subsequently returned to the patient.
🠶 However, as these cells are not immortal, the patient requires periodic infusion of such
genetically engineered lymphocytes.
🠶 However, if the gene isolate from marrow cells producing ADA is introduced into cels
at
early embryonic stages, it could be a permanent cure.
August 15, 2024
 Molecular Diagnosis
336

🠶P C R : To detect HIV, cancers

🠶U s e of probe
🠶E L I S A : Early diagnosis of HIV, viral infections
🠶M i c r o a r r a y : DNA chips
🠶 G e l electrophoresis
🠶G e n e cloning
🠶M o n o c l o n a l antibodies

August 15, 2024

 Transgenic Animals
337
🠶 T o study normal physiology and development
🠶M o d e l for study cause and treatment of diseases
🠶 T o obtain biological products
🠶A l p h a anti-trypsin: emphysema
🠶A l p h a - lactalbumin: from Rosie the cow
🠶V a c c i n e safety
🠶T r a n s g e n i c mice used in trials of polio vaccine
🠶C h e m i c a l safety testing
🠶D r u g - toxicity
August 15, 2024
 BIOSAFETY ISSUES
🠶P a t e n t : Right granted by government to an inventor
which prevents others from commercial use of his
invention.
🠶 A biological patent is a patent protecting provides
the holder with the right to exclude others from
making, using, selling, or importing the claimed
invention or discovery in biology for a limited period
of time.
🠶G i v e s its owner a monopoly for a period of time
🠶S u threat
and c h monopoly
to global could have serious effect on33research
food security August 15, 2024

8
 BIOETHICS
🠶 Ethical use of biological inventions and discoveries globally.
🠶 Major bioethical concerns in biotechnology
🠶 Causing pain to the animals during research
🠶 Transfer of genes from one species to another violates the integrity of species
🠶 Transfer of human genes to animals or vice versa dilutes the concept of
humanness
🠶 Animal are reduced to ‗factories‘ for products
🠶 Risk to biodiversity
🠶 Exploitation of animals for benefit of humans, no respect for animal life
🠶 GEAC: Genetic Engineering Approval Committee of Govt. Of India:
Monitors the research and safety issues related with the release of GMOs
33 August 15, 2024

9
 BIOPIRACY
🠶G e t t i n g the biopatents for materials and products
which are already known and being used by
people.
🠶M a n y organizations exploiting and patenting
biological resources of other nations without
proper authorization from the countries
concerned without compensatory payment. This
is known as biopiracy

34 August 15, 2024

0
 The neem tree
• In 1995, the U.S. Department of Agriculture and a pharmaceutical research
firm received a patent on a technique to extract an antifungal agent from the
neem tree (Azadirachta indica), which grows throughout India and Nepal;
Indian villagers have long understood the tree's medicinal value. Although the
patent had been granted on an extraction technique, the Indian press described
it as a patent on the neem tree itself; the result was widespread public outcry,
echoed throughout the developing world.
• Legal action by the Indian government followed, with the patent eventually
being overturned in 2005.
• Importantly, the pharmaceutical company involved in the neem case argued
that as traditional Indian knowledge of the properties of the neem tree had never
been published in an academic journal, such knowledge did not amount to
"prior art" (prior art is the term used when previously existing knowledge bars
a patent). Public knowledge and public disclosure (including oral or written
descriptions) are considered prior art in most countries. August 15, 2024

341
342 Basmati rice
In 2000, the US corporation RiceTec (a subsidiary
of RiceTec AG of Liechtenstein) attempted to patent
certain hybrids of basmati rice and semi-dwarf
long-grain rice (vide U.S. Patent No. 5,663,484).

