TYPE Original Research

PUBLISHED 22 July 2024

DOI 10.3389/fmars.2024.1449066

Effects of Bacillus subtilis-

OPEN ACCESS fermented soybean meal
EDITED BY
Lei Wang,
Anhui Normal University, China
replacing fish meal on
REVIEWED BY
Dong Han,
antioxidant activity, immunity,
Chinese Academy of Sciences (CAS), China
Antonio Luca Langellotti,
University of Naples Federico II, Italy
endoplasmic reticulum stress
Junyan Jin,
Chinese Academy of Sciences (CAS), China and hepatopancreas histology in
*CORRESPONDENCE
Qiang Chen Pacific white shrimp
(Litopenaeus vannamei)
[email protected]
Tao Han
[email protected]

RECEIVED 14 June 2024

ACCEPTED 09 July 2024 Songming Chen 1, Jieyu Dai 1, Yan Chen 2, Qiang Chen 1*,
PUBLISHED 22 July 2024
Fen Dong 1, Congcong Wang 1, Yulong Sun 1,
CITATION
Jiteng Wang 1 and Tao Han 1*
Chen S, Dai J, Chen Y, Chen Q, Dong F,
Wang C, Sun Y, Wang J and Han T (2024) 1
Department of Aquaculture, Zhejiang Ocean University, Zhoushan, China, 2 Zhejiang Provincial
Effects of Bacillus subtilis-fermented soybean Engineering Technology Research Center of Marine Biomedical Products, School of Food and
meal replacing fish meal on antioxidant Pharmacy, Zhejiang Ocean University, Zhoushan, China
activity, immunity, endoplasmic reticulum
stress and hepatopancreas histology in Pacific
white shrimp (Litopenaeus vannamei).
Front. Mar. Sci. 11:1449066. Introduction: Screening excellent bacterial strains for fermentation is the key to
doi: 10.3389/fmars.2024.1449066
improving the nutritional value and bioavailability of soybean meal (SBM). This
COPYRIGHT
© 2024 Chen, Dai, Chen, Chen, Dong, Wang,
study investigated the application of Bacillus subtilis-fermented soybean meal
Sun, Wang and Han. This is an open-access (FSBM) on the feed of Pacific white shrimp (Litopenaeus vannamei).
article distributed under the terms of the
Creative Commons Attribution License (CC BY).
Methods: FSBM was used to replace 0%, 25%, 50%, 75%, and 100% fish meal, and
The use, distribution or reproduction in other
forums is permitted, provided the original the feeding trial was lasted for 8 weeks (initial weight: 0.9 g).
author(s) and the copyright owner(s) are
credited and that the original publication in
Results and discussion: The amino acid profile in the whole shrimp body was
this journal is cited, in accordance with
accepted academic practice. No use, tested. FSBM substitution only significantly reduced the content lysine in whole
distribution or reproduction is permitted shrimp body, but increased the content of arginine. Fatty acid data showed that
which does not comply with these terms.
the content of n-6 PUFAs in whole shrimp was significantly increased by FSBM
substitution. In muscle, FSBM substitution significantly reduced the content of
MUFAs, but increased the content of PUFAs including C18:3n-3, C18:2n-6 and
C20:4n-6. No hepatopancreas structure modifications appeared in the 25%
group compared with the control group. Subsequently, we investigated the
response patterns of different organs to FSBM substitution from antioxidant,
endoplasmic reticulum stress and immunity. A high proportion of FSBM
significantly reduced the content of GSH in hemolymph and hepatopancreas,
while increased the mRNA expression of cat. FSBM substitution did not affect the
activities of antioxidant enzymes in the intestine. However, the mRNA expression
level of hsp70 in the intestine was significantly reduced by FSBM. In terms of
immunity, the mRNA expression levels of lgbp and penaeidin in the
hepatopancreas showed a significant linear increase trend. In muscle, high
proportion of FSBM significantly increased the mRNA expression of imd. FSBM
substitution did not significantly affect the expression of immune genes in the

Frontiers in Marine Science 01 frontiersin.org

Chen et al. 10.3389/fmars.2024.1449066

intestine. In terms of endoplasmic reticulum stress, FSBM substitution

significantly increased the mRNA expression of eif2a in the hepatopancreas. In
muscle, FSBM substitution inhibited the mRNA expression of bip. In the intestine,
FSBM replacing 75% of fish meal significantly increased the mRNA expression of
bip and ire1. In summary, this study indicated that when the fish meal content
account for 40% in diets (dry weight), the screened Bacillus subtilis-FSBM can
replace 25% of fish meal protein without reducing the antioxidant and immune
abilities of shrimp.

KEYWORDS

antioxidant activity, endoplasmic reticulum stress, fermented soybean meal, immunity,

Litopenaeus vannamei

1 Introduction (2023) found that fermenting SBM with mixed strains containing
Enterococcus faecium, Bacillus velezensis and Saccharomyces
Pacific white shrimp (Litopenaeus vannamei) is one of the boulardii can significantly increase the content of small peptides
world’s most important crustacean species. In 2023, the world’s in FSBM. SBM fermented by Bacillus subtilis is rich in hydrolytic
aquaculture output reached 5.6 million tons, mainly from countries enzymes such as a-amylase, proteases and b-glucosidase (Dai et al.,
such as Ecuador, China, India, and Vietnam (Zhi et al., 2023). 2017). Our laboratory has screened a type of Bacillus subtilis
Undoubtedly, it has become an important measure to ensure (copyright number: CN115197876A; preservation number:
people’s food security. The downturn in China’s shrimp market CGMCCNo.24836), which relies on traditional strain selection
price allowed industries and farmers to further reduce costs. In the techniques. Through efficient mutagenesis breeding technology
process of shrimp breeding, feed is the main source of cost, combined with high-throughput screening methods, we have
especially the fish meal in the diet (Chen et al., 2024). The rising developed a Bacillus subtilis strain that can degrade non starch
prices and shortage of resources seriously limit the development of polysaccharides and antigen proteins. On this basis, the hydrolysis
shrimp farming. Therefore, it is crucial to find alternatives to fish ability of non starch polysaccharides and antigen proteins of
meal and reduce farming costs without affecting the growth Bacillus subtilis was optimized through iterative evolution to
of shrimp. obtain probiotic strains with high protein and peptide production
Soybean meal (SBM), a by-product of soybean oil extraction, capacity. In the process of mutation breeding screening, Bacillus
has been applied as protein source in aquatic feed (Kari et al., 2023). subtilis with high accumulation of negative metabolites are
However, anti-nutritional factors (ANFs) limit the application of selectively avoided to obtain probiotic strains of Bacillus subtilis
SBM in aquatic feed (Qi et al., 2023). Recently, it is a trend to use with low viscosity of fermentation products and no ammonia taste.
modern molecular biology and microbiology technologies to However, further exploration is needed to determine the
improve SBM under the background of interdisciplinary effectiveness of this FSBM in shrimp feed.
integration. Among them, fermentation technology is gradually The standard to evaluate the effect of FSBM in shrimp feed
applied to improve the nutritional value of SBM (Cao et al., mainly focuses on the growth performance, health status and tissue
2023). Fermented soybean meal (FSBM) is widely used in shrimp structure of shrimp. Although FSBM has multiple functional
feed as a substitute for fish meal and SBM protein (Abd El-Naby ingredients, its utilization ratio in shrimp feed is still limited. The
et al., 2023; Wang et al., 2024). The key to fermentation lies in stable basic nutritional characteristics of FSBM is similar with SBM, and
processes, controllable conditions and excellent bacteria (Barragá n there are also problems such as amino acid imbalance (Chen et al.,
et al., 2016; Kårlund et al., 2020). At present, Lactobacillus and 2023). Excessive addition can affect the health status of various
Bacillus subtilis are the main strains used in fermentation (Shrestha organs in shrimp, such as inducing oxidative stress (Abd El-Naby
et al., 2010; Zhang et al., 2014). The improvement of the nutritional et al., 2023) and endoplasmic reticulum stress (ER stress) (Xie et al.,
value of SBM by fermentation is reflected in two aspects. On the one 2020), affecting muscle tissue growth and intestinal health (Cheng
hand, the ANFs in SBM, including antigen proteins, ureases and et al., 2020). Hence, the present study evaluated the utilization value
phytic acid, are degraded during the fermentation process (Zheng of FSBM in shrimp feed by detecting the induction patterns of three
et al., 2017); On the other hand, the microbial fermentation process main tissues, including hepatopancreas, muscle and intestine. We
also endows SBM with abundant bioactive substances. Wang et al. hope to provide alternative protein sources for shrimp feed.

Frontiers in Marine Science 02 frontiersin.org

Chen et al. 10.3389/fmars.2024.1449066

2 Materials and methods for 10 min, the supernatant was collected for use. The contents of
total protein (TP), reduced glutathione (GSH), malondialdehyde
2.1 Experimental diets (MDA) total cholesterol (T-CHO) and total triglyceride (TG) and
the activities of superoxide dismutase (SOD), total antioxidant
This experiment was equipped with five groups of feed with capacity (T-AOC), glutamic oxalacetic transaminase (GOT) and
isonitrogenous (37.31%) and isolipidic (6.47%) element. Bacillus glutamic-pyruvic transaminase (GPT) were determined by the
subtilis selected in our lab was used to ferment SBM. In brief, commercially available kit (Nanjing Jiancheng Bioengineering
following a prolonged period of incubation, 5*109 CFU of Bacillus Institute, China). The analysis of TP content was conducted with
subtilis was dissolved in 100 mL of water and introduced into 100 g Coomassie Brilliant Blue method. For GSH measurement, reduced
of sterile SBM. SBM was put in a shaker right away, and keeping GSH reacts with dithiodinitrobenzoic acid (DTNB) to produce a
fermented for 24 h at 37°C, 100 rpm, and 80% humidity. The FSBM yellow compound that can be quantitatively measured by
was then put in an oven and dried for 6–7 h at 50°C, maintaining 8– colorimetric analysis at 405nm. MDA can form a red product
10% humidity. FSBM replaced 0%, 25%, 50%, 75% and 100% of fish with thiobarbituric acid (TBA), with a maximum absorption peak
meal protein, respectively, which named CON, 25F, 50F, 75F and at 532nm. Hence, the MDA content was analyzed with TBA
100F. The details and composition of feed were presented in the method. CHO generates a red pyrodhumin compound under the
Table 1. Before the feed preparation, various raw materials crushed catalysis of cholesterase, cholesterol oxidase and peroxidase, and the
through the ultra -micro crushing machine and passed through the content of CHO was measured using a microplate reader at 500 nm.
60 -mesh screen. The ingredients were pelleted into a diameter of The TG content was measured with GPO-PAP (Glycerol-3-
0.8 mm-1.0 mm using a twin-screw extruder (Guangzhou Huagong Phosphate Oxidase and Perioxidase) method. SOD activity was
Optical Mechanical & Electrical Technology CO. LTD, F-75Q). The measured using WST-1 method and T-AOC activity was analyzed
screw rotation speed was 15–17 rpm. The pelletizing speed was 30– with ABTS method. The GOT and GPT activities were measured
40 rpm and the extrusion pressure was under 400 Kgf. The pellet with a microplate reader at 505 nm.
was dried in an oven at 45°C for 24 h. The dried feed was stored in a For hepatopancreas histological observation, after 24 h of
sealed plastic bag in a -20°C refrigerator for later use. fixation with paraformaldehyde, ethanol was used for stepwise
dehydration and embedded in paraffin. The slices were got using
a microtome (5–8 mm) and stained with hematoxylin eosin (H&E)
2.2 Feeding procedure and sampling staining method. Finally, the stained sections were photographed
and observed under the microscope (Olympus BX53, Japan).
The experimental shrimp were purchased from Zhejiang Yize
Aquaculture Co., Ltd. (Taizhou, Zhejiang, China). After 14 d of
laboratory adaptation, healthy and active shrimp (initial weight: 0.9 2.4 Amino acid composition and fatty acid
g) were randomly assigned to 15 tanks (water volume: 300 L), with 20 profile analysis
shrimp per tank and 3 replicates per treatment. During the experiment,
the feeding frequency of shrimp was maintained at 4 times a day The amino acid analysis was measured according to the
(06:00, 11:00, 16:00, 22:00), and the feeding amount was determined by published method with some modifications (Yang et al., 2022a).
body weight with a daily ratio of 5% to 8% which can maintain satiety In brief, for amino acid profile in the diets and shrimp body, the
and ensure that all feed was consumed by shrimp. The aquaculture samples were placed at the bottom of an ampoule bottle. 6 M
water quality should be maintained within the optimal range for hydrochloric acid was added into the ampoule bottle and then
shrimp feeding and growth (temperature: 24–26°C; nitrite < 0.1 nitrogen blowing for 10 min. Subsequently, the ampoule bottle was
mg/L; dissolved oxygen level ≥ 6 mg/L; total ammonia nitrogen < sealed and then nitrified at 110°C for 24 h. Then, the samples were
0.5 mg/L; pH: 7.8–8.3; salinity: 29–31 ‰). diluted 100 times and mixed with acetonitrile. The mixture was
After 8-week feeding trial, all shrimp were subjected to a 24 h centrifuged and the supernatant was mixed with 0.1 N hydrochloric
fasting treatment. Six shrimp were randomly selected from each acid, followed by measurement using a liquid chromatography
tank, and the hepatopancreas, muscle and intestine were collected. (Agilent, 1260 Infinity II, USA).
All the above samples were frozen in a liquid nitrogen tank and Transesterification was made with boron trifluoride and
stored at -80°C until use. 4% paraformaldehyde was used to fix the methanol and profile of metal-esters were performed in 7890B
hepatopancreas for subsequent histological observation. gas chromatography (Agilent Technologies Inc., USA) with an
external standard method. The gas chromatography method was
set as follows (Liu et al., 2021): the flow rate of the carrier gas
2.3 Biochemical analysis and histology (nitrogen) was 1 mL/min. The split ratio was 100:1, the injector
temperature was 250°C, the pressure was 20.363 psi, the overall flow
Before the biochemical indices were detected, hepatopancreas, rate was 104 mL/min, and the septum purge flow was 3 mL/min.
muscle and intestine samples were homogenized with saline The oven temperature increased at a rate of 20°C/min from 70°C to
solution at a ratio of 1:9 (w: v). After centrifugation at 2,500 rpm 150°C, then increased at a rate of 6°C/min to 180°C, increased at a

