Discovery and characterization of small non-coding RNAs

in Vibrio cholerae that contribute to gene regulation during

infection

A thesis submitted by

Evan Bradley
In partial fulfillment of the requirements for the degree of

Doctor of Philosophy

In

Molecular Microbiology

TUFTS UNIVERSITY

Sackler School of Biomedical Sciences

August, 2012

Adviser: Andrew Camilli, Ph. D.

 UMI Number: 3624938

All rights reserved

INFORMATION TO ALL USERS

The quality of this reproduction is dependent upon the quality of the copy submitted.

In the unlikely event that the author did not send a complete manuscript
and there are missing pages, these will be noted. Also, if material had to be removed,
a note will indicate the deletion.

UMI 3624938
Published by ProQuest LLC (2014). Copyright in the Dissertation held by the Author.
Microform Edition © ProQuest LLC.
All rights reserved. This work is protected against
unauthorized copying under Title 17, United States Code

ProQuest LLC.
789 East Eisenhower Parkway
P.O. Box 1346
Ann Arbor, MI 48106 - 1346
Abstract
Small non-coding RNAs (sRNAs) are being increasingly recognized as critical

regulators of a wide variety of processes in bacteria. To investigate the contribution of

unknown sRNAs to virulence gene regulation in Vibrio cholerae, we undertook a screen

to identify previously uncharacterized sRNAs under the control of the major virulence

gene activator in V. cholerae, ToxT. Using a combination of direct sRNA cloning and

sequencing together with a genome-wide ToxT in vitro binding assay, we identified 18

putative ToxT-regulated sRNAs. Two of these ToxT regulated sRNAs were located

within the Vibrio Pathogenicity Island-1 (VPI-1), the genetic element that encodes ToxT

and the Toxin Co-regulated Pilus (TCP). We verified regulation of these sRNAs by ToxT

and showed that deletion of one of them, now designated TarB, caused a variable

colonization phenotype when competed against the parental strain in an infant mouse

model of V. cholerae infection. Infections progressing for 18 hours or less showed the

ΔtarB strain was out-competed by the wild type strain, while those carried out longer,

showed ΔtarB out-competing the wild type. Additionally, if inoculated from a resource

poor environment the ΔtarB strain also showed decreased colonization relative to wild

type. Using a bioinformatic approach, we identified that TarB-mediated regulation of the

gene tcpF was primarily responsible for the TarB mutant’s in vivo colonization

phenotype. Further investigation of genes regulated by TarB using genome-wide

transcriptional profiling of a TarB over-expressing strain revealed that TarB also directly

regulates genes involved in iron and amino acid uptake. We determined that TarB has a

repressive effect on many genes within the VPI-1, but has an activating effect on

i
tcpP/tcpH, encoding regulators upstream of ToxT. Taken together, the data suggest that

TarB plays an important role in regulating virulence and metabolic genes early after V.

cholerae infection, but that this repressive effect on virulence genes later in infection may

lead to reduced replication in vivo.

ii
Acknowledgments

I would like to acknowledge my adviser, Andy, who’s limitless enthusiasm and

optimism for this work and all the science that goes on in his lab is an inspiration,
especially in times when protocols aren’t working and the data yield conflicting results. I
would like to acknowledge postdocs in the lab, Revati Masilliamani and Ayman Ismail,
for giving freely of their time and expertise; their input into my science was critical to the
progress of this work. I’d like to thank my class and lab mate, EmilyKate McDonough,
for her input into my writing and figure design. We wrote a book chapter together and it
was a great experience.
Outside the lab, my mother and father, Linda and John Bradley, have always been
a great source of confidence and encouragement; they never doubted this day would
come, though I sometimes did. I am indebted to my friend and classmate, Nikolai
Schnitke. We’ve been in this together since college and I couldn’t have made it this far
without his support.
I would finally like to thank all my close friends in Boston, who were there for me
in the worst of times, and with whom I spend most of my free time chasing a plastic toy.

iii
Table of Contents

Chapter 1: Introduction

• The species Vibrio cholerae

• Cholera the disease, epidemiology and treatment

• Primary virulence factors

o Toxin Co-regulated Pilus

o Cholera Toxin

• Natural history of infection

o Initial attachment

o Replication and toxin elaboration

o Exit from the host

o New perspectives on the V. cholerae infectious cycle

• Persistence in the aquatic environment

• Regulation of virulence

o Factors upstream of ToxT

o ToxT, signal integration and mechanisms of action

o New perspectives for non-coding targets of ToxT

• General sRNA mediated regulation in bacterial

• sRNA mediated regulation of bacterial virulence

• Use of ToxT as a method of investigating the contribution of sRNAs to regulation

of virulence in V. cholerae

iv
Chapter 2: High throughput screens and discovery sRNAs regulated by ToxT

• Detection of putative ToxT-regulated sRNA transcripts

• Assessment of sRNA mutants in the infant mouse model of intestinal colonization

• ToxT binds in the TarB promoter region

• The tcpF mRNA is a target of the TarB sRNA

• TarB’s anti-colonization phenotype is time dependent

• Potential other ToxT-regulated sRNAs

• Discussion

Chapter 3: Investigating other upstream factors controlling expression of TarB.

• Introduction

• Upstream factors influencing TarB expression

o Anaerobic conditions

o Stationary phase growth

o LuxR quorum sensing system

• Analysis of in vivo expression of TarB using reporter fusion and quantitative RT-

PCR

• TarB is likely an Hfq independent sRNA

• Discussion

Chapter 4: Investigation other downstream genes of TarB and possible direct

targets

v
 • Introduction

• A genome wide search for other targets of TarB

• Determination of in vivo phenotypes of potential TarB targets

• TarB likely directly interacts with the mRNAs of VC1863 and VCA0686

• Discussion

Chapter 5: Discussion and future directions

• sRNAs as members of the ToxR regulons

• Understanding TarB’s role during infection

• Future directions

• Conclusion

Chapter 6: Materials and Methods

• Bacterial growth conditions

• Strain construction

• sRNA deep sequencing

• ToxT overexpression and purification

• Affinity purification of ToxT binding sequences

• Mobility shift assays

• AKI induction experiments

• Anaerobic growth

• Pond water incubations

• ToxT induction experiments

vi
 • Northern Blots

• qRT-PCR

• Western Blots

• Mouse infections

• Growth curves

• RNA-seq experiments

References

Appendix

• Table 1: Sequencing results, determination of sRNA clusters with relative

abundance between ToxT expressing and ToxT ΔHLH expressing libraries

• Table 2: ToxT in vitro DNA pulldown results

• Table 3: Genes differentially regulated at 15 minutes of TarB expression

• Table 4: Genes differentially regulated by 4 hours of TarB expression

vii
List of Figures

• Figure 1.1: A summary of physical environments in the host versus fresh water

• Figure 1.2 Diagrammatic representation of a trans-acting sRNA

• Figure 1.3: Summary of known inputs into the ToxR regulon

• Figure 1.4: Orientations and sequence of toxbox ToxT-binding DNA elements

• Figure 2.1: Affinity purification of ToxT binding sequences

• Figure 2.2: Northern blots of TarA and TarB

• Figure 2.3: Mouse infections performed with ΔsRNA and complemented strains

• Figure 2.4: In vitro analysis of the ΔtarB mutant and complemented strains

• Figure 2.5: Sequence of tarB and ToxT binding sites within promoter region

• Figure 2.6: TarB interaction with the 5’ UTR of tcpF

• Figure 2.7: Quantitation of TcpF-FLAG western blot

• Figure 2.8: The colonization phenotype of the ΔtarB mutant is time dependent

• Figure 2.9: A third potential ToxT-regulated sRNA

• Figure 3.1: Northern blots of TarB during AKI induction and growth in LB

• Figure 3.2: TarB expression under anaerobic conditions

• Figure 3.3: LuxO may contribute to the regulation of TarB under normal growth

conditions

• Figure 3.4: The RNA chaperone Hfq likely plays no role in TarB stability or in its

interaction with TcpF transcript.

• Figure 3.5: Expression of TcpF and TarB during pond water incubations

• Figure 3.6: In vivo qRT-PCR of the TarB reporter

• Figure 4.1: Determination of putative direct targets of TarB

viii
• Figure 4.2: TcpA expression is effected by TarB expression

• Figure 4.2: Growth curves of ΔVC1863 strains and TarB expressing strain

• Figure 4.4: mFold diagram of TarB binding to VC1863

• Figure 4.5: VCA0686 and VC1863 are likely direct targets of TarB

• Figure 5.1: A map of TarB’s downstream regulated genes

ix
List of Tables

• Table 1: Potential sRNAs with ToxT binding sites in cis

• Table 2: Putative targets of TarB determined by transcriptional profiling using

RNA-seq.