The Indian government intervened and several

claims of the patent were invalidated. Meanwhile,
the European Commission has agreed to protect
basmati rice under its regulations pertaining to
geographical indications. August 15, 2024
 5. Ecology and Environment
(i) Organisms and Populations
🠶 Organisms and environment: habitat and niche, population and ecological adaptations;
population interactions - mutualism, competition, predation, parasitism; population attributes –
growth, birth rate and death rate, age distribution.
🠶 Definition of ecology; major biomes; abiotic factors (temperature, water, light, soil – definition
of stenothermal, eurythermal, stenohaline and euryhaline), responses to abiotic factors
(regulate, conform, migrate, suspend); ecological adaptations: morphological, physiological
and behavioural in response to loss of water and extremes of temperature in plant and animals
including humans. Definition of habitat and niche.
Definition of population; population attributes: sex ratio, types of age distribution pyramids for
🠶
human population; definition of population density, natality, mortality, emigration, immigration,
carrying capacity. Ways to measure population density. Calculation of natality and mortality.
Population growth: factors affecting population growth and population growth equation; growth
🠶
models: exponential growth and logistic growth along with equations, graph and examples of the
same; life history variations: definition of reproductive fitness and examples.
🠶 Population interactions – definition of mutualism, competition (interspecific, interference,
competitive release and Gause’s Principle of Competitive Exclusion), predation (adaptations in
organisms to avoid predation), parasitism (ecto-, endo-, and brood parasites), commensalism,
amensalism.
 Definitions
🠶P o p u l a t i o n density
🠶N a t a l i t y
🠶M o r t a l i t y
🠶e m i g r a t i o n
🠶I m m i g r a t i o n
🠶C a r r y i n g capacity
 Organisms and Populations
Population
🠶 Individuals of the same species living in a specific geographical
area
🠶 Population attributes
🠶 Birth rate
🠶 Death rate
🠶 Sex ratio
🠶 Age distribution (stable, declining, growing population)
🠶 Ways to measure Population density (N)
🠶 By counting Total number
🠶 By estimating Percent cover / Biomass
🠶 Natality and mortality calculated by
🠶 Births or Deaths divided by original no.
🠶 Expressed as Per individual per unit time (week, year, hour)
🠶 Population growth affected by
🠶 Natality, Mortality, Immigration, Emigration
🠶 I f in a pond there are 20 lotus plants last year and
through reproduction 8 new plants are added, taking the
current population to 28, calculate the birth rate.
🠶8 / 2 0 = 0.4 offspring per lotus per year.
🠶 I f 4 individuals in a laboratory population of 40 fruit
flies died during a specified time interval, say a week, the
death rate in the population during that period?
🠶 - - 4/40 = 0.1 individuals per fruit fly per week.
Nt = Noert

And equation
 Sem 2- 2022
🠶 The following diagram represents the population growth curves of
two different species A and B, living together in an area. Answer the
following questions based on it.
🠶 (i) What type of growth-patterns are exhibited by the species A and
B?
🠶 (ii) Give mathematical equations to represent the growth curves
of species A and species B, separately.
🠶 (iii) In the diagram, what does the horizontal line K. represent?
🠶 Reproductive fitness: Populations evolve to maximise their
reproductive fitness, also called Darwinian fitness (high r value), in the
habitat in which they live. Under a particular set of selection pressures,
organisms evolve towards the most efficient reproductive strategy.
🠶 Life history variations:
🠶S o m e organisms breed only once in their lifetime (Pacific salmon fish,
bamboo) while others breed many times during their lifetime (most birds
and mammals).
🠶S o m e produce a large number of small-sized offspring (Oysters, pelagic
fishes) while others produce a small number of large-sized offspring (birds,
mammals).
🠶 So, which is desirable for maximising fitness? Ecologists suggest that
life history traits of organisms have evolved in relation to the
constraints imposed by the abiotic and biotic components of the habitat
in which they live.
 Organisms and Populations 351

Effect on Effect on
Type of interaction Comment
X Y
Commensalism + 0 One benefitted, other
unaffected
Mutualism + + Both benefitted (obligatory)
(Symbiosis)
Proto-co-operation + + Both benefitted (not
obligatory)
Scavenging + 0 Clean the environment
Organisms and Populations
Population Interactions
🠶B o t h partners equally benefited
🠶R h i z o b i u m and leguminous plants
🠶L i c h e n s
🠶M y c o r r h i z a
🠶F l o w e r – pollinating animal (Fig – wasp, Orchids
– bees and bumblebees) Exception: Pseudocopulation
in the Mediterranean orchid Ophrys
🠶C o - evolution
 353
Organisms and Populations