Frontiers in Marine Science 03 frontiersin.org

Chen et al. 10.3389/fmars.2024.1449066

TABLE 1 The experimental diets’ formulation and chemical content a (% dry matter).

Ingredients CON 25F 50F 75F 100F

b
Fish meal 40.00 30.00 20.00 10.00 0.00
c
Chicken powder 10.00 10.00 10.00 10.00 10.00
d
Fermented soybean meal 0.00 13.00 26.00 39.00 52.00

Alpha-starch 20.00 20.00 20.00 20.00 20.00

Fish oil 2.00 2.15 2.30 2.60 2.90

Soybean oil 1.00 0.95 0.90 0.65 0.40

Soybean lecithin 1.00 1.00 1.00 1.00 1.00

Cholesterol 0.60 0.60 0.60 0.60 0.60

Choline 0.20 0.20 0.20 0.20 0.20

e
Vitamin premix 1.00 1.00 1.00 1.00 1.00
f
Mineral mix 1.00 1.00 1.00 1.00 1.00

Monocalcium phosphate 1.00 1.00 1.00 1.00 1.00

Sodium alginate 2.50 2.50 2.50 2.50 2.50

Vitamin C 0.05 0.05 0.05 0.05 0.05

g
Mold inhibitor 0.20 0.20 0.20 0.20 0.20

Ethoxyquin 0.01 0.01 0.01 0.01 0.01

Microcrystalline cellulose 19.44 16.34 13.24 10.19 7.14

Proximate analysis

Crude protein 37.9 38.41 36.34 36.92 36.99

Crude lipid 6.93 6.39 6.01 6.53 6.49

a
CON, control group; 25F, 25% of fish meal protein was replaced with FSBM; 50F, 50% of fish meal protein was replaced with FSBM; 75F, 75% of fish meal protein was replaced with FSBM; 100F,
100% of fish meal protein was replaced with FSBM.
b
The proximate analysis of fish meal is shown as follows. Crude protein: 68.19%; Crude lipid: 6.82%; Moisture: 8.66%.
c
The proximate analysis of chicken powder is shown as follows. Crude protein: 59.67%; Crude lipid: 15.93%; Moisture: 4.52%.
d
Soybean meal was fermented by Bacillus subtilis. The proximate analysis of this FSBM is shown as follows. Crude protein: 56.39%; Crude lipid: 2.81%; Moisture: 10.93%. The amino acid
composition of FSBM is presented in Supplementary Table 1.
e
Vitamin premix (g/kg): vitamin B1, 2.390; vitamin B2, 16.000; vitamin B3, 10.960; vitamin B5, 10.200; vitamin B6, 12.800; vitamin B8, 118.150; vitamin B9, 0.337; vitamin B12, 0.020; vitamin C,
19.100; vitamin A, 2.250; vitamin D3, 1.370; vitamin E, 9.900; vitamin H, 0.225; vitamin K, 8.900; cellulose, 787.400.
f
Mineral premix (g/kg): NaSeO3, 0.038; MnSO4·H2O, 1.040; CoCl2·6H2O, 2.217; CuSO4·5H2O, 9.260; ZnSO4·7H2O, 11.770; MgSO4, 12.800; KCl, 20.800; CaCO3, 24.180; NaCl, 90.720;
FeSO4·7H2O, 118.370; Ca(H2PO4)2·H2O, 330.100; cellulose, 378.705.
g
Mold inhibitor: 50% fumaric acid and 50% calcium propionic acid.

rate of 20°C/min to 220°C and remained there for 6 min, and combined with isopropanol. The mixture was stewing for 10 min
increased at a pace of 20°C/min to 250°C and remained there for and centrifuged for 10 min at 4°C, 12, 000 g. Finally, the RNA sediment
11.5 min. The air flow, hydrogen (H2), and makeup flow (N2) were was washed twice with 75% ethanol and dissolved in RNAse-free water.
300 mL/min, 30 mL/min, and 25 mL/min, respectively, and the The extracted RNA was reverse transcribed into cDNA with HiScript
detector’s temperature was 300°C. The fatty acid content is shown III 1st Strand cDNA Synthesis Kit (Vazyme, China). SYBR qPCR
as a percentage of the overall fatty acid content. Master Mix (Vazyme) was used to conduct RT-qPCR. The primers
were designed according to the published sequences in NCBI and are
presented at Table 2. b-actin was selected as the housekeeping gene in
2.5 Real-time polymerase chain the present study. The relative expression of genes were calculated
reaction analysis using the comparative cycle threshold (CT) method (2-△△CT method)
(Livak and Schmittgen, 2001).
The RNA of hepatopancreas, muscle and intestine were extracted
with TRIzol reagent. In brief, 100 mg of tissues were extracted with 1
mL of TRIzol. Immediately, the homogenate was centrifuged for 10 2.6 Statistical analysis
min at 4°C, 12–000 g. Chloroform was added to the supernatant, and
the mixture was incubated on ice for 3 min before being centrifuged for The data are presented as the mean ± standard error of the
15 min at 4°C and 12–000 g. Subsequently, the supernatant was mean (S. E. M.). Linear and quadratic patterns was analyzed using

Frontiers in Marine Science 04 frontiersin.org

Chen et al. 10.3389/fmars.2024.1449066

SPSS 23.0 software followed by Tukey’s tests to compare differences that in the FM group (Table 3). In the whole shrimp body, with the
between the means. For the feeding experiment, the n = 3. For increase of FSBM substitution ratio, the content of lysine showed a
amino acid and fatty acid analysis, the n = 3. For enzyme activity significant linear downward trend (Table 4). On the contrary, FSBM
detection and gene expression analysis, the n = 4. P < 0.05 defined substitution increased the content of arginine with a significant
statistical significance. linear pattern (Table 4).

3 Results 3.2 Fatty acid profile in the feed, muscle

and whole shrimp body
3.1 Amino acid composition
With the increase of FSBM substitution ratio, the levels of
After 8-week feeding trial, the survival rate of shrimp in all saturated fatty acids (SFAs) including C13:0 and C20:0 in diets
groups were all above 90% and were not affected by dietary showed an increasing trend in significantly linear pattern (Table 5).
treatment. Firstly, we tested the amino acid composition in feed On the contrary, the level of C14:0 exerted a decreasing trend in
and shrimp. Results showed that the amino acid profile in feed was significantly linear pattern with the increase of FSBM substitution
affected by FSBM substitution. For essential amino acids (EAAs), ratio (Table 5). FSBM substitution significantly decreased the
the content of amino acids showed a significant linear downward contents of monounsaturated fatty acids (MUFAs) including
trend with the increase of FSBM substitution ratio, except for C16:1, C18:1 and C20:1n-9 with a linear pattern (Table 5). For n-
phenylalanine (Table 3). Compared with the FM group (control 3 polyunsaturated fatty acids (n-3 PUFAs), FSBM substitution
group), 25% FSBM substitution only significantly reduced the significantly increased the content of C18:3n-3 with a linear and
content of threonine. However, when the proportion of FSBM quadratic pattern while significantly decreased the contents of
replacing fish meal exceeded 50%, the contents of nine EAAs C20:5n-3 and C22:6n-3 with a linear pattern (Table 5). In
were significantly lower than those in the FM group (Table 3). addition, FSBM substitution significantly increased the content of
For non-essential amino acids (NEAAs), FSBM substitution C18:2n-6 with a linear pattern (Table 5). In the whole body, with the
significantly increased the content of proline with a linear pattern increase of FSBM substitution ratio, the contents of total MUFAs
and significantly decreased the content of glycine with a linear showed a trend of first increasing and then decreasing with a
pattern. When the proportion of FSBM replacing fish meal significant linear pattern (Table 6). However, compared with the
exceeded 50%, the content of serine was significantly lower than FM group, there was no significantly difference in total MUFA

TABLE 2 Primer sequences for real-time quantitative PCR.