• Table 3: Genes within the Vibrio Pathogenicity Island 1 operon repressed by TarB

Expression

• Table 4: Primers used in this study

• Table 5: Barcoded adapters and sRNA cloning linkers for constructing Illumina

sRNA-seq libraries

• Table 6: Plasmids used in this study

• Table 7: Vibrio strains used in this study

x
Introduction

The Organism Vibrio cholerae

The bacterial species Vibrio cholerae is the causative agent of the disease Asiatic

Cholera [1], which is characterized by voluminous secretory diarrhea. V. cholerae is a

Gram-negative, flagellated bacterium that can be found free living in aquatic

environments. V. cholerae is a member of the family Vibrionaceae and shares some

characteristics with the family Enterobacteriaceae. The bacterium has a single polar,

sheathed flagellum that confers the characteristic rapid darting movement of the organism

upon viewing with a microscope. V. cholerae can be serologically subdivided into groups

(serogroups) by their structurally and antigenically diverse O antigen portion of the outer

membrane lipopolysaccharide (LPS). Approximately 206 serogroups of V. cholerae have

been identified to date. However, only the serogroups O1 and O139 are associated with

clinical cholera and have pandemic potential [2,3]. Of these two serogroups, only a subset

of strains have acquired the key virulence factors, Cholera Toxin (CT) and the Toxin-Co-

regulated Pilus (TCP), required to cause cholera. A lysogenic bacteriophage known as

CTXΦ contains the genes for CT as well as accessory toxins whose contribution to

pathogenesis is less clear [4,5]. While other virulence factors such as TCP are required by

the organism to colonize and cause disease, it is the elaboration of CT that is primarily

responsible for the voluminous secretory diarrhea that is characteristic of the disease.

Classical and El Tor Biotypes

1
 The world is currently in the 7th recorded world-wide cholera pandemic [4]. The

current strain causing infection is of the O1 serogroup, El Tor biotype, which first

emerged in the 1960s, replacing the original O1 classical biotype [6]. For reasons that are

not clear, the 7th pandemic is currently the longest running and this is hypothesized to be

due in part to differences in the El Tor biotype that allow it to persist in the environment

longer than the previous classical biotype. There are important differences with respect to

virulence between these two biotypes as well. Previous classical strains have been

associated with more severe disease than the current El Tor strains, which appear to more

frequently cause asymptomatic carriage of the organism [7]. A possible explanation for

this difference is lower expression and specific activity of a secreted neuraminidase,

NanH, in the El Tor compared to classical biotype strains. NanH is capable of cleaving

terminal sugars of glycolipids present in the membranes of intestinal epithelial cells,

revealing additional sites for CT binding, and hence more severe disease [8]. Although

NanH activity is important in pathogenesis in animal models [9], its possible that its

reduced activity contributing to asymptomatic spread of the disease provides more of an

advantage to spread of the organism.

The primary genetic differences between classical and El Tor biotypes mostly

relate to the presence of a number of new genomic islands in the latter [10]. Some of

these appear to be horizontally acquired elements [11] although the exact nature of these

elements is not known. Recent investigations into some genes present in these islands has

suggested that they may be involved in regulating chemotaxis [12], but mechanistic

explanations for how these genes contribute to El Tor’s ability to cause asymptomatic

2
infections or effectively persist in environments that have never had endemic V. cholerae

before [13], have yet to be determined.

There was likely be some genetic exchange between classical and El Tor strains

in recent history as variations in the amino acid sequence of CT and other virulence

factors characteristic of classical strains have occasionally been found in El Tor strains

isolated from outbreaks in Africa [7]. While there are many differences between these

two biotypes, the presence of the quintessential virulence factors and the way they are

regulated appear to be similar and in some cases identical [14,15,16,17]. Thus, the results

of much of the research conducted in vivo (in infection models) to elucidate virulence

factors are in general comparable across strains. Nevertheless, it is now thought that

classical biotype strains may now be extinct in endemic areas [7], showing the rapid rate

at which the population of disease-causing V. cholerae in the environment can change.

Cholera the Disease; Epidemiology and Treatment

Cholera is a human disease characterized by voluminous secretory diarrhea and

vomiting [2]. As a result, most patients present with symptoms of severe dehydration.

Cholera can be rapidly fatal if not treated promptly with intravenous fluids or oral

rehydration solution (ORT) [18]. Patients may loose fluid at rates up to 200 ml/kg/hr and

as much as 10% of their total body water over the course of the disease [2]. Despite this

severe secretory diarrhea, the intestinal epithelium shows minimal pathology and normal

physiological transporters of sodium and glucose remain intact [19], allowing for

effective absorption of fluids administered orally, so long as they contain the proper

electrolytes.

3
 Treatment with antibiotics can shorten the duration of the disease and may reduce

fluid loss by up to 50%, but it does not alter the natural course of infection and is

secondary to administration of ORT [2]. Many clinical isolates of V. cholerae are also

resistant to commonly used antibiotics such as tetracycline [2] and these resistances are

commonly encoded on mobile genetic elements, allowing resistance to spread rapidly

through a population [20]. Hence, treatment of the disease with antibiotics is restricted to

severe cases and those in which the resources for providing ORT are limited.

Attempts to develop effective vaccines against V. cholerae have been difficult

and, in general, do not result in greater then 50% protection for more then 3 years after

administration [2,6]. This may be due to the fact that these vaccines, which contain killed

whole cells with or without recombinant CT B-subunit, primarily generate an antibody

response against the carbohydrate LPS O antigen of V. cholerae that does not result in

lasting immunity [6,21]. In addition, there are two subtypes (serotypes) of V. cholerae O1

LPS (Inaba and Ogawa) that generate antibody responses that are partially specific and

thus not completely cross protective with each other and are not cross protective at all to

O139 strains [6,21]. With the emergence of the O139 serotype and the possibility of new

toxigenic strains arising rapidly by horizontal gene transfer, it may never be possible to

formulate a vaccine that will be universally protective [7]. Despite the fact that lasting

immunity has not been achieved, use of the current vaccine has been recommended in

areas in which active epidemics are occurring, such as the outbreak in Haiti in 2010

[22,23]. Vaccination may also be effective at reducing asymptomatic carriage of V.

cholerae, which has been documented as a possible mode of transmission [6]. However,

4
due to the lack of lasting immunity, prevention measures in endemic areas have focused

on improved sanitation and methods to prevent spread of V. cholerae.

Persistence in the environment

Toxigenic V. cholerae is known to be resident in estuary environments and is

thought to be a free living organism in those settings (not just in intermediate persisting

stage) [24,25]. In this setting, it its thought to be chitinolytic, living off the exoskeletons

of copepods or insect egg masses, and to be present within biofilms on surfaces

[25,26,27]. In endemic areas, cholera infections tend to peak during warmer

months,which may be associated with blooms of plankton and the copepods that feed on

them, that could serve as substrates for V. cholerae growth. Based on this knowledge, the

simple measure of filtering drinking water through a Sari cloth to remove copepods has

shown some efficacy in controlling infection, indicating that low cost, simple measures

can be effective at reducing disease burden so long as the locations to target are known

[2].

Outbreaks are thought to begin by the introduction of the organism into drinking

water sources by weather events or human-made changes in the environment [28,29].

Although the organism usually inhabits estuary environments, it is capable of persisting

in fresh water and water with growth-limiting concentrations of carbon or nitrogen

sources, possibly in a viable but non-culturable state (VBNC). Under such conditions, the

organism can cause disease in some animal models of infection and can be detected with

molecular methods, but cannot be cultured on standard laboratory media [25,27]. These

VBNC V. cholerae can be returned to a culturable state by passage in some animal

5
models [25,27], suggesting that animals could contribute to transition of V. cholerae from

estuary to drinking water sources, though V. cholerae has never been observed to cause

disease in animals other then humans. V. cholerae present in the aquatic environment is

also capable of becoming naturally competent for DNA transformation [30]. In this way,

non-toxigenic strains can acquire virulence factors and become novel pathogens to which

there is no pre-existing immunity. Alternatively, pathogenic strains can acquire a new

LPS O antigen to escape pre-existing immunity, and this is what appears to have occurred

with the emergence of the toxigenic O139 serogroup from what is believed to have been

an O1 El Tor parent strain [3,31]. This has serious implications for implementation of

vaccine or antibiotic treatment regimens as major antigens such as LPS and antibiotic

resistance genes could be exchanged in the environment.

The ability of V. cholerae to transition from a free-living organism to a parasitic

one and back again is of great public health interest because the process could enable the

development of cycle-specific targeted measures to prevent spread of V. cholerae. A

summary of the challenges the organism faces in each environment is shown in Figure

1.1, thus understanding how the organism copes with these different environments will be

critical to an effective public health strategy to eliminate the disease. The primary

virulence factors of the organism have been known for some time [5,32] and are

discussed in the next section. Increasing our knowledge of these factors may allow for

more effective vaccines to be developed or targeted treatment of the disease itself that

may not involve antibiotics.

6
Figure 1.1 A summary of differences in host and aquatic environment

Listed are differences in the freshwater environment and human rice water stool (RWS)

that the organism must manage in order to cause a productive infection

7
Virulence factors of V. cholerae

A large number of determinants of V. cholerae colonization have been identified

in animal models using biochemical and genetic techniques [8,33]. CT was originally

identified as the protein in cell-free supernatants that caused watery diarrhea in infant

rabbits [34,35]. The TCP was identified as a pilus that was produced coincidently with

CT under conditions in vitro that stimulate toxin production [8]. The TCP was

determined to be a colonization factor by transposon mutagenesis; with transposons

containing the alkaline phosphatase gene (TnPhoA); strains with TnPhoA insertions into

the major pilin gene, tcpA, showed a 100,000-fold drop in LD50 in infant mice [32].