Type of Effect on Effect on

Comment
interaction X Y
Parasite benefitted, host
Parasitism + -
harmed, examples
Predator kills the prey
Predation + -
examples
Intra specific: Controls
population size
Competition - -
Inter specific: Induces
adaptations
One harmed, other
Amensalism - 0
unaffected
 Organisms and Populations
Population Interactions
🠶P r e d a t i o n
🠶T i g e r and deer, Plants and herbivores
🠶N a t u r e ‘ s way to transfer the energy to higher trophic level
🠶K e e p s the prey population under control (Cactus, moth)
🠶B a s i s of biological pest control
🠶P r e d a t o r s help to maintain species diversity in community
by reducing the intensity of competition among competing
prey species.
🠶F o r example in a controlled experiment, removal of starfish Pisaster caused
extinction of >10 species of invertebrates within a year due to increased
inter-specific competition
 Organisms and Populations
Population Interactions
🠶P r e d a t i o n
🠶P r e d a t o r s do not over-exploit the prey to prevent theri
own extinction
🠶P r e y develop defense mechanism to reduce the adverse
effects of predation
🠶C a m o u f l a g e
🠶P o i s o n (Monarch butterfly)
🠶P l a n t s develop spines, thorns, harmful chemicals (for example
cardiac glycosides in Calotropis, nicotine, caffeine, quinine,
strychnine, opium etc)
 Organisms and Populations
Population Interactions
🠶 Competition
🠶 Process in which the fitness (in terms of ‗r‘) of one species is lowered in the presence
of another species
🠶 Interspecific (Resource) competition
🠶 Closely related or different species may compete for the same resource
🠶 For example bird and fish may compete for zooplanktons in lakes

🠶 Interference competition
🠶 Presence of one species reduces the feeding efficiency of another species even if resources (fod
and space) are different
🠶 Competitive release
🠶 Gause‘s Competitive exclusion Principle:
🠶 For Example - extinction of Abingdon tortoise from Galapagos Islands after introduction of
goats
 Organisms and Populations
Population Interactions
🠶P a r a s i t i s m
🠶S p e c i e s specific
🠶C o - evolution
🠶E c t o p a r a s i t e s : Cuscuta, lice, ticks copepods on
fish
🠶E n d o p a r a s i t e s : Ascaris, Wuchereria
🠶B r o o d parasite: Cuckoo
🠶F e m a l e mosquito is not a parasite. Why?
 Organisms and Populations
Population Interactions
🠶C o m m e n s a l i s m
🠶O n e species benefits and the other remains
unaffected
🠶O r c h i d on mango tree
🠶C a t t l e egret on grazing cattle
🠶S e a anemone and Clown fish
🠶A m e n s a l i s m : One species harmed, other
remains unaffected
 5. Ecology and Environment
(ii) Ecosystem
🠶 Ecosystems: patterns, components; productivity and decomposition; energy flow; pyramids of number, biomass,
energy; nutrient cycles (carbon and phosphorous); ecological succession; ecological services - carbon fixation,
pollination, seed dispersal, oxygen release (in brief).
🠶 Definition and types of ecosystems; structure of ecosystem (brief idea about biotic and abiotic components).
🠶 Structure and function of pond ecosystem; ecosystem functions: (i) Productivity – gross primary productivity
(GPP), net primary productivity (NPP) and secondary productivity (ii) Decomposition (fragmentation,
leaching, catabolism, humification and mineralization), factors affecting rate of decomposition (iii) Energy
flow. Various types of food chains – grazing and detritus, food webs, trophic levels, ecological pyramids –
energy, number and biomass (iv) Nutrient cycle – definition of biogeochemical cycles – gaseous (Carbon) and
sedimentary (Phosphorous). Graphic representation of the above cycles. Definition of PAR, 10% Law, standing
crop and standing state.
🠶 Succession: definition to explain the meaning, kinds of succession (hydrarch, xerarch; primary and secondary
succession with examples), definition of pioneer community, climax community and sere; significance of
ecological succession. Ecological services and their cost.
 Ecosystem
🠶C o i n e d by Tansley
🠶F u n c t i o n a l unit of nature
🠶E n t i r e biosphere is a global ecosystem
🠶T w o major types
🠶T e r r e s t r i a l (forest, grassland and desert)
🠶A q u a t i c (pond, lake, wetland, river and estuary)
🠶C r o p fields and aquaria are man-made ecosystems
🠶D e f i n i t i o n s
🠶P A R
🠶S t a n d i n g crop
🠶S t a n d i n g state
 Ecosystem