Gene Forward primer Reverse primer GenBank no.

b-actin GAAGTAGCCGCCCTGGTTGT AGGATACCTCGCTTGCTCTGG AF300705.2

lgbp CGGCAACCAGTACGGAGGAAC GTGGAAATCATCGGCGAAGGAG EU102286

traf6 ACATCACCAATCCCAGAG TCAGCACCGCCTTTATC HM581680

hsp70 CCTCCTACGTCGCCTTCACAGACA GGGGTAGAAGGTCTTCTTGTCTCCC AY645906

imd TGGGTCCGTGTCCAGTGATT AGAGCCGCCGGTTATGTTGT FJ592176

lysozyme TACGGCAAGAACGTCTGCAAA CACTTGCTGTTGTAAGCCACCC AF425673

sod GCCTTCCGAGGGTTCAGA TTTGGCAGCGTGTTGTCC AY495084

gpx TCAACAGCTGATCCCGTCTT CTCTTAAACGGCTGCCCATC AY973252.2

cat TTGCGTTCTCTCCTGCCAAC GGTAGTTCCTTGTACGGGCA AY518322.1

penaeidin CGGTTGATGGAGAACACGATGAAA TCATTCATCGTGCATTCATGGAAA AF390139

bip GTCGGTGGTTCCACTCGTATC ATCTGGGACTTCTTGGTAGGGA JQ265942.2

atf4 GTTTCCCTTCCATCGCCTG CGTGACTTCCTTTTGGATGGG JX908828.1

eif2a AATCCACCACCATGCCGCTC AGGTTCCGTCTTGCCCACTCTA JX908827.1

ire1 TGGTCGTTATGAACCTTGAGCG GGGAACCGATCTGTCCAGTATGA JQ265943.1

lgbp, Lipopolysaccharide and beta-1,3-glucan binding protein; traf6, TNF receptor-associated factor 6; hsp70, Heat shock 70 kDa protein; imd, immune deficiency; sod, superoxide dismutase;
gpx, glutathione peroxidase; cat, catalase; bip, immunoglobulin heavy chain binding protein; atf4, activates transcription factor 4; eif2a, eukaryotic translation initiation factor 2A; ire1, inositol-
requiring enzyme 1.

Frontiers in Marine Science 05 frontiersin.org

Chen et al. 10.3389/fmars.2024.1449066

TABLE 3 Amino acids profile of experimental diets for Pacific white shrimp (% dry matter, n=3, mean± S.E.M.) 1.

Diets Polynomial contrasts

Amino acids
CON 25F 50F 75F 100F Pvalue Linear Quadratic
Essential amino acids

His 0.75 ± 0.01b 0.66 ± 0.00a 0.65 ± 0.00a 0.64 ± 0.01a 0.66 ± 0.01a ≤ 0.001 ≤ 0.001 ≤ 0.001

Thr 1.66 ± 0.03d 1.52 ± 0.02c 1.36 ± 0.01b 1.22 ± 0.01a 1.13 ± 0.02a ≤ 0.001 ≤ 0.001 0.198

Arg 2.36 ± 0.06c 2.30 ± 0.03bc 2.16 ± 0.01ab 2.06 ± 0.01a 2.01 ± 0.03a ≤ 0.001 ≤ 0.001 0.656

Val 1.90 ± 0.03c 1.83 ± 0.01c 1.69 ± 0.02b 1.58 ± 0.02a 1.52 ± 0.03a ≤ 0.001 ≤ 0.001 0.480

Met 0.95 ± 0.02 c

0.91 ± 0.01 c
0.81 ± 0.01 b
0.68 ± 0.00a
0.64 ± 0.01 a
≤ 0.001 ≤ 0.001 0.575

Phe 1.50 ± 0.02 1.51 ± 0.01 1.46 ± 0.01 1.44 ± 0.01 1.45 ± 0.03 0.066 0.014 0.435

Ile 1.60 ± 0.03 c

1.56 ± 0.01 c
1.45 ± 0.01 b
1.37 ± 0.01ab
1.33 ± 0.03 a
≤ 0.001 ≤ 0.001 0.602

Leu 2.85 ± 0.05 c

2.77 ± 0.02 c
2.55 ± 0.02 b
2.36 ± 0.02a
2.27 ± 0.04 a
≤ 0.001 ≤ 0.001 0.894

Lys 4.83 ± 0.17c 4.77 ± 0.03c 4.15 ± 0.06b 3.51 ± 0.15a 3.06 ± 0.15a ≤ 0.001 ≤ 0.001 0.125

Total EAA 18.42 ± 0.41c 17.82 ± 0.11c 16.28 ± 0.15b 14.85 14.07
≤ 0.001 ≤ 0.001 0.814
± 0.24a ± 0.35a

Non-essential acids

Asp 3.70 ± 0.08 3.74 ± 0.03 3.65 ± 0.04 3.60 ± 0.03 3.65 ± 0.06 0.335 0.148 0.747

Glu 5.68 ± 0.11a 5.99 ± 0.05ab 6.06 ± 0.06ab 6.27 ± 0.05bc 6.59 ± 0.11c ≤ 0.001 ≤ 0.001 0.590

Ser 1.78 ± 0.04c 1.75 ± 0.01c 1.64 ± 0.02b 1.53 ± 0.02a 1.49 ± 0.03a ≤ 0.001 ≤ 0.001 0.796

Gly 2.48 ± 0.04 e

2.22 ± 0.01 d
1.97 ± 0.02 c
1.71 ± 0.02b
1.53 ± 0.03 a
≤ 0.001 ≤ 0.001 0.154

Ala 3.03 ± 0.06 bc

3.19 ± 0.01 c
2.88 ± 0.03 b
2.50 ± 0.03a
2.42 ± 0.04 a
≤ 0.001 ≤ 0.001 0.004

Tyr 0.93 ± 0.04 0.90 ± 0.02 0.86 ± 0.01 0.84 ± 0.02 0.83 ± 0.02 0.091 0.010 0.404

Pro 5.08 ± 0.30 a

6.05 ± 0.06 b
6.02 ± 0.19 b
6.37 ± 0.04b
6.55 ± 0.07 b
0.001 ≤ 0.001 0.078

Total NEAA 22.69 ± 0.53 23.84 ± 0.17 23.08 ± 0.34 22.81 ± 0.11 23.06 ± 0.35 0.203 0.783 0.321

Total AA 41.11 41.67 39.36 37.65 37.13

0.001 ≤ 0.001 0.505
± 0.93b ± 0.28b ± 0.49ab ± 0.34a ± 0.70a
1
Tryptophan could not be detected because it was destroyed during acid hydrolysis. Means bearing the same letters are not significantly different among treatments determined by Tukey’s test
(P > 0.05). The same as below.

TABLE 4 Amino acids profile of the whole shrimp body fed with different diets (% dry matter) (n = 3, mean ± S.E.M.) 1.

Diets Polynomial contrasts

Amino acids
CON 25F 50F 75F 100F P value Linear Quadratic
Essential amino acids

His 1.39 ± 0.01 1.33 ± 0.06 1.34 ± 0.03 1.35 ± 0.03 1.31 ± 0.02 0.601 0.235 0.792

Thr 2.49 ± 0.04 2.46 ± 0.10 2.47 ± 0.03 2.40 ± 0.07 2.43 ± 0.03 0.822 0.356 0.840
a ab b ab b
Arg 7.06 ± 0.21 7.37 ± 0.11 7.86 ± 0.22 7.76 ± 0.06 7.94 ± 0.11 0.012 0.001 0.173

Val 3.01 ± 0.03 2.95 ± 0.10 2.99 ± 0.04 2.89 ± 0.08 2.90 ± 0.05 0.632 0.205 0.985

Met 1.50 ± 0.02 1.48 ± 0.04 1.48 ± 0.02 1.37 ± 0.03 1.43 ± 0.04 0.111 0.042 0.616

Phe 2.62 ± 0.03 2.58 ± 0.10 2.67 ± 0.07 2.61 ± 0.05 2.59 ± 0.03 0.862 0.903 0.684

Ile 2.61 ± 0.02 2.58 ± 0.10 2.61 ± 0.04 2.49 ± 0.05 2.55 ± 0.04 0.592 0.279 0.940

Leu 4.55 ± 0.05 4.52 ± 0.16 4.60 ± 0.07 4.34 ± 0.06 4.40 ± 0.05 0.263 0.115 0.613

Lys 5.96 ± 0.12 c

5.38 ± 0.26 bc
4.68 ± 0.33 ab
3.95 ± 0.04a
4.07 ± 0.08 a
≤ 0.001 ≤ 0.001 0.104

(Continued)

Frontiers in Marine Science 06 frontiersin.org

Chen et al. 10.3389/fmars.2024.1449066

TABLE 4 Continued

Diets Polynomial contrasts

Amino acids
CON 25F 50F 75F 100F P value Linear Quadratic
Essential amino acids

Total EAA 31.19 ± 0.47 30.66 ± 0.90 30.71 ± 0.31 29.16 ± 0.44 29.62 ± 0.25 0.101 0.019 0.846

Non-essential acids

Asp 6.76 ± 0.06 6.77 ± 0.26 6.95 ± 0.14 6.64 ± 0.12 6.69 ± 0.06 0.662 0.593 0.491

Glu 10.63 ± 0.06 10.61 ± 0.30 10.69 ± 0.04 10.05 ± 0.19 10.11 ± 0.11 0.053 0.013 0.402

Ser 2.67 ± 0.04 2.66 ± 0.07 2.75 ± 0.04 2.63 ± 0.05 2.67 ± 0.03 0.527 0.831 0.547

Gly 4.81 ± 0.36 5.16 ± 0.25 5.39 ± 0.19 5.06 ± 0.35 6.02 ± 0.18 0.086 0.024 0.545

Ala 4.60 ± 0.05 4.86 ± 0.09 4.76 ± 0.08 4.54 ± 0.13 4.56 ± 0.04 0.087 0.159 0.093

Tyr 2.16 ± 0.03 2.07 ± 0.07 2.12 ± 0.04 2.05 ± 0.04 2.06 ± 0.03 0.419 0.137 0.662

Pro 11.09 ± 1.18 10.35 ± 0.46 10.20 ± 0.08 10.83 ± 1.06 8.76 ± 0.41 0.300 0.113 0.527

Total NEAA 42.73 ± 0.85 42.49 ± 1.38 42.86 ± 0.42 41.80 ± 1.14 40.88 ± 0.45 0.563 0.166 0.440

Total AA 73.92 ± 1.24 73.14 ± 2.28 73.57 ± 0.52 70.96 ± 1.54 70.50 ± 0.69 0.347 0.069 0.656
1
Tryptophan could not be detected because it was destroyed during acid hydrolysis.

TABLE 5 Fatty acid profile of experimental diets (% total fatty acids; n = 3, mean ± S.E.M.) 1.