Although the CT and TCP represent the primary virulence factors in V. cholerae, a large

number of accessory factors which aid in motility, attachment, growth, resistance to

stresses and other processes inside the host that have smaller contributions to virulence

have also been identified [36,37,38].

The TCP is a type 4b, bundle-forming pilus whose major structural subunit is

TcpA [39,40]. Type 4 pili are present in a large number of different pathogenic gram

negative bacteria and play varied roles in pathogenicity and other cellular processes, such

as competence and twitching motility. Most similar to the role of the TCP in V. cholerae

is the type 4, bundle-forming pilus (BFP) in enteropathogenic Escherichia coli (EPEC).

The BFP is important for bacterial cell-to-cell attachment and adherence to the intestinal

surface in the form of microcolonies [41]. This illustrates the importance of proteins that

mediate cell-to-cell adhesion in intestinal pathogens, possibly as a mechanism for

resisting shear force in the intestine. In V. cholerae, the pilus appears to play a similar

8
role in micro-colony formation on epithelial surfaces [42]. Similar to the BFP, the TCP is

encoded on a mobile genetic element, though essential functions of this element for

integration and excision appear to have been lost [43]. The TCP is also the surface

receptor for CTXΦ particles [43] that allows binding and infection with CTXΦ particles

[5]. While many environmental V. cholerae O1 isolates are TCP positive, some do not

contain CTXΦ, and thus do not have pathogenic potential. However, laboratory

experiments suggest these strains could become lysogenized with the phage [44]. In

addition, V. cholerae can be transduced with phage during infection of the host intestine

[5], which has been used as a tool in the laboratory to investigate TCP expression in

animal models of infection [45]. This opens up the possibility that non-toxigenic strains

that are positive for the TCP could become converted to toxigenic strains during the

infection process, revealing another mechanism by which new variations of pathogenic V.

cholerae could emerge.

TcpF is another essential factor that is part of the TCP biogenesis operon and

requires the pilus for secretion, but is not, strictly speaking, part of the pilus [42,46]. This

protein is secreted in vitro during virulence factor stimulating conditions, and secretion

deficient mutants of the protein do not complement the colonization defect of a ΔtcpF

mutant in vivo [47]. TcpF is also present in TCP positive environmental isolates of V.

cholerae, however these environmental versions of the protein do not always complement

a TcpF null strain in vivo, suggesting an ancestral non-pathogenic role for this protein

[47]. Although this protein is required for virulence inside the host, it has no noticeable in

vitro phenotype and its function is unknown.

CT is an AB-type toxin that attaches to intestinal epithelial cells by binding to the

9
GM1 ganglioside lipid on intestinal epithelial cell surfaces. The A subunit of the toxin is

an ADP-ribosylating toxin which targets the Gαs-subunit of a stimulatory GTP-binding

regulatory protein. This modification results in activation of adenylate cyclase leading to

over-production of cAMP [48]. Which results in protein kinase A-mediated

phosphorylation of the CTFR [48]. This culminates in protein kinase A-mediated

phosphorylation of the CTFR luminal chloride channel that leads to efflux of chloride

ions and water into the lumen of the small intestine. It is this biochemical event that is

responsible for the voluminous diarrhea that is associated with cholera. Logically, the

main function of this toxin seems to be to generate fluid accumulation which the

organisms can use to disseminate, and V. cholerae deleted for the genes encoding CT do

not show colonization defects, at least in the suckling mouse model of colonization [33].

Interestingly, CT also appears to be expressed early in infection in animal models of

infection [21,49]; this is presumably when the organism is replicating rapidly, prior to

dissemination and release. A possible explanation for this conundrum is discussed below.

Although CT is the primary toxin responsible for the watery diarrhea

characteristic of cholera, toxigenic strains also carry accessory toxins which may

contribute to disease as revealed by the fact that volunteers inoculated with a ΔctxAB

strain of V. cholerae still developed diarrhea [8]. These toxins include the hemolysin-

cytolysin [50] encoded by the V. cholerae genome and the Ace [51] and Zot toxins

encoded along with CT on the CTXΦ phage. All of these toxins have been shown to

increase fluid accumulation in ligated rabbit ileal loops and disrupt cultured intestinal

epithelial layers, although by different mechanisms. The hemolysin-cytoloysin toxin is

directly cytolytic and can lead to hemorrhage in addition to fluid accumulation [50]. The

10
Zot toxin appears to alter intestinal epithelium by disrupting tight junctions (or the Zona

Occludens area) of epithelial cells, hence promoting efflux of fluid by disrupting the

barriers between cells [52]. The Ace toxin shows homology to eukaryotic ionphores, and

may lead directly to efflux of salts from epithelial cells, generating fluid flow in a similar

manner to CT [8]. Strains deleted for all of these toxins, including CT produced no

adverse reactions in volunteers, however, such strains showed reduced colonization. In

conclusion, these accessory toxins do appear to play a role in V. cholerae pathogensis and

colonization, but the nature of that role is not entirely clear [53].

Natural History of a Cholera infection

The natural history of a cholera infection has been broken down into three phases:

initial attachment, replication and toxin elaboration, and detachment and escape. Initial

attachment of the organisms to the intestinal epithelium is mediated by the N-acetyl

glucosamine binding protein, GbpA [36,54], which also allows the organisms to bind to

and grow on chitin ex vivo. Once in the small intestine, in vivo signals that include bile

salts, bicarbonate, temperature and pH lead to activation of the ToxR regulon [55,56].

How these signals result in virulence gene expression is discussed later. The primary

virulence factors of V. cholerae, CT and TCP, are under the control of this regulon and

appear to turned on early in infection [57,58].

Once V. cholerae has grown to high density in the small intestine, it begins a

down regulation of the primary virulence factors and expression genes necessary for

motility and survival outside of the host [49,58]. This has been termed “the mucosal

escape response” and is thought to be the genetic program for dissemination from the

11
host. The mechanism for down regulation of virulence factors remains unclear, but may

involve repression of virulence factors by the Pho regulon that is involved in phosphate

acquisition [45] and proteolysis of the major positive regulator of virulence, ToxT [59].

This other aspect of the mucosal escape program appears to be under the control of three

factors; the stationary phase sigma factor RpoS, the major quorum sensing regulator and

transcriptional repressor protein HapR (for hemaglutinin and protease repressor), and the

catabolite repression protein CRP [49,60,61]. The primary signals for this response are

thought to be the high density of bacteria present in the small intestine and nutrient

limitation, possibly of both phosphate and carbon. Genes expressed during this phase of

the infection appear to be important for migration of the bacteria away from the intestinal

border (motility) and for ex vivo survival, as genes for processes such as chitin utilization,

biofilm formation and iron uptake are upregulated later in infection [58].

The fluid generated during a V. cholerae infection is an isotonic transudate

created by the osmotic gradient generated by CT. This fluid visually resembles water

after it has been used to cook rice, and is hence commonly called rice water stool or

RWS. V. cholerae within freshly passed RWS have a different transcriptional profile then

those isolated from late in animal models of infection. Most notably, chemotaxis genes

are upregulated late in rabbit-ileal loop infections, but repressed in RWS [49,62].

Bacteria in RWS are also hyperinfectious, being about 10-fold more virulent then in vitro

grown bacteria [62]. The regulators that result in the development of this state and the

signals that differ between human and animal models of infection that are responsible for

this difference are not yet known, but hyperinfectivity is hypothesized to be a major

contributor to epidemic spread of V. cholerae [63,64]. Although repression of chemotaxis

12
genes appears to be a contributor to the hyperinfectious state [65,66], the detailed

mechanisms of hyperinfectivity are currently under investigation.

Recently, confocal microscopy has allowed for analysis of subpopulations of

bacteria during animal models of infection. This has led to the hypothesis that there is

one subpopulation of bacteria that expresses high levels of the primary virulence factors

TCP and CT, while another subpopulation prepares for exit from the host by upregulation

motility and ex vivo survival genes [60]. This may explain some data from population

averages showing that CT is expressed during the early stage of infection but not late in

the infection in the shed bacteria: one population of bacteria, those bound to the

epithelium, may be generating fluid flux from the small intestine to aid in the release of

the population that is changing its transcriptional profile to prepare for survival outside of

the host. Thus, early during infection, the former subpopulation (high CT and TCP

expressors) would dominate, while late in infection, the latter subpopulation (motility and

ex vivo survival gene expressers) would dominate. It is not yet clear what causes the

emergence of subpopulations of bacteria during infection, or what role it has in the

infectious process, but it will no doubt change our current models of a human cholera

infection.

From the standpoint of prevention of cholera in the future, knowledge about the

factors involved and the potential in vivo signals that regulate the transition from free-

living organism to pathogen could help determine targeted measures to prevent the

disease in the first place. A brief review of the current knowledge about these factors and

signals as well as gaps in that knowledge is presented in the next section.

13
Transition of V. cholerae from free-living organism to pathogen

The bicistronic operon encoding CT, ctxAB, is co-regulated with genes located in

the Vibrio pathogenicity island-1 (VPI-1). The VPI-1 carries some of the hallmarks of a

horizontally transmissible element, and may have been at one time, but reports of its

ability to be transmitted as an independent element have not been reproduced [11,43,67].