Abiotic Biotic

Light Wind
Producer Consumer Decomposer
Gases, Temp Soil, Water

Primary Secondary Tertiary

 POND
ECOSYSTEM
Structure
Function
 Ecosystem
Productivity
🠶T h e rate of production of biomass in an ecosystem
🠶E x p r e s s e d as g/m2/year or kcal/m2/year
🠶P r i m a r y productivity
🠶 T h e amount of biomass produced per unit area over a period of time by
the plants during photosynthesis
🠶G r o s s primary productivity: The rate of production of organic matter during
photosynthesis
🠶N e t primary productivity: GPP – energy consumed in respiration. It is amount
of
biomass available to heterotrophs
🠶S e c o n d a r y productivity
🠶 T h e rate of formation of new organic matter by consumers
 Ecosystem
Productivity
🠶P r i m a r y productivity depends on
🠶P l a n t species inhabiting a particular area
🠶E n v i r o n m e n t a l factors
🠶A v a i l a b i l i t y of nutrients
🠶Photosynthetic capacity of plants
🠶T h e annual net primary productivity of he whole
biosphere is approximately 170 billion tons (dry weight)
of organic matter
• The primary productivity of tropical rain forest is maximum and
that of desert is minimum
 Calculate
🠶 T h e Net Primary Productivity of a terrestrial ecosystem is 1500 K g
per meter square per year and the respiratory loss of the ecosystem is
1200 Kg per meter square per year. Calculate the gross primary
productivity of the given ecosystem.
🠶 I n an ecosystem, a food chain follows the following patern:
Grass  Insects  Snake  Peacock.
If 2000 J of energy is available at the level of producers in this food
chain, how much energy would be available to the peacock?
 Ecosystem
Decomposition
🠶P r o c e s s of breakdown of complex organic matter
into inorganic raw materials like CO 2 , H2O & various
other nutrients
🠶F r e s h l y deposited organic matter is called Detritus/litter
 🠶 Fragmentation
369
🠶 Detritus feeding invertebrates (detritivores) like earthworms feed
on detritus and break it into smaller particles
🠶 Detritus eaten comes out in pulverised state in their faeces
🠶 During eating and pulverisation, detritus is changed to fine particles
with a large surface area for microbial action
🠶 Leaching
🠶 As water percolates through the soil, it removes the water soluble
substances like sugar and inorganic nutrients
🠶 Go down into the soil from the fragmented detritus due to leaching
action
🠶 Catabolism
🠶 The decomposers saprophytic bacteria & fungi secrete digestive
enzymes & convert complex organic compounds into simple and soluble
inorganic & organic compounds
8/15/2024
 🠶Humification
370
🠶P r o c e s s of decomposition of detritus to form humus
🠶H u m u s undergoes very slow decomposition as it is highly
resistant to microbial action
🠶R e l e a s e s nutrients in the soil
🠶M i n e r a l i s at i o n
🠶H u m u s is further degraded by microbes
🠶R e l e a s e s inorganic substances (CO2 , H2O &
minerals) fromorganic matter

8/15/2024
 Factors affecting the rate of
decomposition
🠶C h e m i c a l nature of the detritus:
🠶W a t e r soluble substances decay faster
🠶T e m p e r a t u r e :
🠶F a s t e r decay at high temperature
🠶M o i s t u r e content of the soil:
🠶F a s t e r decay at high moisture content in the
soil
 ENERGY TRANSFER THROUGH TROPHIC
373 LEVELS
🠶E n e r g y is lost with each trophic
🠶~ 9 0 % is released to the environment as h
e
a
t
🠶~ 1 0 % of the energy is used