Diets Polynomial contrasts

fatty acid
CON 25F 50F 75F 100F P-value Linear Quadratic
C13:0 4.90 ± 0.18a 5.69 ± 0.26ab 6.01 ± 0.07ab 6.79 ± 0.61bc 7.99 ± 0.49c 0.002 ≤ 0.001 0.384

C14:0 2.96 ± 0.18c 2.67 ± 0.09bc 2.53 ± 0.16abc 2.11 ± 0.09ab 2.05 ± 0.06a 0.002 ≤ 0.001 0.702

C16:0 23.30 ± 0.70 22.49 ± 0.32 22.48 ± 1.08 21.71 ± 0.22 22.61 ± 0.16 0.512 0.286 0.266

C18:0 6.85 ± 0.14 6.74 ± 0.13 7.07 ± 0.11 7.16 ± 0.14 6.99 ± 0.22 0.366 0.182 0.567

C20:0 0.58 ± 0.04 a

0.70 ± 0.01 ab
0.84 ± 0.06bc
0.89 ± 0.07 bc
0.99 ± 0.01 c
0.001 ≤ 0.001 0.472

∑SFAs 2
38.59 ± 0.75 38.28 ± 0.45 38.92 ± 1.28 38.66 ± 0.93 40.64 ± 0.47 0.352 0.121 0.268

C16:1 5.15 ± 0.34 c

4.48 ± 0.12 bc
4.03 ± 0.17ab
3.54 ± 0.04 a
3.27 ± 0.16 a
≤ 0.001 ≤ 0.001 0.309

C18:1 21.09 ± 0.22b 20.52 ± 0.11ab 19.95 ± 0.30ab 20.46 ± 0.28ab 19.48 ± 0.31a 0.012 0.002 0.784

C20:1n-9 1.08 ± 0.07c 0.89 ± 0.04bc 0.72 ± 0.05ab 0.57 ± 0.01a 0.52 ± 0.07a ≤ 0.001 ≤ 0.001 0.172

∑MUFAs 3 27.32 ± 0.47c 25.89 ± 0.18bc 24.69 ± 0.19ab 24.57 ± 0.24ab 23.27 ± 0.41a ≤ 0.001 ≤ 0.001 0.294

C18:3n-3 1.87 ± 0.04 a

2.29 ± 0.03 b
2.73 ± 0.06c
3.12 ± 0.10 d
3.22 ± 0.07 d
≤ 0.001 ≤ 0.001 0.016

C20:5n-3 6.49 ± 0.33 d

5.32 ± 0.24 c
4.02 ± 0.16b
2.77 ± 0.10 a
1.96 ± 0.12 a
≤ 0.001 ≤ 0.001 0.348

C22:6n-3 9.26 ± 0.95 b

8.08 ± 0.51 b
6.89 ± 0.63ab
5.24 ± 0.34 a
4.48 ± 0.15 a
0.001 ≤ 0.001 0.862

∑n-3 PUFAs 4
17.61 ± 1.26 d
15.69 ± 0.73 cd
13.63 ± 0.84 bc
11.14 ± 0.45 ab
9.66 ± 0.06 a
≤ 0.001 ≤ 0.001 0.879

C18:2n-6 15.44 ± 0.14a 19.15 ± 0.22b 21.93 ± 0.21c 24.96 ± 0.58d 25.87 ± 0.22d ≤ 0.001 ≤ 0.001 0.001

C20:4n-6 1.04 ± 0.07c 1.00 ± 0.07c 0.81 ± 0.04bc 0.67 ± 0.02ab 0.56 ± 0.03a ≤ 0.001 ≤ 0.001 0.650

∑n-6 PUFAs 5
16.48 ± 0.08 a
20.15 ± 0.15 b
22.75 ± 0.25 c
25.63 ± 0.60 d
26.43 ± 0.20 d
≤ 0.001 ≤ 0.001 0.001

n-3/n-6 1.07 ± 0.08 d

0.78 ± 0.04 c
0.60 ± 0.03bc
0.43 ± 0.02 ab
0.37 ± 0.00 a
≤ 0.001 ≤ 0.001 0.018
1
Some fatty acids, such as C22:0, C24:0, C14:1, C22:1n-11, C20:2n-6, C20:3n-6, C18:4n-3, C18:4n-3, C22:5n-3, whose contents were too small to be identified, are not listed in the table.
2
SFAs: saturated fatty acids including C13: 0, C14: 0, C16: 0, C18: 0 and C20: 0.
3
MUFAs: monounsaturated fatty acids including C16: 1, C18: 1 and C20: 1n-9.
4
n-3 PUFAs: n-3 polyunsaturated fatty acids including C18: 3n-3, C20: 5n-3 and C20: 6n-3.
5
n-6 PUFAs: n-6 polyunsaturated fatty acids including C18: 2n-6 and C20: 4n-6. The same as below.

Frontiers in Marine Science 07 frontiersin.org

Chen et al. 10.3389/fmars.2024.1449066

contents among these FSBM substitution groups (Table 6). The the 50FSBM and 100FSBM groups, the arrangement of hepatic
contents of C18:3n-3 showed a trend of first decreasing and then corpuscles was not tight and the gap increased (Figure 1). In the
increasing with a significant linear pattern (Table 6). FSBM 75FSBM group, the basement membrane was shed and the tubular
substitution significantly enhanced the levels of C18:2n-6 and lumen was enlarged. Hence, we indicated that no structure
C20:4n-6 with a linear pattern (Table 6). Hence, FSBM modifications appeared in the 25% group compared with the
substitution significantly decreased the ratio of n-3 PUFAs and n- control group, but the hepatopancreas were damaged if the
6 PUFAs with a linear pattern. In the muscle, with the increase of replacement ratio increased till 50% and more (Figure 1).
FSBM substitution ratio, the content of C14:0 showed a trend of
first increasing and then decreasing with a significant linear pattern
(Table 7). FSBM substitution significantly decreased the levels of 3.4 Physiological and biochemical
C16:1 and C18:1 with a linear pattern, while increased the levels of indicators in hemolymph, hepatopancreas,
C18:3n-3, C18:2n-6 and C20:4n-6 (Table 7). Hence, FSBM muscle and intestine
substitution significantly decreased the ratio of n-3 PUFAs and n-
6 PUFAs with a linear pattern (Table 7), which was consistent with In the hemolymph, compared with the control group, FSBM
the trend in the whole body. substitution had no significant effects on the activities of GPT, GOT
and T-AOC (Figures 2A, B, E). Correspondingly, as the proportion
of FSBM substitution increased, the activity of SOD showed a trend
3.3 Histology of hepatopancreas of first increasing and then decreasing with a significant linear and
quadratic pattern, but there was no significant difference compared
Compared with the FM group, 25% FSBM substitution to the control group (Figure 2D, Table 8). When FSBM replaced
increased the number of secretory cells (B cells), which indicated more than 50% of fish meal, the content of GSH significantly
that 25% FSBM substitution enhanced the digestive and absorptive decreased with a significant linear pattern (Figure 2C, Table 8).
capacity (Figure 1). In addition, the structure of the various types of We also tested the effects of FSBM substitution on total cholesterol
cells in the 25FSBM group was complete and clear, and the (T-CHO) and triglyceride (TG) contents in hemolymph. Results
arrangement was neatly arranged, indicating that no damage to showed that the response of these two lipid substances to FSBM
shrimp hepatopancreas cells was damaged (Figure 1). However, in substitution was consistent. 25% FSBM substitution did not affect

TABLE 6 Fatty acid profile of the whole shrimp body in different diets (% total fatty acids; n = 3, mean ± S.E.M.).

Diets Polynomial contrasts

Fatty acid
CON 25F 50F 75F 100F Pvalue Linear Quadratic
C13:0 13.67 ± 1.43 11.52 ± 0.76 13.52 ± 0.67 11.85 ± 0.60 11.28 ± 1.08 0.300 0.174 0.887

C14:0 0.75 ± 0.07 0.69 ± 0.06 0.68 ± 0.06 0.67 ± 0.08 0.64 ± 0.04 0.763 0.239 0.757

C16:0 26.08 ± 0.77 26.74 ± 0.99 27.2 ± 0.75 25.34 ± 1.18 25.6 ± 0.68 0.579 0.425 0.371

C18:0 14.37 ± 0.67 14.54 ± 0.71 15.44 ± 0.20 14.90 ± 0.48 14.99 ± 0.33 0.636 0.353 0.423

C20:0 1.57 ± 0.12 1.43 ± 0.25 1.31 ± 0.09 1.26 ± 0.07 1.35 ± 0.13 0.643 0.226 0.379

∑SFAs 56.43 ± 1.95 54.91 ± 1.85 58.16 ± 1.13 54.03 ± 1.49 53.85 ± 2.10 0.414 0.298 0.487

C16:1 1.41 ± 0.16 1.31 ± 0.11 1.15 ± 0.06 1.22 ± 0.06 1.15 ± 0.07 0.353 0.083 0.468
ab b ab a a
C18:1 14.62 ± 0.70 15.40 ± 0.59 13.43 ± 0.11 12.94 ± 0.38 12.39 ± 0.60 0.012 0.002 0.562

C20:1n-9 1.24 ± 0.03ab 1.20 ± 0.12ab 0.96 ± 0.02a 1.43 ± 0.14b 0.96 ± 0.06a 0.016 0.278 0.690

∑MUFAs 17.27 ± 0.81ab 17.91 ± 0.73b 15.53 ± 0.18ab 15.59 ± 0.49ab 14.50 ± 0.61a 0.015 0.002 0.661
ab a a ab b
C18:3n-3 0.67 ± 0.07 0.54 ± 0.05 0.53 ± 0.02 0.70 ± 0.08 0.82 ± 0.05 0.024 0.025 0.010

C20:5n-3 8.08 ± 0.58 8.11 ± 0.59 7.93 ± 0.43 8.78 ± 0.38 8.13 ± 0.36 0.753 0.619 0.854

C22:6n-3 7.32 ± 0.31 6.97 ± 0.88 5.73 ± 0.43 6.90 ± 0.23 6.01 ± 0.37 0.197 0.122 0.495

∑n-3PUFAs 16.06 ± 0.73 15.61 ± 1.44 14.19 ± 0.86 16.38 ± 0.65 14.96 ± 0.77 0.507 0.639 0.644

C18:2n-6 8.15 ± 0.56a 9.18 ± 0.13ab 9.79 ± 0.24ab 11.42 ± 0.64bc 13.45 ± 0.62c ≤ 0.001 ≤ 0.001 0.128

C20:4n-6 2.09 ± 0.15a 2.38 ± 0.01a 2.32 ± 0.12a 2.58 ± 0.05ab 3.24 ± 0.28b 0.004 ≤ 0.001 0.098

∑n-6PUFAs 10.24 ± 0.67a 11.56 ± 0.12ab 12.11 ± 0.35ab 14.01 ± 0.67bc 16.68 ± 0.83c ≤ 0.001 ≤ 0.001 0.094

n-3/n-6 1.57 ± 0.05 c

1.35 ± 0.11 bc
1.17 ± 0.04 ab
1.17 ± 0.05 ab
0.90 ± 0.00a
≤ 0.001 ≤ 0.001 0.745

Frontiers in Marine Science 08 frontiersin.org

Chen et al. 10.3389/fmars.2024.1449066

TABLE 7 Fatty acid profile of muscle in the shrimp fed with different diets (% total fatty acids; n = 3, mean ± S.E.M.) .

Diets Polynomial contrasts

fatty acid
CON 25F 50F 75F 100F P value Linear Quadratic
ab ab ab b a
C13:0 7.82 ± 0.56 7.21 ± 0.43 7.91 ± 0.52 8.30 ± 0.38 6.02 ± 0.52 0.056 0.135 0.073

C14:0 0.80 ± 0.05 bc

0.94 ± 0.06 c
0.68 ± 0.02 ab
0.67 ± 0.05ab
0.55 ± 0.04a
0.001 ≤ 0.001 0.153

C16:0 26.95 ± 0.36 25.80 ± 0.27 25.69 ± 0.32 25.74 ± 0.59 25.33 ± 0.81 0.287 0.068 0.410

C18:0 13.84 ± 0.46 14.62 ± 0.44 14.84 ± 0.24 15.19 ± 0.46 14.50 ± 0.19 0.214 0.144 0.074

C20:0 0.93 ± 0.03 1.10 ± 0.07 0.99 ± 0.10 1.16 ± 0.10 0.94 ± 0.07 0.232 0.787 0.113

∑SFAs 50.34 ± 0.47 49.67 ± 0.72 50.11 ± 0.34 51.06 ± 1.24 47.34 ± 1.23 0.104 0.130 0.122
b b ab a ab
C16:1 1.46 ± 0.14 1.47 ± 0.10 1.15 ± 0.05 1.05 ± 0.01 1.22 ± 0.03 0.016 0.006 0.103

C18:1 15.59 ± 0.31 c

15.25 ± 0.34 c
13.75 ± 0.18 b
12.42 ± 0.18 a
12.77 ± 0.16 ab
≤ 0.001 ≤ 0.001 0.120