This co-regulation is carried out primarily by the protein ToxT, a member of the AraC

family of transcriptional regulators [68,69]. ToxT activates expression of CT and the

toxin co-regulated pilus (tcp) operon. Both toxT and the tcp genes are located within VPI-

1. The collection of genes known to be involved in regulating virulence in V. cholerae is

known as the ToxR regulon [56] and a summary of the factors known to interact with this

regulon is shown in Figure 1.3. Upstream of toxT are the transcription factor

heterodimers ToxR/S and TcpP/H. These complexes reside within the inner membrane.

The toxRS genes are located in the ancestral Vibrio genome and are expressed

constitutively [70]. They function to regulate outer membrane protein expression in both

V. cholerae and non-pathogenic Vibrio species [56]. Although tcpPH is located within

the VPI-1, the Aph proteins and CRP [71], which are located outside the VPI-1, control

its transcription. This serves to integrate information about pH [72] and carbon

availability, respectively, into control of virulence factor expression, although the reasons

for this regulation and their consequences remain unclear.

ToxR/S and TcpP/H directly bind as a complex to the promoter of toxT to activate

transcription [73,74]. ToxR/S and TcpP/H likely sense some signals in the periplasm

and/or inner membrane to initiate binding and transcription from the toxT promoter but

the nature of this signal in vivo is not known [55]. The in vitro factors which result in

14
toxT transcription differ between the classical and El Tor biotype strains and it is not

clear how these differences influence infection [55]. Here, I discuss findings relevant to

the El Tor biotype as it is the currently circulating pandemic biotype. Factors determined

in vitro, which contribute to activation of the ToxR regulon include low pH, static growth

(possibly by generating microaerobic culture conditions [72,75]), and 37oC temperature

[70,76]. The primary result of sensing these signals in vitro appears to be initiation of

tcpPH transcription [14]. Addition of bicarbonate to the culture media also enhances

toxin production, but this appears to act at the level of ToxT activity (discussed later), not

directly contributing to tcpPH transcription [77].

There are also factors upstream of TcpP/H that contribute to virulence gene

regulation by repressing production of TcpP/H in response to conditions that may be

present in vivo or in the environment. Phosphate limitation, which likely occurs in the

aquatic environment and possibly late in the course of a cholera infection, prevents

transcription of tcpPH via the action of the positive regulator of phosphate uptake, PhoB

[45]. A high population density of V. cholerae as sensed by the Lux and Cqs quorum

sensing systems leads to production of HapR that represses production of AphA

[61,78,79]. It is possible that dense populations in the form of biofilms occurs in the

environment and that inhibition of virulence may be beneficial in that case [80], but this

may also function in vivo late in infection as discussed above. The CRP protein is also

known to interact directly with the tcpP promoter by binding to it and preventing binding

of AphA in a cAMP-dependent manner [81]. This indicates that carbon-limiting

conditions, likely present in the aquatic environment and possibly late in a cholera

infection, contributes to the repression of virulence [82].

15
 The bacterial second messenger molecule cyclic di-GMP has also been shown to

contribute to virulence gene expression, likely at a level above ToxT production [83],

although exactly where this molecule acts is currently unknown. Increased concentrations

of cyclic di-GMP in bacteria have been generally associated with a transition from a

planktonic, motile lifestyle to a sessile one [84]. In V. cholerae specifically, increased

cyclic di-GMP concentrations have been correlated with enhanced biofilm formation,

inhibited flagellar biosynthesis, inhibited chemotaxis [85], and importantly, inhibition of

virulence factors, exactly where this molecule acts is currently uknown although it is

hypothesized to occur via proteins that bind cyclic di-GMP known ans plz domain

proteins, however, specific mechanisms have remained elusive

Among factors that impact cyclic di-GMP concentrations in cells are quorum

sensing via HapR. In addition to affecting transcription of tcpP/H via its repression of

aphA, HapR controls a number of genes that contribute to production of cyclic di-GMP

[80]. In addition, AphA controls expression of factors regulating cyclic di-GMP

expression, adding another level of regulation to the system [84]. The in vivo induced

three-component system VieSAB also contributes to the cyclic di-GMP pool, likely

during infection [83,86]. However, it should be mentioned that the VieSAB system

appears to be more relevant in the classical V. cholerae biotype, and what this system

senses and how it contributes to the expression of virulence factors in vivo is currently

under investigation.

In addition to initiating transcription of toxT, ToxR/S also represses transcription

of ompT and enhances transcription of ompU [56]. V. cholerae expressing OmpT are

more susceptible to the anti-microbial action of bile salts, and those expressing OmpU

16
show enhanced resistance to bile salts as well as other environmental stresses [87,88]. It

is thought that this regulation of OMPs may allow specific signals to enter into the cell

that then trigger virulence gene induction by stimulating toxT transcription through

ToxR/S and TcpP/H [87]. However, it was demonstrated that these OMPs are dispensable

for colonization, at least in the infant mouse model of V. cholerae colonization [88],

indicating that they are not directly involved in the pathogenic process nor are they

required for virulence gene induction.

17
Figure 1.3: Summary of known inputs affecting expression of the ToxR regulons

While the primary in vivo signals that activate transcription of toxT through TcpP/H and

ToxR/S have yet to be determined, many inputs into this regulon have been identified in

vitro. Both carbon and phosphate limitation have been shown to repress transcription of

tcpP/H via direct promoter binding of cRP-cAMP and PhoB, respectively. The AphA

protein is required for transcription of tcpP/H and its activity is enhanced by low pH and

low O2 conditions, but HapR inhibits production of this protein at high cell density. Once

produced, ToxT stimulates transcription of the TCP biogenesis operon including the toxT

gene at the end of the operon, CT genes, as well as sRNA targets, the exact number and

nature of which remain to be determined. The activity of the ToxT protein itself can be

inhibited by free fatty acids and bile salts and activated by bicarbonate.

18
 Once the ToxT protein is produced, it stimulates transcription of the ctx and tcp

operons by binding to upstream regions within the promoters of these genes, known as

toxboxes [89], leading to production of V. cholerae’s primary virulence factors. The

toxbox DNA element can be present in different copy number and orientation and thus

ToxT displays some flexibility in its ability to bind these different toxbox configurations

[90,91]. The different known orientations of toxboxes as well as a consensus binding

sequence determined by two different methods [89,92] are included in Figure 1.4.

Although the exact mechanism by which ToxT activates transcription of downstream

genes is not known, it is suspected to interact with the alpha subunit of RNA polymerase

to recruit it to promoters [93]. ToxT may also relieve repression of virulence gene

promoters by displacing the nucleoid protein, Hns [94]. The Hns protein is a DNA

binding protein that seems to bind somewhat non-specifically to low GC content regions

and repress transcription of a number of genes [95]. Though primarily studied in other

organisms, it appears to have an analogous function in V. cholerae. The ToxT protein

itself appears to also integrate information about the environment into its activity [93].

The protein directly binds unsaturated fatty acids, which inhibit its ability to bind DNA

[96]. ToxT activity is also inhibited by temperature and bile salts [93] and activated by

the presence of bicarbonate [77], though how these factors interact with the protein

directly is not known. Dimerization of ToxT also appears to be critical for its activity

[97], which is hypothesized to occur due to the tandem arrangement of most toxboxes;

however, dimerization is not required for ToxT’s ability to bind DNA [98].

ToxT activates additional genes within the VPI-1 by similar mechanisms. These

other genes, known as the accessory colonization factor or acf genes, do not have known

19
functions, but were determined by transposon mutagenesis to be important for

colonization of the small intestine of infant mice [38,99]. Besides ctxAB, ToxT also

regulates additional genes outside the VPI-1, including the repression of genes encoding

the mannose-sensitive hemagglutanin (MSH) pilus, an anti-colonization factor [98]. In

this case, it appears that the binding of ToxT to the toxboxes located in the MSH pilus

operon interferes with transcription, rather than stimulates it, opening up a new

mechanism of ToxT mediated regulation.

The data suggest that regulatory targets of ToxT, be they repressed or activated,

are related to the virulent lifestyle of the organism, and by learning what other possible

downstream targets of ToxT exist, we can gain insight into how V. cholerae causes the

disease cholera. While many of the protein coding target genes of ToxT are known [37]

or can be inferred from microarrays [60], small non-coding RNA (sRNA) genes that play

important regulatory roles, and mechanisms of their regulation by ToxT remain to be

investigated fully. These putative additional downstream sRNA genes may be able to

teach us more about the environment the organism encounters in the human gut and the

processes that are essential for its survival there, which can help target efforts to disrupt

those processes and hopefully shorten the natural history of cholera in a patient. A

discussion of how sRNAs encoded in bacterial genomes carry out regulation, as well as

specific examples in V. cholerae and other organisms of how sRNAs contribute to

virulence is included below.