Only about
10% of the
energy from
one level is
passed on to
the next level
8/15/2024
 ENERGY FLOW IN ECOSYSTEM

374

8/15/2024
 FOOD CHAINS
375
🠶 A food chain shows
the path of energy
from one organism to
the next
🠶W i t h repeated
process of eating &
being eaten
🠶 energy flows from producers
to consumers

🠶 Usually decomposers are left 8/15/2024

out
 FOOD CHAINS
376

🠶T y p e s of food chains
🠶G r a z i n g Food Chain (GFC) - simple food chain
🠶E x t e n d s from producers to herbivores to carnivores
🠶P r o d u c e r s →Herbivores → Carnivores → Top carnivores
🠶D e t r i t u s Food Chain (DFC) – begins with dead
a
n
ddecaying organic matter
🠶D e a d organic matter → microorganisms → detritus feeding
organisms → Decomposers

8/15/2024
 GRAZING FOOD DETRITUS FOOD
377
CHAIN CHAIN
🠶 Based on energy obtained Based on energy present
🠶
from in detritus
sun
Detrivores &
🠶
Producers from the first trophic
🠶 decomposers formthe first
level trophic level
🠶 Binds inorganic nutrients 🠶 Releases inorganic
into nutrients
organic matter bound in organic matter
It brings energy
🠶 🠶 Prevents wastage of
in th
eecosystem energy bound in organic
matter

8/15/2024
378

8/15/2024
ENERGY PATHS
3 ways to 1. Food Chain: Single path
illustrate
energy flow

2. Food Web: many paths 3. Food Pyramid

8/15/2024 381
 FOOD WEB
382 🠶 Many animals eat more than one kind of food
🠶 Each form a part of several food chains
🠶 This network of interconnected food chains is called a food
web

8/15/2024
 FOOD WEBS
383
 A food web shows all feeding relationships
in an ecosystem (made of many food
chains)

8/15/2024
 FOOD CHAIN FOOD WEB
385
Straight pathway through which
🠶 Consists of a multiple series
🠶
food energy travels in the of trophic levels
ecosystem
Each food chain is
🠶
Consists of a number of
🠶
distinct fromother food
interconnected food chains
chains
🠶 Several type of organisms
Only one type of organism is
🠶
are
available as food for the higher
available at each trophic level
organisms
Members of higher trophic level
🠶
Food chain becomes unstable
🠶
can feed on alternative organisms
in absence of any trophic level
of the lower trophic level
Increases competitiveness &
🠶
Competition & adaptability are
🠶 adaptability of the same & other
limited to members of the same species
species

8/15/2024
 ENERGY PYRAMIDS
386
The energy pyramid shows
energy flow in an ecosystem:
Top
Idea given by Charles Elton Consumer
A level of the energy pyramid
🠶
is called a TROPHIC LEVEL

Energy stored by
Each trophic level represents
🠶 Secondary Consumers
the energy for those organisms

Energy stored by
Primary Consumers

ENERGY STORED
BY PRODUCERS
8/15/2024
 Pyramid of Numbers
387
🠶 Shows the numbers of individual organisms at each trophic
level in an
ecosystem.

tertiary 5
consumers

secondary 5000
consumers

primary 500,000
consumers

producers 5,000,000

• A vast number of producers are required to support even a few top level
consumers. 8/15/2024
388 UPRIGHT PYRAMID OF NUMBER

8/15/2024
 🠶I N V E R T E D PYRAMID OF NUMBER
389
🠶 I n a parasitic food chain, for e.g., an oak tree, the large
tree provides food to several herbivorous birds.
🠶T h e birds support still larger population of ectoparasites
leading to the formation of an inverted pyramid.
🠶S P I N D L E SHAPED PYRAMID OF NUMBER
🠶W h e n a large tree support larger number
of herbivorous birds
🠶W h i c h in turn are eaten by carnivorous birds like falcon
and eagle, which are smaller in number, it forms a
spindle shaped pyramid.