C20:1n-9 1.06 ± 0.03 1.12 ± 0.06 1.21 ± 0.11 1.13 ± 0.09 0.99 ± 0.07 0.428 0.629 0.087

∑MUFAs 18.11 ± 0.36 c

17.83 ± 0.34 c
16.10 ± 0.18 b
14.59 ± 0.13 a
14.99 ± 0.18 ab
≤ 0.001 ≤ 0.001 0.133

C18:3n-3 0.47 ± 0.04a 0.64 ± 0.04ab 0.61 ± 0.01ab 0.73 ± 0.05b 1.10 ± 0.07c ≤ 0.001 ≤ 0.001 0.012

C20:5n-3 10.93 ± 0.12 10.76 ± 0.07 10.75 ± 0.19 10.65 ± 0.47 10.01 ± 0.34 0.247 0.052 0.347
b ab ab a ab
C22:6n-3 9.98 ± 0.33 9.85 ± 0.63 9.23 ± 0.13 7.79 ± 0.61 8.25 ± 0.37 0.024 0.003 0.834

∑n-3 PUFAs 21.38 ± 0.40 21.25 ± 0.66 20.58 ± 0.07 19.17 ± 1.12 19.36 ± 0.72 0.134 0.018 0.963

C18:2n-6 7.92 ± 0.33 a

8.84 ± 0.52 a
10.53 ± 0.18 b
11.87 ± 0.27 b
15.15 ± 0.21 c
≤ 0.001 ≤ 0.001 0.005

C20:4n-6 2.26 ± 0.12 a

2.41 ± 0.05 a
2.66 ± 0.11 a
3.31 ± 0.02b
3.16 ± 0.15b
≤ 0.001 ≤ 0.001 0.603

∑n-6 PUFAs 10.17 ± 0.28a 11.24 ± 0.47a 13.20 ± 0.24b 15.18 ± 0.26c 18.31 ± 0.35d ≤ 0.001 ≤ 0.001 0.007

n-3/n-6 2.11 ± 0.09c 1.90 ± 0.11c 1.56 ± 0.03b 1.26 ± 0.06ab 1.06 ± 0.02a ≤ 0.001 ≤ 0.001 0.876

FIGURE 1
The effects of FSBM substitution on the structure of hepatopancreas in Pacific white shrimp. Scale bar, 100 mm. B cells (Blasenzellen). R
cells (Restzellen).

Frontiers in Marine Science 09 frontiersin.org

Chen et al. 10.3389/fmars.2024.1449066

the contents of T-CHO and TG. However, when the substitution content of GSH decreased gradually as the proportion of FSBM
ratio exceeded 50%, the content of T-CHO and TG significantly substitution increased with a significant linear pattern (Figures 2H,
decreased with a significant linear pattern (Figures 2F, G, Table 8). J, Table 8). However, compared with the control group, only group
In the hepatopancreas, FSBM substitution had no significant 100F significantly inhibited the activity of SOD (Figure 2H). The
effects on the activity of T-AOC and the content of MDA contents of GSH in group 75F and 100F were significantly lower
(Figures 2I, K). On the contrary, the activity of SOD and the than that in the control group (Figure 2J).

A B C D

E F G

H I J K

L M N O

P Q R S

FIGURE 2
The effects of FSBM substitution on the antioxidant indices in different tissues and the contents of T-CHO and TG in the hemolymph (n = 4). The results are
presented as the mean ± S. E. M. and were analyzed with Tukey’s tests [bars bearing the same letters are not significantly different among treatments (P >
0.05)]. The same as below. (A) GPT (glutamic-pyruvic transaminase) activity in the hemolymph; (B) GOT (glutamic oxalacetic transaminase) activity in the
hemolymph; (C) GSH (reduced glutathione) content in the hemolymph; (D) SOD (superoxide dismutase) activity in the hemolymph; (E) T-AOC (total
antioxidant capacity) activity in the hemolymph; (F) T-CHO (total cholesterol) content in the hemolymph; (G) TG (triacylglycerol) content in the hemolymph;
(H) SOD activity in the hepatopancreas; (I) MDA (malondialdehyde) content in the hepatopancreas; (J) GSH content in the hepatopancreas; (K) T-AOC activity
in the hepatopancreas; (L) SOD activity in the muscle; (M) MDA content in the muscle; (N) GSH content in the muscle; (O) T-AOC activity in the muscle; (P)
SOD activity in the intestinal; (Q) MDA content in the intestinal; (R) GSH content in the intestinal; (S) T-AOC activity in the intestinal. n. s., not significant.

Frontiers in Marine Science 10 frontiersin.org

Chen et al. 10.3389/fmars.2024.1449066

In the muscle, the content of MDA and the activity of T-AOC the increase of FSBM substitution ratio, the mRNA expression of sod
were not affected by FSBM substitution (Figures 2M, O). The trend (superoxide dismutase) showed an increasing tendency without
of SOD activity in the muscle under FSBM substitution was similar statistical difference, but underwent a significant linear relationship on
with that in the hepatopancreas and only 100F significantly the whole (Figure 3A, Table 9). The tendency of cat (catalase) expression
decreased the activity of SOD (Figure 2L). The content of GSH under FSBM substitution was similar with sod expression. However,
showed a trend of increasing first and then decreasing with both compared with the control group, 75F and 100F significantly increased
linear and quadratic patterns (Figure 2N, Table 8). the mRNA expression of cat (Figure 3D). In the muscle, compared with
In the intestine, FSBM substitution had no significant effects on the the control group, 75F significantly enhanced the mRNA expression of
contents of GSH and MDA and the activity of T-AOC (Figures 2Q-S). cat and sod (Figures 3E, H). When FSBM substitution ratio exceeded
With the increasing of FSBM substitution ratio, the activity of SOD 50%, the mRNA expression of gpx was significantly higher than that in
showed a trend of first increasing and then decreasing with a significant the control group with a linear pattern (Figure 3G, Table 9). As the
linear pattern (Figure 2P, Table 8). FSBM substitution ratio increased, the mRNA expression of hsp70 in
muscle showed a decreasing tendency with a significant linear and
quadratic pattern (Figure 3F, Table 9). In the intestine, FSBM
3.5 Expression of antioxidant and immune substitution did not affect the mRNA expression of gpx and cat
related genes in tissues (Figures 3I, K). However, FSBM substitution significantly inhibited
the mRNA expression of hsp70 with a linear pattern (Figure 3J, Table 9).
In the hepatopancreas, there was no significant correlation between We also detected the effect of FSBM substitution on the mRNA
the substitution of FSBM and the expression levels of hsp70 (heat shock expression of genes related with innate immunity in tissues. Results
70 kDa protein) and gpx (glutathione peroxidase) (Figures 3B-C). With indicated that the mRNA expression of lgbp (lipopolysaccharide and

A B C D

E F G H

I J K

FIGURE 3
The effects of FSBM substitution on the mRNA expression of antioxidant enzymes in different tissues of shrimp (n=4). (A-D) mRNA expression of
antioxidant enzymes in hepatopancreas. (E-H) mRNA expression of antioxidant enzymes in muscle. (I-K) mRNA expression of antioxidant enzymes in
intestine. n. s., not significant.

Frontiers in Marine Science 11 frontiersin.org

Chen et al. 10.3389/fmars.2024.1449066

TABLE 8 Polynomial contrasts of antioxidant indices in different tissues TABLE 9 Polynomial contrasts of antioxidant enzymes mRNA expression
and T-CHO and TG in the hemolymph. in different tissues.

tissues Polynomial contrasts Polynomial contrasts

P-value Linear Quadratic P-value Linear Quadratic
Hemolymph Hepatopancreas

TG P ≤ 0.001 P ≤ 0.001 0.490 cat 0.003 P ≤ 0.001 0.928

T-CHO P ≤ 0.001 P ≤ 0.001 0.038 sod 0.067 0.005 0.826

T-AOC 0.018 0.016 0.371 gpx 0.600 0.411 0.445

SOD P ≤ 0.001 0.002 P ≤ 0.001 hsp70 0.554 0.227 0.366

GPT 0.062 0.004 0.874 Muscle

GOT 0.319 0.556 0.100 cat P ≤ 0.001 0.217 0.024

GSH P ≤ 0.001 P ≤ 0.001 0.309 sod 0.025 0.006 0.996

Hepatopancreas gpx P ≤ 0.001 P ≤ 0.001 0.002

T-AOC 0.130 0.454 0.028 hsp70 0.019 0.007 0.046

SOD P ≤ 0.001 P ≤ 0.001 0.117 Intestine

MDA 0.045 0.014 0.062 cat 0.405 0.091 0.485

GSH 0.023 0.002 0.298 gpx 0.126 0.642 0.849

Muscle hsp70 P ≤ 0.001 P ≤ 0.001 0.053

T-AOC 0.071 0.010 0.347

SOD 0.031 0.003 0.200 3.6 The mRNA expression of ER stress-

MDA 0.637 0.170 0.936
related genes in tissues
GSH P ≤ 0.001 P ≤ 0.001 P ≤ 0.001
In the hepatopancreas, FSBM substitution did not significantly
Intestine affected the expression of atf4 (activates transcription factor 4) and ire1
(inositol-requiring enzyme 1) (Figures 5B, D). However, FSBM
T-AOC 0.078 0.024 0.620
substitution significantly enhanced the mRNA expression of eif2a
SOD 0.026 0.003 0.257 (eukaryotic translation initiation factor 2A) with a linear and
MDA 0.908 0.402 0.761 quadratic pattern (Figure 5C, Table 11). Compared with the control
group, only 25F significantly increased the mRNA expression of bip
GSH 0.101 0.018 0.741
(immunoglobulin heavy chain binding protein) (Figure 5A). In the
muscle, compared with the control group, FSBM substitution did not
beta-1,3-glucan binding protein) and penaeidin in the hepatopancreas significantly affect the expression of eif2a and atf4, but significantly
showed significantly linear increase with increasing substitution ratio, inhibited the mRNA expression of bip with a linear and quadratic
but the difference was that when the FSBM substitution ratio exceeded pattern (Figures 5E, F, H, Table 11). The mRNA expression of ire1 in
50%, the mRNA expression level of lgbp was significantly higher than 50F was significantly lower than that in the control group, while 75F
that of the control group, while only in the 100F group did the mRNA significantly enhanced the mRNA expression of ire1 (Figure 5G). In the
expression level of penaeidin be significantly higher than that of the intestine, FSBM substitution did not affect the mRNA expression of atf4
control group (Figures 4D, E, Table 10). FSBM substitution did not and eif2a (Figures 5I, J). When the FSBM substitution ratio exceeded
affect the mRNA expression of lysozyme and imd (immune deficiency) 75%, the mRNA expression of bip was significantly increased with a
in the hepatopancreas (Figures 4A, C). Although there was no linear pattern (Figure 5L, Table 11). Compared with the control group,
significant correlation between the substitution of FSBM and the 75F significantly enhanced the mRNA expression of ire1 (Figure 5K).
expression levels of traf6 (tnf receptor-associated factor 6), it showed
a significantly linear increase tendency (Figure 4B, Table 10). In the
muscle, FSBM substitution did not affect the mRNA expression of 4 Discussion
traf6, lysozyme, lgbp and penaeidin (Figures 4F, H-J). However, 75F and
100F significantly increased the mRNA expression of imd with a The purpose of this study is to explore the application value of SBM
significant linear pattern (Figure 4G, Table 10). The mRNA fermented by a self-developed probiotic strain of Bacillus subtilis with
expression of penaeidin, imd, lysozyme and lgbp in the intestine were non starch polysaccharides and antigen protein hydrolysis ability in the
not affect by FSBM substitution (Figures 4K-N). feed of Litopenaeus vannamei. Shrimp, like other aquatic animals, do