20
Figure 1.4: Orientation and sequence of toxbox ToxT-binding DNA elements

Panel A shows the variety of orientations of ToxT binding sequences relative to the

promoters of genes it activates transcription of. Because of the variety of orientations and

copy number of these sequences, it is likely that the ToxT protein has some flexibility in

its ability to bind DNA and activate transcription of downstream genes. Different

orientations of toxboxes may relate to different mechanisms of action (e.g. stimulation of

transcription as opposed to displacing repressive factors). Panel A shows the ToxT

binding sites in the promoters of the two established ToxT-regulated sRNAs. They show

similar toxbox orientations to tcpA, but other ToxT regulated sRNAs with different

orientations may exist. Panel C shows the ToxT binding sequence as determined by in

vitro DNA binding (pulldown) or exhaustive mutagenesis of the tcpA promoter

(canonical)

21
Small RNAs in bacterial gene regulation

Recent publications have demonstrated that bacterial genomes encode a large

number of sRNAs, that play key roles in regulating a wide variety of cellular processes.

Small RNAs were originally discovered in regulation of plasmid genes and first noted in

the plasmid ColE1, and as regulators of transposases in several transposons. sRNAs,

which are generally between 50-300 nucleotides long, typically do not code for proteins

and most often act via base-pairing interactions with their targets [100]. Small RNAs

have long been known to regulate plasmid maintenance and toxin-anti-toxin systems

[101] but have more recently been shown to be wide-spread and to be key regulators of

many important processes in bacteria. These include outer membrane protein (OMP)

expression [102], quorum sensing [103] and virulence [104,105]. Their role(s) in many of

these processes has been under-appreciated until recently because the genes encoding

sRNAs are small enough to be missed by transposon mutagenesis screens, and

disruptions by transposons may have been disregarded because of their non-coding

nature. However, the development of high throughput massively parallel sequencing

systems such as 454 pyrosequencing and the Illumina Genome Analyzer have allowed

characterization of sRNAs present in everything from cancer cells to fungi to bacteria.

Many early described sRNAs were determined to be upregluated under stressful

conditions, such as when various nutrients are limiting [106] or low pH [107]. As

regulators, sRNAs have properties that make them particularly useful under stressful

conditions where rapid changes in gene expression are advantageous [106]. Not needing

to be translated, they can act more quickly then protein regulators. Additionally, sRNAs

22
can act on existing mRNAs by either inhibiting or enhancing translation. In this way they

can change protein expression profiles without the time it takes to alter transcription or

degredation of mRNAs.

The first sRNAs to be characterized were encoded in cis and transcribed from the

opposite strand as their targets and thus the regulation was carried out by relatively large

stretches of perfect complementarity with their targets [108,109]. These cis-acting sRNAs

most likely regulate a single cis target. Many early described sRNAs were determined to

be upregulated under stressful conditions, such as nutrient limitation [106] or low pH

[107]. As regulators, sRNAs have properties that make them particularly useful as

regulators under stressful conditions where rapid changes in gene expression are

advantageous [106]. Not needing to be transcribed, then translated, they can act more

quickly then protein regulators.

A more recently discovered class of sRNAs act in trans and carry out regulation

often with imperfect complementarity to their targets [108]. I will focus on this class

more extensively. The imperfect complementarity allows for regulation of multiple

targets by a single sRNA [110,111]. This class of sRNAs most frequently works in

conjunction with the RNA chaperone, Hfq, which can enhance these imperfect base-

pairing interactions between sRNAs and mRNA targets [112]. The Hfq protein was

originally discovered as a replication factor for the Q-beta RNA phage [113], but it has

recently been appreciated that it is involved in most sRNA-mediated gene regulation and

RNA metabolism in general.

These trans-acting sRNAs are most frequently described as being transcribed

from intergenic regions, although this may be a bias of researchers as quite a few putative

23
sRNAs appear to be transcribed from areas within open reading frames [114]. Trans-

acting sRNAs, generally speaking, have a modular architecture consisting of a 5’ seed

region important for interacting with targets, an Hfq binding site, and a Rho-independent

terminator [115]. A diagram of the typical structure of trans-acting sRNAs is shown in

Figure 1.2. Studies have shown that these domains can be swapped; the seed region of

one sRNA, when replaced with another, can re-direct that sRNA to a new target [116].

Trans acting sRNAs in bacteria have been shown to function via a variety of

mechanisms. The most frequently observed mechanism of regulation is via the sRNA

duplexing within the 5’ untranslated region (UTR) of an mRNA and blocking the

ribosomal binding site leading to prevention of translation. In some messages 5’ UTRs

form structures that occlude ribosome binding and require pairing with sRNAs to disrupt

this structure and allow the message to be translated [103,117]. Hence the same basic

mechanism of sRNA-mRNA interaction can either lead to inhibition of translation of that

mRNA or stimulation of translation. Small RNAs can also pair in other regions of the

mRNA. For example, the GadY sRNA of Salmonella pairs with the 3’ end of a message

and enhances its stability [107]. Another possibility is that sRNAs may interact with the

coding region of mRNAs. In one documented example of this, an sRNA, which

interacted with the coding sequence of an mRNA, enhanced degradation of the mRNA

but not its translation efficiency [118]. Other possibilities exist for mechanisms of sRNA-

mediated gene regulation and it is clear that some sRNAs can make large contributions to

global transcriptional regulation [119]. There may be additional ways in which sRNAs

can affect gene expression that have yet to be described.

24
 Figure 1.2 Diagrammatic representation of a trans-acting sRNA

Shown is the typical architecture of a trans-acting sRNA. The seed region in the

5’ end of the molecule mediates base-pairing and target specificity. 3’ to that is typically

a binding site for the RNA chaperone Hfq, this is usually an AU rich sequence. At the 3’

end of the molecule many sRNAs have a Rho-independent terminator that consists of a

stem-loop structure followed by a U rich tail.

25
 While direct base-pairing with targets is the most frequent mode of sRNA

regulation, some sRNAs act primarily through proteins to mediate regulation. The

Carbon Storage Regulator system (Csr) consists of the RNA-binding protein CsrA and

three sRNAs that inhibit its function (CsrB-D) [120]. The CsrA protein influences a wide

variety of functions in different bacteria [121,122,123] and it does this primarily by

binding to a UACARGGAUGU sequence motif on mRNAs and affecting their stability

and translation efficiency [120]. The Csr sRNAs contain repeats of this sequence motif to

titrate CsrA away from its targets [124].

An example of an sRNA which directly controls translation is the 6s RNA that

has been observed to regulate transcription from sigma70 promoters in late stationary

phase [125]. The 6s RNA accomplishes this by forming a sequence mimic of sigma70

promoters and competing for binding of RNA polymerase. The Csr sRNAs and 6s RNA

exemplify a common theme in which sRNAs serve as sequence mimics of the proteins’

other targets. However, this theme is not universal. There is an example of a sRNA that

functions as an allosteric regulator of a protein, which is not usually involved in RNA

binding. The sRNA Rcd from the ColE1 plasmid, interacts with a cellular tryptophanase

to inhibit growth to allow plasmid segregation [126]. It is possible that other sRNAs can

interact directly with proteins, which do not usually bind nucleic acids, to modulate there

activity.

Much of the regulation carried out by sRNAs via mRNA-sRNA interaction occurs

in conjunction with Hfq, a member of the Sm family of RNA binding proteins which

includes such diverse homologues as the snRP proteins that carry out splicing in

eukaryotes [112,127]. Hfq has homologues that are widely, though not ubiquitously

26
found in bacterial and archeal species [128]. Hfq is a hexameric protein that binds to AU-

rich regions of sRNAs [129] and appears to enhance stability of sRNAs and can facilitate

interactions between sRNAs and mRNAs [127,130]. Hfq is central to many regulatory

processes involving sRNA-mediated regulation and has been the focus of many sRNA

discovery experiments which used immunoprecipitation of Hfq to “pull down” sRNAs

for analysis [131,132]. To the best of our knowledge, no attempt to analyze the total

number of sRNAs within V. cholerae that bind to Hfq has been undertaken, however,

there is data that hints at the importance of sRNA-Hfq-mediated regulation to the

virulence of V. cholerae. Deletion of hfq disrupts virulence [133], although it does appear

to have pleitropic affects on the physiology of the organism. Because Hfq is central to the

activity of many different sRNAs, and since it acts stochiometrically with sRNAs rather

then catalytically, it can become a limiting factor when sRNAs are expressed to high

levels either under certain stress conditions or artificially by inducible expression systems

[134]. This may have implications for sRNA functions physiologically, but certainly has

implication for research involving the over-expression of Hfq-dependent sRNAs.

Hfq in conjunction with ribonucleases can contribute to sRNA-mediated

regulation. Some sRNAs also require processing by ribonucleases to be active [109,135].

In addition, sRNAs in conjunction with Hfq can stimulate degradation of paired mRNAs

by recruitment of poly-adenylation machinery or ribonucleases [109,112]. Research done

with an sRNA that inhibits translation by pairing with and blocking the ribosomal

binding site of an mRNA suggests that inhibition of translation may be the primary

activity of that sRNA and can occur without protein partners [130,136], indicating that

recruitment of degradation machinery may be a secondary activity of inhibitory sRNAs.