8/15/2024
390

8/15/2024
391
Biomass pyramid
🠶 Biomass is a measure of the total dry mass of organisms
in a given area.

tertiary 75 g/m2
consumers

150g/m2
secondary
consumers

primary
consumers 675g/m2

p
prro
oddu
uceerrss 2000g/m2
8/15/2024
🠶W h a t type of ecological pyramid would be obtained
with the following data?
Primary consumer - 60 g
Secondary consumer - 120 g
Primary producer - 10 g
 5. Ecology and Environment
(iii) Biodiversity and its Conservation
Concept of biodiversity; patterns of biodiversity; importance of biodiversity; loss of
🠶
biodiversity; biodiversity conservation; hotspots, endangered organisms, extinction, Red Data
Book, biosphere reserves, national parks, sanctuaries and Ramsar sites
Definition of biodiversity, few examples of each type of biodiversity - species, ecosystem and
🠶
genetic. Global biodiversity and proportionate number of species of major taxa of plants,
invertebrates and vertebrates; patterns of biodiversity (latitudinal gradients, species-area
relationship – graph and equation), ―rivet popper hypothesis‖, importance of species
diversity to the ecosystem (narrowly utilitarian, broadly utilitarian, ethical).
Examples of some recently extinct organisms, causes of loss of biodiversity (habitat loss and
🠶
fragmentation, over-exploitation, alien species invasion, co-extinction).
Biodiversity conservation: In-situ methods - protected areas: biosphere reserves, national
🠶
parks, wildlife sanctuaries, sacred groves; ex-situ methods - captive breeding, zoo, botanical
gardens, cryopreservation, wild life safari, seed banks, tissue culture.
🠶 Definitions and examples of each of the above. Hotspots, Ramsar sites and Red Data
Book.
🠶 The place, year and main agenda of Historic conventions on biological diversity (the
Earth
 395
BIODIVERSITY
🠶T h e term may have been coined by W.G. Rosen in 1985
while planning the 1986 National Forum on Biological
Diversity organized by the National Research Council
🠶 I t first appeared in a publication in 1988 when
entomologist E. O. Wilson used it as the title of the
proceedings of that forum.
🠶D e f i n i t i o n : Biodiversity is the degree of variation
of life forms within a given species, ecosystem, biome, or
an entire planet.
August 15, 2024
 396

TYPES OF BIODIVERSITY
1. Genetic diversity: A single species might show high diversity at the
genetic level over its distributional range.
🠶 T h e genetic variation shown by the medicinal plant Rauwolfia vomitoria growing
in different Himalayan ranges might be in terms of the potency and concentration
of the active chemical (reserpine) that the plant produces. India has more than
50,000 genetically different strains of rice, and 1,000 varieties of mango.
2. Species diversity: The diversity at the species level.
🠶 F o r example, the Western Ghats have a greater amphibian species diversity than
the Eastern Ghats.
3. Community and Ecosystem diversity: At the ecosystem level.
🠶 F o r example, India with its deserts, rain forests, mangroves, coral reefs, wetlands,
estuaries, and alpine meadows has a greater ecosystem diversity than a
Scandinavian country like Norway August 15, 2024
402
IMPORTANCE OF BIODIVERSITY

🠶S o u r c e of food
🠶S o u r c e of medicine
🠶S o u r c e of raw material
🠶S o u r c e of microbes
for industries
🠶E c o l o g i c a l importance
🠶G e n e t i c resources
🠶A e s t h e t i c value August 15, 2024
Rivet popper hypothesis: Paul Ehrlich
 LOSS OF BIODIVERSITY
🠶D u e to anthropogenic actions
🠶E x a m p l e s
🠶T h e colonisation of tropical Pacific Islands by humans is said to have e
ld
to the extinction of more than 2,000 species of native birds.
🠶T h e IUCN Red List (2004) documents the extinction of 784 species (including
338 vertebrates, 359 invertebrates and 87 plants) in the last 500 years.
🠶T h e last twenty years alone have witnessed the disappearance of
27 species.
🠶S o m e examples of recent extinctions include the dodo (Mauritius), quagga
(Africa), thylacine (Australia), Steller’s Sea Cow (Russia) and three
subspecies (Bali, Javan, Caspian) of tiger.
🠶 I f the present trends continue, nearly half of all the species on eart4
h might
August 15, 2024