Frontiers in Marine Science 12 frontiersin.org

Chen et al. 10.3389/fmars.2024.1449066

A B C D E

F G H I J

K L M N

FIGURE 4
The effects of FSBM substitution on the mRNA expression of immunity genes in different tissues of shrimp (n=4). (A–E) mRNA expression of
immunity genes in hepatopancreas. (F–J) mRNA expression of immunity genes in muscle. (K–N) mRNA expression of immunity genes in intestine. n.
s., not significant.

not actually need protein; instead, they need a well-balanced

combination of essential and nonessential amino acids provided by TABLE 10 Polynomial contrasts of immunity gene expression in
different tissues.
protein sources (Council et al., 2011). Hence, the amino acid
composition of whole shrimp under FSBM substitution was first
Polynomial contrasts
detected. We found that FSBM substitution significantly reduced the
content of lysine in whole shrimp. Lysine is abundant in animal-based P-value Linear Quadratic
protein, but lacking in plant-based protein (Gorissen et al., 2018). Hepatopancreas
Therefore, lysine is also known as the first limiting amino acid in the
imd 0.355 0.055 0.628
process of replacing fish meal with plant protein in aquaculture (Sá et al.,
2021). The short of lysine is one of the reasons that affect the utilization traf6 0.229 0.032 0.406

efficiency of plant-based protein. Previous study has shown that lgbp P ≤ 0.001 P ≤ 0.001 0.099
fermentation technology can increase the content of lysine in SBM
lysozyme 0.539 0.151 0.483
(Yang et al., 2018). However, it still cannot fill the gap between FSBM
and fish meal. On the contrary, the content of arginine in whole shrimp penaeidin P ≤ 0.001 P ≤ 0.001 0.014

body gradually increased with the increase of FSBM substitution Muscle

proportion in the present study. Similar results have also been
traf6 0.150 0.322 0.524
confirmed in African catfish (Clarias gariepinus) (Kari et al., 2022).
Arginine is considered as an essential amino acid unique to aquatic lgbp 0.433 0.938 0.855

animals (Zhou et al., 2012), and the content of arginine in SBM is (Continued)

Frontiers in Marine Science 13 frontiersin.org

Chen et al. 10.3389/fmars.2024.1449066

TABLE 10 Continued Protein sources in the feed not only affect the protein metabolism
of aquatic animals, but also have an impact on lipid metabolism
Polynomial contrasts (Torrecillas et al., 2021). In the present study, we revealed the effect of
P-value Linear Quadratic FSBM replacing fish meal on shrimp lipid metabolism from two
aspects. On the one hand, when the FSBM replacement ratio
Muscle
exceeded 50%, the content of TG and T-CHO in the hemolymph
imd 0.003 P ≤ 0.001 0.080 significantly decreased. Similar results were also confirmed in
penaeidin 0.386 0.087 0.825 Jannathulla’s study (Jannathulla et al., 2018). they indicated that
Aspergillus niger-fermented SBM replacing fish meal significantly
lysozyme 0.481 0.245 0.445
reduced the content of T-CHO and TG in the hemolymph of
Intestine shrimp, which may be attributed to the lipid-lowering effect of plant-
lysozyme 0.778 0.994 0.865 based proteins. However, Yue et al. (2012) found that using SBM and
peanut meal to replace fish meal did not change the lipid metabolism
imd 0.764 0.370 0.366
indicators of the hemolymph. On the other hand, we also tested the
lgbp 0.265 0.153 0.880 effect of FSBM on the fatty acid composition of shrimp. As the
penaeidin 0.438 0.485 0.544 proportion of FSBM substitution increased, the contents of a-
linolenic acid, linoleic acid and n-6 PUFAs in the whole shrimp
already high. Perhaps plant protein regulated the gene expression and body and muscle were increased. However, the content of DHA in
enzyme activity of arginine metabolism, but the specific mechanism still muscle was reduced. Both of the above phenomena reflected the
needs to be further explored. Overall, with the substitution of FSBM, the difference in fatty acids between protein raw materials. Soybeans are
amino acid composition of the whole shrimp is relatively stable. rich in a- linolenic acid (Asekova et al., 2014) but lacking in DHA.

A B C D

E F G H

I J K L

FIGURE 5
The effects of FSBM substitution on the mRNA expression of endoplasmic reticulum stress-related genes in different tissues of shrimp (n=4). (A–D)
mRNA expression of endoplasmic reticulum stress-related genes in hepatopancreas. (E–H) mRNA expression of endoplasmic reticulum stress-
related genes in muscle. (I–L) mRNA expression of endoplasmic reticulum stress-related genes in intestine. n. s., not significant.

Frontiers in Marine Science 14 frontiersin.org

Chen et al. 10.3389/fmars.2024.1449066

TABLE 11 Polynomial contrasts of endoplasmic reticulum stress-related significantly increased after FSBM replaced over 75% of fish meal
gene expression in different tissues.
protein. The above indicators also proved that a high proportion of
FSBM replacing fish meal caused oxidative stress in the hepatopancreas,
Polynomial contrasts
which can be reflected by the gradual increase in the content of lipid
P-value Linear Quadratic peroxidation product MDA, although there was no significant
Hepatopancreas difference. Oxidative stress in the hepatopancreas is an important
factor limiting the proportion of plant-based protein sources, as
bip P ≤ 0.001 P ≤ 0.001 0.113
oxidative stress can easily damage the structure of the hepatopancreas,
atf4 0.381 0.433 0.159 thereby affecting their normal function (Yang et al., 2022b). In this
eif2a P ≤ 0.001 0.003 P ≤ 0.001 study, histological sectioning results showed that when the FSBM
substitution ratio exceeded 50%, the hepatopancreas structures were
ire1 0.577 0.143 0.464
damaged, with severe vacuolization and detachment of glandular ducts
Muscle from the basement membrane. The conclusion that a high proportion of
eif2a 0.036 0.204 0.006 plant-based proteins damage the structure of the hepatopancreas has
also been confirmed in Lin’s study (Lin and Chen, 2022). Compared
atf4 0.006 0.472 0.885
with hepatopancreas, there is less research on oxidative stress in muscle.
ire1 P ≤ 0.001 0.824 0.649 However, it is undeniable that as an edible part of shrimp, ensuring the
bip P ≤ 0.001 P ≤ 0.001 P ≤ 0.001 normal growth and development of muscles is crucial for consumers.
Oxidative stress can easily cause damage to muscle growth (Kozakowska
Intestine
et al., 2015; Huang et al., 2022), which is reflected in sparse muscle fiber
ire1 0.032 0.004 0.309 density and shortened sarcomere length. The intestine of shrimp plays
atf4 0.449 0.573 0.318 critical role of digesting and absorbing nutrients. Therefore, the health of
the intestine affects the growth status of shrimp. Here, we found that
eif2a 0.272 0.168 0.108
FSBM substitution had little effect on the antioxidant enzyme activity in
bip 0.003 P ≤ 0.001 0.374 the intestine, but significantly reduced the gene expression of hsp70.
Hsp70 can protect the proteome from stress interference and is also
There is relatively little research on the effect of FSBM replacing fish known as the intestinal gatekeepers due to its interaction with gut
meal on the fatty acid composition in aquatic animals. This study just microbiota (Liu et al., 2014). Actually, microbiomics is often used to
filled this gap and provided new ideas for optimizing the application investigate the effects of FSBM on the intestinal health of aquatic animals
strategy of FSBM in aquatic feed. (Cheng et al., 2020; Wei et al., 2021). Probiotics used for fermentation
During the aquaculture process, nutrient availability is one of the may affect the colonization and abundance of gut microbiota. Therefore,
main factors inducing oxidative stress in aquatic animals (Ciji and we will introduce microbiology to further explore the impact of FSBM
Akhtar, 2021). Therefore, antioxidant indicators in different tissues were on the intestinal health of shrimp in the future.
detected. As a representative species of open circulation system, the The execution of basic cellular functions requires regulated protein
hemolymph of shrimp plays an important role in nutrient transport, folding homeostasis. The endoplasmic reticulum (ER) is an active
innate immune response, and stress resistance (Tassanakajon et al., organelle that achieves this function by folding and modifying secreted
2013; Irani et al., 2022). In the present study, when the proportion of and membrane proteins (Kettel and Karagöz, 2024). Reactive oxygen
FSBM exceeded 50%, the content of GSH significantly decreased. GSH species (ROS) produced in the oxidative stress can accelerate ER
is a key substrate for GPX to play catalyzing function, which is dysfunction (Tse et al., 2016). Hence, we explored the effect of FSBM
synthesized from glycine, cysteine, and glutamate (Ruiz-Ramı́rez et al., substitution on the mRNA expression of genes associated with ER
2014). The previous study in our lab indicated that the lower content of stress. Endoplasmic reticulum chaperone BIP (also known as GRP78)
glycine in FSBM may be the reason for the decrease in GSH in is essential for protein folding and quality control in the endoplasmic
largemouth bass (Chen et al., 2023). Recently, the function of glycine reticulum lumen (Liu et al., 2023). However, in the present study, the
in aquatic feed is gradually being explored, and studies in hybrid striped response of bip in the intestine and muscle to FSBM substitution
bass have also emphasized the growth promoting effect of glycine in showed an opposite trend. Chen et al. (2021) demonstrated that
SBM-based diets (He et al., 2023; Li et al., 2023). We speculate that tunicamycin (TM) could induced ER stress in the liver of large
dietary glycine supplementation may enhance the utilization efficiency yellow croaker (Larimichthys crocea) and enhanced the mRNA
of FSBM in aquaculture. In addition, from the activities of SOD and T- expression of bip. Hence, the elevation of bip expression in the
AOC, 25% FSBM substitution enhanced antioxidant capacity, although intestine of shrimp indicated that high proportion of FSBM induced
there is no significant difference. The hepatopancreas is important organ ER stress. However, further research is needed to investigate the
in shrimp and responsible for digestion, absorption, storage and mechanisms by which FSBM reduced the expression of bip in
metabolism (Liang et al., 2022). However, hepatopancreas is also muscle. In addition, the response of eif2a in different tissues under
easily disturbed by oxidative stress (Yu et al., 2023). In this study, the FSBM substitution also varied acutely. With the increase of FSBM
activity of SOD significantly decreased after fish meal protein was 100% substitution proportion, the mRNA expression of eif2a showed a trend
replaced by FSBM, and the content of GSH also showed a similar trend of decreasing first and then increasing. However, all FSBM substitution
to that of hemolymph. In addition, the mRNA expression level of cat group enhanced the mRNA expression of eif2a. Eif2a has been proved