27
 Pathogens are frequently described as needing to survive stressful conditions

related to the natural defenses of the host in order to colonize or cause disease. In this

way, it seems logical that the same quick response time afforded by sRNAs would be

advantageous during pathogenesis. Certainly V. cholerae must survive stressful

conditions such as the gastric acid barrier of the stomach to cause infection [8], but what

are the direct connections between the virulence regulons and sRNAs? Documented

connections between sRNA-mediated gene regulation and virulence are discussed below,

although it is clear that we do not currently understand the full picture. Nevertheless,

improved tools and sequencing technologies can help to assess the role of sRNAs in the

regulation of virulence factors in V. cholerae [114].

Small RNA-mediated gene regulation and connections to virulence

It appears that almost any regulon in bacteria, when examined thoroughly, reveals

sRNA members, and virulence regulons appear to be no exception. Recent research has

revealed sRNA components of the virulence regulons in other organisms, such as

Salmonella enterica serovar Typhimurium [137], Listeria monocytogenes [105] and

Staphylococcus aureus [137,138,139] (though the S. aureus RNAIII, which acts in some

ways as a sRNA, is unusually large).

In Salmonella many sRNAs involved in virulence and other gene regulation are

part of Salmonella Pathogenicity Islands (SPIs) that encode systems for bacterial invasion

and intracellular persistence [140,141,142]. Small RNAs encoded by the SPI-1

pathogenicity island are involved in both regulating the factors directly responsible for

intracellular growth [140] as well as regulating elements of the core genome [142]. In V.

28
cholerae, sRNAs have been shown to be involved in the regulation of virulence factors,

but also outer membrane proteins (OMPs) important for the general physiology of the

organism [111,143]. Recently, sRNAs that are part of the VPI-1 have been discovered

and characterized; one sRNA regulates a glucose-specific phosphotransferase (PTS)

[92,144]. This is interesting given that these Pathogenicity islands are thought to be

horizontally transmitted elements. Between V. cholerae and Salmonella, it appears that

sRNAs may be a key way that these elements interact with the core genomes of the host.

It is also logical that they are involved in the virulent lifestyle of the organisms, as these

elements are key to what makes these bacteria pathogens.

In L. monocytogenes, an sRNA involved in regulating virulence is also a sensor of

S-adenosyl methionine (SAM) [105]. The sRNA, located upstream of the SAM

biosynthetic operon, is part of the message that encodes the SAM biosynthetic proteins.

In the presence of SAM, this sequence folds to form a transcriptional terminator, leading

to the generation of an sRNA that serves to repress expression of the positive regulator of

virulence, the transcription factor PrfA. In the absence of SAM, this sequence does not

fold to form a terminator but instead allows the expression of SAM biosynthesis genes

downstream. Hence, virulence genes become activated in the presence of SAM. This

novel dual acting sRNA/Riboswitch opens up new possibilities for sRNA-mediated

regulation and shows how sensing of available metabolites may be integrated into

virulence gene regulation through the action of sRNAs.

In S. aureus, non-coding RNA-mediated regulation of major virulence

determinants has been well established for many years in the form of RNA-III. The

production of this RNA is controlled by the quorum sensing system that stimulates the

29
transcription of RNA-III. RNA-III, in addition to encoding a small open reading frame

(ORF), acts on mRNAs of S. aureus surface proteins and the mRNA of the major

transcriptional repressor protein of toxin production, Rot [138,145]. It does this through

interactions of the mRNAs of these proteins with unpaired loops in the structure of RNA-

III [138]. Although Hfq is implicated in the pathogenesis of S. aureus, it does not appear

to be critical for this interaction [146]. The S. aureus hfq mutant shows a variety of

phenotypes, but not gene expression changes related to regulation by RNA-III. Although

the hfq mutant showed reduced virulence, it is unclear what direct role Hfq-dependent

sRNAs have in regulating virulence in S. aureus [147].

In V. cholerae, there appears to be at least one example of an sRNA having a

direct effect on regulation of genes involved in pathogenesis. The sRNA VrrA (Vibrio

regulator RNA of OmpA) appears to pair with and inhibit translation of tcpA mRNA, the

major pilin subunit of the TCP [143]. A knock out of this sRNA results in an increased

colonization phenotype, presumably because of the release of this negative regulation,

but the expression of this sRNA does not appear to be dependent on any members of the

ToxR-regulon.

Small RNAs involved in virulence gene regulation do not appear to be unique as

far as their mechanisms of regulation, but seem to act in the same ways as previously

discovered sRNAs involved in physiologic processes. Thus, general principles learned

from these earlier studied sRNAs are applicable to studying this emerging class of

sRNAs. In the same vein, the genes that encode sRNAs have many similarities to genes

encoding proteins: their promoters and transcriptional terminators share the same

elements as those flanking OFRs and therefore likely share similar mechanisms of

30
transcriptional control [126]. Given this, it has been shown that the same factors, which

can upregulate the expression of ORFs, can also activate the transcription of sRNAs.

Many sRNAs are upregulated during stress conditions, some of these sRNAs are

stimulated by alternative sigma factors, which also activate genes involved in survival in

response to stress. The MicA sRNA in Salmonella and VrrA sRNA in V. cholerae are

examples of these [143,148],

Utilization of ToxT to investigate sRNA contributions to gene regulation during

infection

Given the existing knowledge about the regulation of sRNA genes, and the fact

that ToxT plays a central role in virulence regulation in V. cholerae, we hypothesized that

we could use ToxT as a tool to investigate sRNAs responsible for virulence gene

regulation. ToxT could directly affect the expression of sRNAs by binding in their

promoter region and stimulating transcription [149], repressing transcription [98], or

leading to anti-repression [150]. Small RNAs regulated by ToxT in any of these ways are

likely to be linked to regulation that is important to the infectious process. Determining

the targets of this class of sRNAs will therefore provide relevant insight into dynamic

gene expression inside the small intestine.

In the transition of V. cholerae to a virulent lifestyle from a free living one,

sRNAs would have the advantage of being regulators that do not need to be translated

before becoming active, so they can act quickly to silence or enhance the expression of

existing mRNAs [108,112]. By discovering sRNAs that are controlled by ToxT, and what

the targets of those sRNAs might be, we can therefore learn about processes that are

31
critical for rapid control of gene expression during the disease process. One sRNA

regulated by ToxT has already been discovered, which was independently co-discovered

by me as described in this thesis, based on the presence of an “orphan” toxbox within the

tcp region [144]. This sRNA negatively regulates a glucose-specific PTS, which has led

to the important insight that glucose is likely not a sugar that V. cholerae is reliant upon

for growth during the infectious process. The discovery of this sRNA opens up the

possibility that other sRNAs involved in virulence or physiology during infection may be

downstream of ToxT.

32
Chapter 2. High throughput screens and discovery of

sRNAs regulated by ToxT

Portions of this chapter were published as:

Bradley, E. S., K. Bodi, A. M. Ismail & A. Camilli, (2011) A genome-wide approach to

discovery of small RNAs involved in regulation of virulence in Vibrio cholerae.

PLoS pathogens 7: e1002126.

Acknowledgements

Protein purifications were carried out in conjunction with Ayman Ismail who contributed

the protocol for generating the tagged proteins and purifying the tagged proteins. Scripts

for analyzing the high-throughput sequencing data to determine sRNA abundance and

clustering were performed by Kip Bodi. Kip Bodi also performed analysis of ToxT in

vitro pulldown libraries for enriched sequences. All high-throughput sequencing was

performed by the Tufts University Genomics Core Facility. Bharthi Patimalla aided in

animal experiments to measure the in vivo competitive index of various strains. All other

experiments were performed by Evan Bradley.

Detection of putative ToxT-regulated sRNA transcripts

We used sRNA-seq [15], which is a method of direct cloning and deep

33
sequencing of RNA transcripts 50-250 nucleotides in length [114], to compare a culture

in which ToxT or an inactive version missing the helix-loop-helix DNA binding domain

(ΔHLH) [57] was expressed from an arabinose inducible promoter on a plasmid (pToxT

or pToxTΔHLH, respectively). The highly abundant 5S rRNA and tRNAs present in this

size range were depleted prior to sequencing as described [15]. After sequencing we

removed residual tRNA and rRNA reads from the data set and aligned the remaining

reads to the V. cholerae O1 El Tor strain N16916 genome. The number of reads of each

unique transcript in each library was normalized to the number of reads of the control,

MtlS, an abundant sRNA that controls expression of a mannitol transport system [114]

and that does not vary between the conditions tested here (data not shown). A total of

14,578 unique sequences were identified between the two libraries, of which 13,309 were

present in only one library or the other. Many sequences not shared between the libraries

were very low in abundance and may represent products of random RNA degradation

either in vivo or during preparation of the libraries. The position of all reads aligned to the

N16916 genome and their relative abundances in the two libraries is shown in Table 3.

The short sequencing reads were organized into clusters to provide an approximation of

each putative sRNA sequence to allow for variations in the start and stop of sequenced

sRNAs which may be due to biological variation or variation introduced during library

preparation. Many of the 1,269 clusters shared between the libraries had large variations

in abundance between the libraries. While this may reflect the true difference in the

sRNA transcriptome between these two strains, to help us narrow the list of potential

sRNAs we sought a method to determine the subset of sRNAs that was directly regulated

by ToxT.