bewiped out within the next 100 years. 0

4
405
Causes of loss of biodiversity
🠶T h e accelerated rates of species extinctions that the world
is facing now are largely due to human activities. There are
four major causes (The Evil Quartet)
(i) Habitat loss and fragmentation
(ii) Over-exploitation
(iii) Alien species invasions: Example Parthenium
(iv) Co-extinctions: Host-Parasite, Plant – Pollinator
🠶O t h e r causes: Anthropogenic actions, Selective forestry,
Wildfire etc.
August 15, 2024
 Examples of some recently extinct organisms
(dodo, quagga, Steller’s Sea cow, thylacine, and the three subspecies of tiger-
Bali, Caspian and Javan);
 407

Consequences of loss of
biodiversity
🠶D e c l i n e in plant production

🠶L o w e r e d resistance to environmental
perturbations such as drought

🠶I n c r e a s e d variability in certain ecosystem

processes such as plant productivity, water
use, and pest and disease cycles.
August 15, 2024
Conservation of Biodiversity
Why to conserve
🠶N a r r o w l y utilitarian argument
🠶B r o a d l y utilitarian argument
🠶E t h i c a l argument
 International Efforts to Conserve Biodiversity
🠶 The Earth Summit at Rio de Janeiro (Brazil)
🠶 Main aims
🠶 Conservation of biological diversity
🠶 Sustainable use of biodiversity
🠶 Fair and equitable sharing of benefits

🠶 World Summit: The 2002 World Summit on Sustainable Development in Johannesburg.