Frontiers in Marine Science 15 frontiersin.org

Chen et al. 10.3389/fmars.2024.1449066

to protect tissues against ER stress (Yu et al., 2021). Actually, the Ethics statement
expression of some specific genes does not represent whether the ER
stress has really occurred, because it is a complete response. Hence, The animal study was approved by Institutional Animal Care
further exploration is needed in the future to investigate the and Use Committee of Zhejiang Ocean University. The study was
mechanism of FSBM in regulating ER stress. conducted in accordance with the local legislation and
The health status of the body is a balance of various opposites, institutional requirements.
including stress and anti-stress, immunity and anti-immunity. When
this balance is disrupted, the immunity system is destroyed and
inflammation is occurred. Emerging evidence has shown that
Author contributions
nutritional stimulation is an important factor affecting the immune
status of the aquatic animal (Dawood, 2021), especially anti-nutritional
SC: Formal analysis, Methodology, Writing – original draft.
factors (ANFs) in SBM. Although fermentation techniques can reduce
JD: Formal analysis, Investigation, Methodology, Writing – review
ANFs in SBM, excessive FSBM has also been shown to reduce the
& editing. YC: Funding acquisition, Resources, Writing – review &
immunity of farmed animals (Zhang et al., 2021). Invertebrates do not
editing. QC: Conceptualization, Funding acquisition, Project
have the adaptive immune system and innate immunity system
administration, Writing – review & editing. FD: Software,
(including hemocytes and antimicrobial peptides) plays a crucial role
Validation, Visualization, Writing – review & editing. CW:
in resisting external immune stimuli (recognition, cell–cell
Investigation, Methodology, Writing – review & editing. YS:
communication, lysis of foreign cells, encapsulation, phagocytosis,
Software, Validation, Writing – review & editing. JW:
and cytotoxicity) (Ballarin et al., 2021; Lanz-Mendoza and
Conceptualization, Project administration, Resources, Writing –
Contreras-Garduño, 2022). Hence, the mRNA expression of
review & editing. TH: Funding acquisition, Project administration,
immunity-related genes was examined in the present study. FSBM
Resources, Writing – review & editing.
substitution did not significantly affect the expression of immune genes
in the muscle and intestine. However, a high proportion of FSBM
substitution activated lgbp and penaeidin in the hepatopancreas. Lgbp
is a kind of pattern recognition proteins (PRPs) which is responsible for
Funding
activation of the prophenoloxidase system and plays essential roles in
The author(s) declare financial support was received for the
host immunological defense (Zhang et al., 2016). Previous studies have
research, authorship, and/or publication of this article. This work
mainly emphasized its role in resisting bacterial infection (Zhang et al.,
was supported by Ten-thousand Talents Plan of Zhejiang Province
2016). Recently, there have been reports of its protective role in
(No. 2022R52021), “Pioneer” and “Leading Goose” R&D Program
resisting external stress (Chen et al., 2015). However, its activation in
of Zhejiang (No: 2022C04020) and Zhoushan Science and
nutritional stress is the first time reported in the present study.
Technology Project (No: 2023C41008; No: 2023C41009).
Penaeidin is an antimicrobial peptide isolated from shrimp
hemolymph, which is activated under bacteria and virus infection,
especially in inflammation conditions (Song and Li, 2014). Studies in
the aquatic animals found that probiotics in feed can positively regulate Conflict of interest
the expression of penaeidin and enhance immunity (Pooljun et al.,
2020; Tseng et al., 2023). However, Bacillus subtilis in this study did not The authors declare that the research was conducted in the
affect its expression during a low-proportion FSBM replacement, absence of any commercial or financial relationships that could be
whereas a sharp rise in the total FSBM replacement group suggested construed as a potential conflict of interest.
that the hepatopancreas might be diseased. Due to the high
temperature treatment during the production process, the finished
feed may contain no active Bacillus subtilis. Co-feeding Bacillus subtilis Publisher’s note
may be a better method to exert the probiotic effect of subtilis.
In summary, through the responses to FSBM in different tissues, the All claims expressed in this article are solely those of the authors
screened Bacillus subtilis is a bioconverter of low value biomass (SBM) and do not necessarily represent those of their affiliated
into high value feed ingredient, which can replace up to 25% dietary fish organizations, or those of the publisher, the editors and the
meal without affecting antioxidant capacity and immunity. Moreover, reviewers. Any product that may be evaluated in this article, or
25% FSBM substitution enhanced hepatopancreas structure. Considering claim that may be made by its manufacturer, is not guaranteed or
the shortage of fish meal resources affecting the development of shrimp endorsed by the publisher.
industry, this FSBM has clear application prospects.

Supplementary material
Data availability statement
The Supplementary Material for this article can be found online
The raw data supporting the conclusions of this article will be at: https://www.frontiersin.org/articles/10.3389/fmars.2024.1449066/
made available by the authors, without undue reservation. full#supplementary-material

Frontiers in Marine Science 16 frontiersin.org

Chen et al. 10.3389/fmars.2024.1449066

References
Abd El-Naby, A. S., Eid, A., Gaafar, A. Y., Sharawy, Z., Khattaby, A., El-sharawy, M. Kårlund, A., Gó mez-Gallego, C., Korhonen, J., Palo-Oja, O. M., El-Nezami, H., and
S., et al. (2023). Overall evaluation of the replacement of fermented soybean to fish meal Kolehmainen, M. (2020). Harnessing microbes for sustainable development: food
in juvenile white shrimp, Litopenaeus vannamei diet: growth, health status, and fermentation as a tool for improving the nutritional quality of alternative protein
hepatopancreas histomorphology. Aquacult. Int., 1–19. sources. Nutrients 12, 1020. doi: 10.3390/nu12041020
Abd El-Naby, A. S., Eid, A., Gaafar, A. Y., Sharawy, Z., Khattaby, A., El-sharawy, M. S., Kettel, P., and Karagöz, G. E. (2024). ENDOPLASMIC RETICULUM: Monitoring
et al. (2023). Overall evaluation of the replacement of fermented soybean to fish meal in and maintaining protein and membrane homeostasis in the endoplasmic reticulum by
juvenile white shrimp, Litopenaeus vannamei diet: growth, health status, and hepatopancreas the unfolded protein response. Int. J. Biochem. Cell Biol. 172, 106598. doi: 10.1016/
histomorphology. Aquacult. Int. 32, 1665–1683. doi: 10.1007/s10499-023-01234-0 j.biocel.2024.106598
Asekova, S., Chae, J.-H., Ha, B.-K., Dhakal, K. H., Chung, G., Shannon, J., et al. (2014). Kozakowska, M., Pietraszek-Gremplewicz, K., Jozkowicz, A., and Dulak, J. (2015). The
Stability of elevated a-linolenic acid derived from wild soybean (Glycine soja Sieb. & Zucc.) role of oxidative stress in skeletal muscle injury and regeneration: focus on antioxidant
across environments. Euphytica 195, 409–418. doi: 10.1007/s10681-013-1004-1 enzymes. J. Muscle Res. Cell Motility. 36, 377–393. doi: 10.1007/s10974-015-9438-9
Ballarin, L., Karahan, A., Salvetti, A., Rossi, L., Manni, L., Rinkevich, B., et al. (2021). Lanz-Mendoza, H., and Contreras-Garduño, J. (2022). Innate immune memory in
Stem cells and innate immunity in aquatic invertebrates: Bridging two seemingly invertebrates: Concept and potential mechanisms. Dev. Comp. Immunol. 127, 104285.
disparate disciplines for new discoveries in biology. Front. Immunol. 12, 688106. doi: 10.1016/j.dci.2021.104285
doi: 10.3389/fimmu.2021.688106 Li, X., He, W., and Wu, G. (2023). Dietary glycine supplementation enhances the
Barragá n, L. P., Figueroa, J., Durá n, L. R., Gonzá lez, C. A., and Hennigs, C. (2016). growth performance of hybrid striped bass (Morone saxatilis♀× Morone chrysops♂) fed
Fermentative production methods, Biotransformation of Agricultural Waste and By- soybean meal-based diets. J. Anim. Sci. 101, skad345. doi: 10.1093/jas/skad345
Products (Elsevier), 189–217. doi: 10.1016/B978-0-12-803622-8.00007-0 Liang, Z., Chen, T., Yang, F., Li, S., Zhang, S., and Guo, H. (2022). Toxicity of chronic
Cao, Y., Xu, M., Lu, J., and Cai, G. (2023). Simultaneous microbial fermentation and waterborne zinc exposure in the hepatopancreas of white shrimp Litopenaeus
enzymolysis: a biotechnology strategy to improve the nutritional and functional quality vannamei. Chemosphere 309, 136553. doi: 10.1016/j.chemosphere.2022.136553
of soybean meal. Food Rev. Int. 40, 1–16. doi: 10.1080/87559129.2023.2255892 Lin, Y.-H., and Chen, Y.-T. (2022). Lactobacillus spp. fermented soybean meal
Chen, Y.-Y., Chen, J.-C., Lin, Y.-C., Yeh, S.-T., and Huang, C.-L. (2015). White partially substitution to fish meal enhances innate immune responses and nutrient
shrimp Litopenaeus vannamei that have received Gracilaria tenuistipitata extract show digestibility of white shrimp (Litopenaeus vannamei) fed diet with low fish meal.
early recovery of immune parameters after ammonia stressing. Mar. Drugs 13, 3606– Aquaculture 548, 737634. doi: 10.1016/j.aquaculture.2021.737634
3624. doi: 10.3390/md13063606 Liu, H., Dicksved, J., Lundh, T., and Lindberg, J. E. (2014). Heat shock proteins:
Chen, Q., Fang, W., Cui, K., Chen, Q., Xiang, X., Zhang, J., et al. (2021). Endoplasmic intestinal gatekeepers that are influenced by dietary components and the gut
reticulum stress induces hepatic steatosis by transcriptional upregulating lipid droplet microbiota. Pathogens 3, 187–210. doi: 10.3390/pathogens3010187
protein perilipin2. FASEB J. 35, e21900. doi: 10.1096/fj.202100739RR Liu, Z., Liu, G., Ha, D. P., Wang, J., Xiong, M., and Lee, A. S. (2023). ER chaperone
Chen, Y., Mitra, A., Rahimnejad, S., Chi, S., Kumar, V., Tan, B., et al. (2024). Retrospect GRP78/BiP translocates to the nucleus under stress and acts as a transcriptional
of fish meal substitution in Pacific white shrimp (Litopenaeus vannamei) feed: Alternatives, regulator. Proc. Natl. Acad. Sci. 120, e2303448120. doi: 10.1073/pnas.2303448120
limitations and future prospects. Rev. Aquacult. 16, 382–409. doi: 10.1111/raq.12843 Liu, T., Xu, H., Han, T., Wang, J., Yin, F., and Wang, C. (2021). Effect of dietary egg
Chen, Q., Wang, C., Sun, Y., Chen, Y., Chen, S., Han, T., et al. (2023). Excessive yolk lecithin levels on survival, growth, lipid metabolism, and antioxidant capacity of
substitution of fish meal with fermented soybean meal induces oxidative stress by early juvenile green mud crab Scylla paramamosain. Aquaculture 540, 736706.
impairing glutathione metabolism in largemouth bass (Micropterus salmoides). doi: 10.1016/j.aquaculture.2021.736706
Antioxidants 12, 2096. doi: 10.3390/antiox12122096 Livak, K. J., and Schmittgen, T. D. (2001). Analysis of relative gene expression data
Cheng, A. C., Yeh, S. P., Hu, S. Y., Lin, H. L., and Liu, C. H. (2020). Intestinal using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25,
microbiota of white shrimp, Litopenaeus vannamei, fed diets containing Bacillus 402–408. doi: 10.1006/meth.2001.1262
subtilis E20-fermented soybean meal (FSBM) or an antimicrobial peptide derived Pooljun, C., Daorueang, S., Weerachatyanukul, W., Direkbusarakom, S., and
from B. subtilis E20-FSBM. Aquacult. Res. 51, 41–50. doi: Abd El-Naby Jariyapong, P. (2020). Enhancement of shrimp health and immunity with diets
Ciji, A., and Akhtar, M. S. (2021). Stress management in aquaculture: A review of supplemented with combined probiotics: application to Vibrio parahaemolyticus
dietary interventions. Rev. Aquacult. 13, 2190–2247. doi: 10.1111/raq.12565 infections. Dis. Aquat. Organisms. 140, 37–46. doi: 10.3354/dao03491
Council, N. R., Earth, D.o., Studies, L., and Fish, C. (2011). Shrimp, Nutrient Qi, N., Zhan, X., Milmine, J., Sahar, M., Chang, K.-H., and Li, J. (2023). Isolation and
requirements of fish and shrimp (National academies press). characterization of a novel hydrolase-producing probiotic Bacillus licheniformis and its
Dai, C., Ma, H., He, R., Huang, L., Zhu, S., Ding, Q., et al. (2017). Improvement of application in the fermentation of soybean meal. Front. Nutr. 10, 1123422.
nutritional value and bioactivity of soybean meal by solid-state fermentation with doi: 10.3389/fnut.2023.1123422
Bacillus subtilis. Lwt 86, 1–7. doi: 10.1016/j.lwt.2017.07.041 Ruiz-Ramı́rez, A., Ortiz-Balderas, E., Cardozo-Saldaña, G., Diaz-Diaz, E., and El-
Dawood, M. A. (2021). Nutritional immunity of fish intestines: Important insights Hafidi, M. (2014). Glycine restores glutathione and protects against oxidative stress in
for sustainable aquaculture. Rev. Aquacult. 13, 642–663. doi: 10.1111/raq.12492 vascular tissue from sucrose-fed rats. Clin. Sci. 126, 19–29. doi: 10.1042/CS20130164