34
 Because sRNA promoters share many characteristics with ORF promoters, it

seemed reasonable that any sRNA directly controlled by ToxT would have a ToxT

binding site in cis. To investigate this we undertook a genome-wide ToxT pulldown of

genomic DNA fragments 200-500 bp in length that were modified to allow for

subsequent deep sequencing (Figure 2.1 A and 3B), similar to an approach taken with the

transcription factor CodY from S. aureus [151]. Using a cut off of 3-fold enrichment in

pulldown libraries over input libraries, we identified 199 putative binding sites of which

67 overlapped between technical replicates and likely represented the most specific sites

(Table S2). A DNA binding motif generated from the 67 enriched sites was a close,

though not identical, match to the canonical toxbox [89] (figure 2.1, panel C). Of the

overall 199 putative binding sites, 64 mapped to the VPI-1, which is consistent with the

fact that this locus contains the majority of ToxT-regulated genes. Most, but not all

previously described ToxT-binding sites were present in the pulldown library; notably

absent were sites within the tcpA promoter [89] and sites within the MSH pilus operon

[98].

35
Figure 2.1 Affinity purification of ToxT binding sequences

A) Experimental outline of the ToxT in vitro DNA pulldown. Because the purification

procedure left a residual amount of TEV protease in the His-ToxT prep, a negative

control pulldown was performed with 6His-TEV protease. B) Amplification of resulting

libraries after pulldowns shows that in the presence of ToxT (libraries BC1 and BC2),

DNA was eluted from the column, whereas with TEV bound to the column instead, no

DNA is detected after 10 cycles of amplification (BC3). C) The resulting binding motif

predicted for ToxT present in 66 out of 67 pulldown sites with an E-value of 2.3e-14 as

36
analyzed by MEME software according to parameters detailed in Methods. The ToxT

binding motif predicted by pulldown is shown with the previously reported canonical

toxbox. Single letter codes are as follows; B=C/G/T, D=A/G/T, H=A/C/T, N=A /C/G/T,

R=A/G, W=A/T, Y=C/T.

37
 Cross-referencing the putative ToxT binding sites with ToxT-regulated sRNA

sequencing data yielded a collection of 18 potential sRNAs transcribed from intergenic

regions with cis ToxT binding sites. The locations of these pulldown sites, sRNA

transcripts and relative abundance between ToxT and ToxTΔHLH expressing strain

libraries are shown in Table 1. This analysis revealed two putative sRNAs within

intergenic regions in the VPI. To investigate whether these two sRNAs represented

genuine transcripts, we probed for each by Northern blot using total RNA from cultures

expressing ToxT or ToxTΔHLH. Both of these sRNAs are dramatically upregulated upon

expression of ToxT and both are present at the expected size predicted by the sRNA deep

sequencing experiment (Figure 2.2). One of these sRNAs was discovered independently

by another group and was named TarA [144] (for ToxT activated RNA A). The other, to

the best of our knowledge, remains uncharacterized. Since it also showed dramatic up

regulation upon expression of ToxT, and given its role in virulence (described below), we

named it TarB. Although some upregulation of TarB was seen at later time points in the

ΔHLH expressing strain, this is not likely to be due to residual activity of the ΔHLH

allele and is most likely due to the culture entering stationary phase as this appears to

upregulate TarB independently of ToxT (data shown later). Having now determined that

at least two ToxT-regulated sRNAs were present in the VPI, we set out to determine

whether they played detectable roles in the virulence of V. cholerae.

38
Table 1. Intergenic sRNAs with cis located ToxT binding sites.

Normalized

sRNA sequencing Normalized ToxT

Enriched pulldown read genome nearby ORF annotation; ToxTΔHLH library

genome coordinates coordinatesa ORFs sRNA annotation library readsa readsa

Start End Start End

VC0142/ hypothetical/

134659 134803 134505 134394 VC0143 hypothetical 155 375

alkaline serine

VC0157/ protease/glutamate

149092 149248 149280 149445 VC0158 racemase 0 413

transcriptional

regulator

(putative)/Zinc

VC0175/ binding domain

177452 177653 177267 177165 VC0176 protein 242 5630

hemolysin

VC0489/ (putative)/conserved

523047 523177 522904 522819 VC0490 hypothetical 786 167

VC0825/

889129 889314 888622 888550 VC0826 tcpI/tcpP; tarA 0 2182

putative

lipoprotein/phage

VC0845/ integrase

911227 911352 911310 911233 VC0846 (degenerative); tarB 2922 519

VC0971/ ligA DNA

1037594 1037784 1037758 1037862 VC0972 ligase/porin, putative 851 605

vicH DNA binding

VC1130/ protein/membrane

1198742 1198847 1199141 1199239 VC1131 binding protein 798 3

39
 (putative)

D-galactose or D-

glucose ABC

VC1328/ transporter, permease

1412924 1413078 1413070 1413198 VC1329 protein/hypothetical 0 257

PTS system, glucose-

specific IIBC

VC2013/ component/conserved

2168242 2168432 2168188 2168097 VC2014 hypothetical 1078 143

VC2278/ membrane protein,

2433764 2433903 2433569 2433387 VC2279 putative/pepD 38 10

conserved

VC2384/ hypothetical/DNA

2549682 2549799 2549443 2549565 VC2385 polymerase 3481 2463

conserved

VC2387/ hypothetical/

2552739 2553002 2553119 2553020 VC2388 hypothetical 0 71

tryptophanase

VCA0161/ tnaA/tryptophan leader

180027 180205 182477 182600 VCA0161 peptide tnaC 0 198

GMP reductase

VCA0197/ (guaC)/DNA methyl

214601 214731 214400 214531 VCA0198 transferase (putative) 264 205

conserved

VCA0546/ hypothetical/

485328 485491 485507 485625 VCA0547 hypothetical 0 525

hypothetical/cold

VCA0932/ shock domain family

885950 886158 885901 886039 VCA0933 protein 0 3654

VCA0934/ hypothetical/

886713 886820 893566 893461 VCA0935 hypothetical 1134 448

40
a
Overlapping clusters hypothesized to represent the same transcript were pooled to

determine putative starts and stops and normalized abundances. Normalized abundance

scores were rounded to the nearest whole number.

41
Figure 2.2 Northern blots of TarA and TarB.
32
P-UTP labeled riboprobes complementary to sRNAs were used to blot for the presence

of the expected sRNAs in total RNA isolated from cultures expressing ToxT or

ToxTΔHLH from plasmids. A) TarA is detected at the predicted molecular weight and is

present at high abundance within 20 minutes after induction by addition of arabinose,

which is absent in the transcriptionally inactive ΔHLH form of ToxT. B) TarB is also

present at the predicted size based on sequencing data and also shows dramatic

upregulation in the ToxT expressing strain but not the strain expressing inactive ΔHLH

ToxT.

42
Assessment of sRNA mutants in the infant mouse model of intestinal colonization

Deletion of each sRNA was constructed in the genome and the mutants were

tested in completion experimentally with the fully virulent parental strain carrying a

ΔlacZ marker. No significant difference in virulence was observed for the ΔtarA strain

either when competed against the parental strain or a strain harboring tarA (promoter and

toxboxes included) on a high-copy vector (Figure 2.3 panel A). It was previously reported

that a ΔtarA mutant had a decreased fitness relative to its parental strain [144], however,

those experiments were performed with a classical biotype strain of V. cholerae, and

hence regulation by TarA may be less critical or perhaps is masked in the current

pandemic El Tor biotype tested here.

In contrast,. the ΔtarB strain outcompetes the parental strain by a small but

statistically significant factor of 1.6 (Figure 2.3 panel A) suggesting TarB is a negative

regulator of virulence. The ΔtarB and complemented strains show no change in growth

rate or cell yield in Luria-Bertani (LB) broth or in a minimal medium, nor a change in

survival in pond water (Figure 2.4).

To see if the negative effect on virulence could be complemented in trans, we

competed a ΔtarB strain containing the sRNA with its own promoter cloned onto a low

copy plasmid (ptarB) against a ΔtarB strain carrying empty vector (pMMB). The ΔtarB

strain out-competed the complemented strain to an extent that exceeds out competition of

the parental strain (Figure 2.3 panel A), which may be due to overexpression of TarB

from ptarB. If expression of TarB is detrimental to colonization, as these data indicate,

the plasmid carrying TarB may be selected against during the infection. To investigate

this, small intestine homogenates of infant mice infected with a strain carrying ptarB

43
plasmid the were plated on LB agar and colonies were replica plated onto medium

containing ampicillin, which selects for colonies containing the plasmid. Consistent with

our hypothesis, the plasmid carrying TarB was lost more frequently than the empty

plasmid (Figure 2.3 panel B). This was not the case during growth in LB in the absence

of antibiotic selection (data not shown).

44
Figure 2.3: Mouse infections performed with ΔsRNA and complemented strains

A) Competitions performed with unmarked deletions of tarA and tarB against the

parental strain carrying a lacZ deletion. Competitive indices are reported as the ratio of

CFUs in the output adjusted for the input ratio. The ΔtarB strain shows enhancement of

colonization over the parental strain, but the ΔtarA strain shows no significant trend.