🠶 Main aims
🠶 To ensure a fair and equitable sharing of the benefits arising from the use of genetic
resources.
🠶 The reduction of greenhouse gases.
• A biodiversity hotspot is a region with a high level of endemic species.
• Red data book/ Red list: List of endangered species
• Ramsar sites: Protected areas of wetland biodiversity
 5. Ecology and Environment
(iv) Environmental Issues
Air pollution and its control; water pollution and its control; agrochemicals and their effects; solid waste
🠶
management; radioactive waste management; greenhouse effect and climate change; ozone layer
depletion; deforestation; any one case study as success story addressing environmental issue(s).
Definition of pollution and pollutant; environmental issues: air pollution and its control, major sources of
🠶
gaseous and particulate pollutants, control devices for air pollution such as: scrubbers and electrostatic
precipitators, catalytic converter, CNG, Bharat stages, noise pollution: harmful effects and control; Water
pollution, major sources and its control, composition of waste water, thermal pollution, eutrophication -
cultural and accelerated, BOD, effect of sewage discharge on BOD and dissolved oxygen content in river;
case studies of waste water treatment (FOAM and EcoSan); Soil pollution – sources, effects and control,
agrochemicals and their harmful effects, integrated organic farming, contribution of Ramesh Chandra
Dagar, biomagnification and bioconcentration; solid waste management, Radioactive waste
management, e-waste.
A brief understanding of the concept of deforestation (slash and burn agriculture or jhum cultivation’s
🠶
contribution), greenhouse effect. Impact of global warming in terms of climatic changes, rise in sea levels,
melting of ice caps, El Nino effect ; impact on animals and plants due to climate changes. Ozone depletion
– causes, ozone hole, Dobson unit, effects on plants and animals, methods to control ozone depletion,
ontreal protocol. Any one of the following case studies as success stories addressing environmental issues:
Chipko Movement, Joint Forest Management, contribution of Ahmed Khan of Bangalore. Environmental
Acts — Environmental Protection Act, Water (prevention and control of pollution), Air (prevention and
control of pollution act).
 SCIENTISTS AND THEIR CONTRIBUTIONS:
🠶 1. Oparin: Coacervates, Conditions on primitive earth were favourable for chemical
evolution
🠶 2. Stanley Miller & Harold Urey: Recreated probable conditions on primitive earth
🠶 3. Ernst Haeckel: Proposed the recapitulation theory
🠶 4. Charles Darwin: Natural Selection
🠶 5. Hugo de Vries: Mutation
🠶 6. T. R. Malthus: Theory of Human Population Growth/ Essays on population
🠶 7. Alec Jeffreys: DNA finger printing
🠶 8. Temin and Baltimore: Reverse transcription.
🠶 9. Jacob, Monod and Lwoff: proposed Lac operon.
🠶 10. Watson and Crick: Structure of DNA
🠶 11. Nirenberg and Khorana: Genetic code
🠶 12. Benzer: Cistron, recon, muton
🠶 13. Gregor Mendel: Father of genetics
🠶 14. Sutton and Boveri: Chromosomal theory of inheritance
🠶 15. Hugo de Vries, Correns and Tschermack: Rediscovered Mendelism
🠶 16. T H Morgan: Linkage
 SCIENTISTS AND THEIR CONTRIBUTIONS:
🠶 18. Henking: Discovered X-chromosome
🠶 19. F. Miescher: Isolated nucleic acid from pus cells, called
Nuclein
🠶 20. Chargaff: Rule of equivalence in DNA structure
🠶 21. F. Griffith: Transformation in bacteria
🠶 22. Avery, MacLeod and McCarty: DNA is the genetic
material
🠶 23. Hershey and Chase: DNA is the genetic material
🠶 24. Meselson and Stahl: Semi-conservative replication of
DNA
🠶 25. G. Gamow: Triplet nature of codons
🠶 26. S Ochoa: discovered polynucleotide phosphorylase
🠶 27. Wallace: divided the Earth into biogeographical regions
🠶 28. M S Swaminathan: Green revolution in India
🠶 29. H Boyer: discovered Restriction Enzyme
🠶 30. S Cohen: method to transfer plasmid DNA in host cells
🠶 31. R. Mishra: Father of Indian Ecology
🠶 32. E. Wilson: coined the term Biodiversity
 LIST OF ABBREVIATIONS TO BE STUDIED
🠶 1. ADA- Adenosine Deaminase
🠶 2. CMI- Cell Mediated Immunity
🠶 3. DFC- Detritus Food Chain
🠶 4. EFB- European Federation of Biotechnology
🠶 5. EST- Expressed Sequence Tags
🠶 6. ET- Embryo Transfer
🠶 7. GFC- Grazing Food Chain
🠶 8. GMO- Genetically Modified Organism
🠶 9. GPP- Gross Primary Productivity
🠶 10. hnRNA - Heterogeneous Nuclear Ribo Nucleic Acid
🠶 11. IMR- Infant Mortality Rate
🠶 12. ICSI - Intra Cytoplasmic Sperm Injection
🠶 13. IUCD/IUD – Intra uterine contraceptive device
🠶 14. IUCN- International Union for Conservation of Nature and Natural
Resources
🠶 15. IUI- Intra Uterine Insemination
 LIST OF ABBREVIATIONS TO BE STUDIED
🠶 16. IUT- Intra Uterine Transfer
🠶 17. LAB- Lactic Acid Bacteria
🠶 18. MALT- Mucosal Associated Lymphoid Tissue
🠶 19. MMR- Maternal Mortality Rate
🠶 20. NACO- National AIDS Control Organisation
🠶 21. NPP- Net Primary Productivity
🠶 22. PID- Pelvic Inflammatory Diseases
🠶 23. PKU- Phenylketonuria
🠶 24. RCH- Reproductive and Child Health Care
Programmes
🠶 25. SCID – Severe Combined Immuno Deficiency
🠶 26. SNPs - Single Nucleotide Polymorphisms
🠶 27. snRNA- Small Nuclear Ribo Nucleic Acid
🠶 28. sRNA - Soluble Ribo Nucleic Acid
🠶 29. SSBP – Single Strand Binding Protein
🠶 30. UTR - Untranslated Region
🠶 31. VNTRs - Variable Number of Tandem Repeats