Gorissen, S. H., Crombag, J. J., Senden, J. M., Waterval, W. H., Bierau, J., Verdijk, L. B., Sá , A. G. A., Silva, D. C. D., Pacheco, M. T. B., Moreno, Y. M. F., and Carciofi, B. A.
et al. (2018). Protein content and amino acid composition of commercially available plant- M. (2021). Oilseed by-products as plant-based protein sources: Amino acid profile and
based protein isolates. Amino Acids 50, 1685–1695. doi: 10.1007/s00726-018-2640-5 digestibility. Future Foods 3, 1020. doi: 10.1016/j.fufo.2021.100023

He, W., Posey, E. A., Steele, C. C., Savell, J. W., Bazer, F. W., and Wu, G. (2023). Dietary Shrestha, A. K., Dahal, N. R., and Ndungutse, V. (2010). Bacillus fermentation of
glycine supplementation enhances postweaning growth and meat quality of pigs with soybean: A review. J. Food Sci. Technol. Nepal. 6, 1–9. doi: 10.3126/jfstn.v6i0.8252
intrauterine growth restriction. J. Anim. Sci. 101, skad354. doi: 10.1093/jas/skad354 Song, Y.-L., and Li, C.-Y. (2014). Shrimp immune system-special focus on penaeidin.
Huang, X., Huang, Z., Sun, L., Qiu, M., Deng, Q., Fang, Z., et al. (2022). Protective J. Mar. Sci. Technol. 22, doi: 10.6119/JMST-013-0813-1.
mechanisms of three antioxidants against T-2 toxin-induced muscle protein Tassanakajon, A., Somboonwiwat, K., Supungul, P., and Tang, S. (2013). Discovery
deterioration in shrimp. J. Sci. Food Agricult. 102, 4883–4891. doi: 10.1002/jsfa.11851 of immune molecules and their crucial functions in shrimp immunity. Fish. Shellfish.
Irani, M., Rajabi Islami, H., Nafisi Bahabadi, M., and Hosseini Shekarabi, S. P. (2022). Immunol. 34, 954–967. doi: 10.1016/j.fsi.2012.09.021
Effect of density on performance and some hemolymph antioxidant parameters of Torrecillas, S., Montero, D., Carvalho, M., Benitez-Santana, T., and Izquierdo, M.
white-leg shrimp (Litopenaeus vannamei) in a biofloc system. Aquat. Physiol. (2021). Replacement of fish meal by Antarctic krill meal in diets for European sea bass
Biotechnol. 10, 41–62. doi: 10.22124/JAPB.2022.21352.1451 Dicentrarchus labrax: Growth performance, feed utilization and liver lipid metabolism.
Jannathulla, R., Dayal, J. S., Ambasankar, K., and Muralidhar, M. (2018). Effect of Aquaculture 545, 737166. doi: 10.1016/j.aquaculture.2021.737166
Aspergillus Niger fermented soybean meal and sunflower oil cake on growth, carcass Tse, G., Yan, B. P., Chan, Y. W., Tian, X. Y., and Huang, Y. (2016). Reactive oxygen
composition and haemolymph indices in Penaeus vannamei Boon. Aquaculture 486, 1– species, endoplasmic reticulum stress and mitochondrial dysfunction: the link with
8. doi: 10.1016/j.aquaculture.2017.12.005 cardiac arrhythmogenesis. Front. Physiol. 7, 208400. doi: 10.3389/fphys.2016.00313
Kari, Z. A., Kabir, M. A., Dawood, M. A., Razab, M. K. A. A., Ariff, N. S. N. A., Sarkar, Tseng, K.-C., Huang, H.-T., Huang, S.-N., Yang, F.-Y., Li, W.-H., Nan, F.-H., et al.
T., et al. (2022). Effect of fish meal substitution with fermented soy pulp on growth (2023). Lactobacillus plantarum isolated from kefir enhances immune responses and
performance, digestive enzyme, amino acid profile, and immune-related gene survival of white shrimp (Penaeus vannamei) challenged with Vibrio alginolyticus.
expression of African catfish (Clarias gariepinus). Aquaculture 546, 737418. Fish. Shellfish. Immunol. 135, 108661. doi: 10.1016/j.fsi.2023.108661
doi: 10.1016/j.aquaculture.2021.737418 Wang, C., Qiu, X., Hou, R., Liu, J., Li, L., and Mao, X. (2023). Improvement of
Kari, Z. A., Mat, K., Kabir, M. A., ZAL, W. A., MUNIR, M. B., WEI, L. S., et al. (2023). soybean meal quality by one-step fermentation with mixed-culture based on protease
Soybean by-product: As an alternative to fish meal as protein source for aquaculture activity. Innovative. Food Sci. Emerging. Technol. 85, 103311. doi: 10.1016/
industry. J. Sustainabil. Sci. Manag. 18, 177–200. doi: 10.46754/jssm j.ifset.2023.103311

Frontiers in Marine Science 17 frontiersin.org

Chen et al. 10.3389/fmars.2024.1449066

Wang, P., Wang, S., Zhu, C., Sun, Y., Yan, Q., and Yi, G. (2024). Monascus purpureus M- to the hepatopancreas of the whiteleg shrimp, Litopenaeus vannamei. Environ. pollut.
32 fermented soybean meal improves the growth, immunity parameters, intestinal 329, 121646. doi: 10.1016/j.envpol.2023.121646
morphology, disease resistance, intestinal microbiota and metabolome in Pacific white Yue, Y. R., Liu, Y. J., Tian, L. X., Gan, L., Yang, H. J., and Liang, G. Y. (2012). Effects
shrimp (Litopenaeus vannamei). Anim. Nutr. 17, 283-296. doi: 10.1016/j.aninu.2024.03.009 of replacing fish meal with soybean meal and peanut meal on growth, feed utilization
Wei, C., Wang, X., Li, C., Zhou, H., Liu, C., Mai, K., et al. (2021). Replacement of and haemolymph indexes for juvenile white shrimp Litopenaeus vannamei, Boone.
fishmeal with Shewanella sp. MR-7 fermented soya bean meal in Pacific white shrimp. Aquacult. Res. 43, 1687–1696. doi: 10.1111/are.2012.43.issue-11
Aquacult. Res. 52, 2110–2120. doi: 10.1111/are.15063 Zhang, S., Shi, Y., Zhang, S., Shang, W., Gao, X., and Wang, H. (2014). Whole
Xie, S., Liu, Y., Tian, L., Niu, J., and Tan, B. (2020). Low dietary fish meal induced soybean as probiotic lactic acid bacteria carrier food in solid-state fermentation. Food
endoplasmic reticulum stress and impaired phospholipids metabolism in juvenile Control. 41, 1–6. doi: 10.1016/j.foodcont.2013.12.026
pacific white shrimp, Litopenaeus vannamei. Front. Physiol. 11, 1024. doi: 10.3389/ Zhang, W., Tan, B., Deng, J., Dong, X., Yang, Q., Chi, S., et al. (2021). Effects of high
fphys.2020.01024 level of fermented soybean meal substitution for fish meal on the growth, enzyme
Yang, S., Luo, J., Huang, Y., Yuan, Y., and Cai, S. (2022b). Effect of sub-lethal activity, intestinal structure protein and immune-related gene expression and intestinal
ammonia and nitrite stress on autophagy and apoptosis in hepatopancreas of Pacific flora in juvenile pearl gentian grouper. Aquacult. Nutr. 27, 1433–1447. doi: 10.1111/
whiteleg shrimp Litopenaeus vannamei. Fish. Shellfish. Immunol. 130, 72–78. anu.13281
doi: 10.1016/j.fsi.2022.08.069 Zhang, X., Zhu, Y.-T., Li, X.-J., Wang, S.-C., Li, D., Li, W.-W., et al. (2016).
Yang, H., Rahman, M. M., Li, X., Sharifuzzaman, S., and Leng, X. (2022a). Dietary Lipopolysaccharide and beta-1, 3-glucan binding protein (LGBP) stimulates
leucine requirement of juvenile largemouth bass (Micropterus salmoides) based on prophenoloxidase activating system in Chinese mitten crab (Eriocheir sinensis). Dev.
growth, nutrient utilization and growth-related gene analyses. Aquaculture 555, Comp. Immunol. 61, 70–79. doi: 10.1016/j.dci.2016.03.017
738207. doi: 10.1016/j.aquaculture.2022.738207 Zheng, L., Li, D., Li, Z. L., Kang, L. N., Jiang, Y. Y., Liu, X. Y., et al. (2017). Effects of
Yang, A., Zuo, L., Cheng, Y., Wu, Z., Li, X., Tong, P., et al. (2018). Degradation of major Bacillus fermentation on the protein microstructure and anti-nutritional factors of
allergens and allergenicity reduction of soybean meal through solid-state fermentation with soybean meal. Lett. Appl. Microbiol. 65, 520–526. doi: 10.1111/lam.12806
microorganisms. Food Funct. 9, 1899–1909. doi: 10.1039/C7FO01824J Zhi, L., Zihong, Z., Yudi, H., Piao, C., Xianmei, G., Bin, L., et al. (2023). Origin and
Yu, Q., Fu, Z., Huang, M., Xu, C., Wang, X., Qin, J. G., et al. (2021). Growth, farming pattern authentication of wild-caught, coast-pond and freshwater farming
physiological, biochemical, and molecular responses of Pacific white shrimp white shrimp (Litopenaeus vannamei) in Chinese market using multi-stable isotope
Litopenaeus vannamei fed different levels of dietary selenium. Aquaculture 535, analysis of tail shell. Food Control. 148, 109646. doi: 10.1016/j.foodcont.2023.109646
736393. doi: 10.1016/j.aquaculture.2021.736393 Zhou, Q.-C., Zeng, W.-P., Wang, H.-L., Wang, T., Wang, Y.-L., and Xie, F.-J. (2012).
Yu, Y., Hu, L., Tian, D., Yu, Y., Lu, L., Zhang, J., et al. (2023). Toxicities of polystyrene Dietary arginine requirement of juvenile Pacific white shrimp, Litopenaeus vannamei.
microplastics (MPs) and hexabromocyclododecane (HBCD), alone or in combination, Aquaculture 364, 252–258. doi: 10.1016/j.aquaculture.2012.08.020

Frontiers in Marine Science 18 frontiersin.org