When tarA and tarB (promoters included) were cloned into complementation vectors and

the complemented strains were competed against deletion strains carrying vector alone,

the ΔtarB strain shows a more dramatic enhancement of colonization over the

complemented strain (median CI = 3.5), while the ΔtarA complemented strain shows a

slight but not significant advantage over the deletion strain (median CI=0.61; Wilcoxon

signed rank test on log transformed data). B) Output plates from the competitions in

panel A were replica plated onto plates containing ampicillin to assay for presence of the

plasmid. Replica plating shows that ptarB is lost 2.9x more frequently then the vector

alone (p<0.01, two sample T-test with Welch’s correction for unequal variance). C)

Single strain infections were performed with wildtype and ΔtarB mutants, results are

reported as the total CFUs estimated in small intestine homogenates of infected infant

mice, in single strain infections the ΔtarB mutant also shows an increased colonization

phenotype relative to wildtype (p=0.02 two sample t-test on log transformed data). D)

Competitions were carried out in mice after preincubation of the ΔtarB and parental

strains in pond water for 4, 6 and 24 h. The ΔtarB mutant preincubated for 4 h in pond

water has a fitness advantage over the parental strain, similar to competitions performed

without pond water preincubation. Competitions performed after 6 h of preincubation

show no significant trend. However, after 24 h of preincubation there is a reversal of the

45
above phenotype with the parental strain having a significant advantage over the ΔtarB

mutant (p < 0.05, Wilcoxon signed rank test on log transformed data). Importantly, these

strains do not show any difference in fitness during growth in LB after 24 h pond

incubation.

46
Figure 2.4: In vitro analysis of the ΔtarB mutant and complemented strains.

A) In vitro competitions in LB between the ΔtarB and parental strains show no difference

in fitness. In addition, the ΔtarB strain complemented with ptarB or containing empty

vector show no significant difference during growth in LB. The ΔtarB strain was also

47
competed against wild type for 24 h in pond water and again the ΔtarB strain showed no

significant difference in fitness (one sample t-test). B) In either LB or in M9 minimal

medium with glucose, the ΔtarB mutant showed no difference in growth rate when

compared to the parental strain. Shown is the median value of growth curves performed

in biological triplicate with each individual sample being analyzed in technical triplicate.

We also measured the growth rate of complemented strains (ΔtarB [pMMB] and ΔtarB

[ptarB]) in both LB and M9 minimal media and these also show no changes in growth

rate.

48
 For further confirmation of the hypercolonization phenotype of the ΔtarB mutant,

we performed single strain infections with the ΔtarB and wildtype strains (Figure 2.3C).

Total colonization in these two strains indicated that, as seen in competition experiments,

the ΔtarB mutant showed significant hypercolonization reflected by increased CFUs in

the output.

The out-competition phenotype of the ΔtarB strain in infant mice and the more

drastic attenuated phenotype of the complemented ΔtarB strain suggest that TarB is

deleterious to colonization of the small intestine. The model that TarB is positively

regulated by the master virulence gene activator ToxT, yet functions as a negative

regulator of virulence, is counterintuitive. To investigate this model further we performed

competitions after incubation of the competing strains for varying times in filter sterilized

pond water in an attempt to test the strains in a scenario more similar to a natural

infection. After 4 hours of incubation in pond water, the ΔtarB mutant retained its ability

to outcompete the parental strain, but this phenotype was lost after 6 h of incubation in

the pond (Figure 2.3 panel D). After 24 h of pond incubation, the parental now had a

statistically significant advantage over the ΔtarB mutant when competed in vivo, but not

when competed for in vitro growth in LB.

49
ToxT binds in the TarB promoter region

The sequence upstream of the predicted TarB start site was investigated and

revealed putative -10 and -35 sequences, as well as a direct repeat of putative toxboxes

(Figure 2.5). The 3’ end of TarB determined by deep sequencing corresponded to the

poly-U tract of a Rho independent terminator. The toxboxes upstream of tarB are

arranged in similar fashion to those upstream of the virulence gene tcpA [152]. To

confirm binding of ToxT to this site, a DNA probe consisting of basepairs -100 to +1

relative to the predicted transcription start site was assayed for ToxT binding by gel shift

assay. ToxT bound to this region with an affinity within the range of other reported

toxboxes [149], but not to a non-specific probe of similar length consisting of a PCR

product of the 4.5S RNA sequence (Figure 2.5).

50
Figure 2.5: Sequence of tarB and ToxT binding sites within promoter region.

A) Sequence of tarB as determined by the sRNA deep sequencing experiment. Direct

repeats of the putative ToxT binding sequence are highlighted by the black arrows. B)

Electrophoretic mobility shift assays using uncleaved MBP-ToxT fusion protein and the

sequence 100 bp upstream of the tarB transcriptional start site as a probe. A PCR product

of the same size consisting of the sequence of ffh, the gene encoding the 4.5S RNA, was

used as a negative control probe.

51
The tcpF mRNA is a target of the TarB sRNA

We next wanted to determine the target(s) of TarB that were responsible for the

observed negative role of TarB in virulence. Nineteen putative mRNA targets were

identified using the program targetRNA [153], which searches for complementarity

between the query sRNA and the 5’ untranslated region (UTR) of mRNAs of annotated

ORFs within a given genome. To validate putative targets, we looked for changes in the

steady-state level of the candidate mRNAs using quantitative reverse transcription PCR

(qRT-PCR) on total RNA from TarB+ and ΔtarB strains both expressing toxT from an

arabinose inducible plasmid. Of the six putative targets we selected for further analysis

only two, tcpF and VC2506, had any detectable expression under the conditions tested.

When levels of the potential target transcripts were normalized to toxT transcript levels, a

significant difference between the TarB+ and ΔtarB strains was revealed for the tcpF

mRNA but not for VC2506 (Figure 2.6A). The observed increase in tcpF mRNA in the

ΔtarB background suggests that TarB negatively regulates tcpF, which would be

consistent with the negative role of TarB in virulence.

To determine if TarB similarly affects TcpF protein expression level, we

generated a C-terminal FLAG tag fusion to TcpF in the genome to measure expression by

western blot after AKI in vitro virulence factor induction [76]. We also generated two

sets of three point mutations each within the predicted region of complementarity

between TarB and the 5’ UTR of tcpF, yielding tcpF* and tarB* alleles. These mutations

are underlined in Figure 2.6B. Because the tcpF and tcpE ORFs are very close together,

there is some overlap between the coding sequence of tcpE and the 5’ UTR of tcpF;

52
however, the substitutions that were made do not affect the amino acid coding sequence

of the upstream gene tcpE nor do they alter the Shine-Dalgarno sequence of tcpF.

Moreover, the mutations were designed to preserve GC content of the region altered.

Either set of mutations present alone (tarB* or tcpF*) would be predicted to disrupt the

interaction between TarB and the tcpF 5’ UTR while the presence of both is

compensatory and would be predicted to restore the interaction.

A strain deleted for tarB was then used as the parent strain to construct derivatives

having either the tcpF-FLAG or tcpF*-FLAG allele. These two derivatives were then

complemented with either ptarB, ptarB* or empty vector (pMMB). These six strains

along with the wild type strain carrying the TcpF-FLAG fusion were grown through the

static culture phase of an AKI induction and were Western blotted to measure TcpF-

FLAG expression. The blots were then stripped and probed for OmpU, an outer

membrane protien which is not regulated by ToxT [154], to serve as a loading control.

Compared to the wild type strain (Figure 2.6C, first column) the ΔtarB and ΔtarB tcpF*

strains carrying the empty vector showed elevated TcpF levels (second and third

columns). When the ΔtarB and ΔtarB tcpF* strains were complemented with ptarB* and

ptarB, respectively, levels of TcpF remain largely unchanged, indicating that when either

the tcpF mRNA or tarB sRNA are mutated, no interaction can take place and these

strains show expression of TcpF similar to the ΔtarB mutant. However, when the ΔtarB

and ΔtarB tcpF* strains were complemented with ptarB and ptarB*, respectively, to

observe affects of the wild type or compensatory interaction when the sRNA is

overexpressed, the levels of TcpF drop substantially. Six replicates of this experiment

were performed and reveal that statistically significant drops in expression of TcpF occur

53
only in strains containing either the wildtype TcpF target sequence complemented with

wildtype TarB or strains in which the target sequence and sRNA have compensatory

mutations (Figure 2.7). When protein samples from these strains were taken after the

aeration growth phase of AKI induction and used for Western blots, no differences in

TcpF expression were visible (data not shown), which would be expected given the up

regulation of tarB during the static phase but return to basal level of expression during

the aeration phase of AKI induction.

54
Figure 2.6: TarB interaction with the 5’ UTR of tcpF.

A) Quantitative reverse transcription PCR was carried out on RNA extracted from strains

expressing ToxT from an arabinose inducible promoter. Because the extent of toxT

induction varied between experiments, transcript levels were normalized to toxT

transcript. The ΔtarB mutant showed a significant enhancement of 2-fold in tcpF

transcript relative to wild type over the course of four independent experiments (Mann-

Whitney U test), the level of the other predicted target (VC2506) did not change. B)

Predicted base pairing interaction between TarB and the 5’ UTR of tcpF. The start codon

of TcpF is highlighted in bold, the numbering of the tcpF transcript is relative to the start

of translation, numbering of the TarB transcript is relative to the start of transcription.

55
The mutations made to generate tcpF* and tarB* are underlined. C) A fusion of the

FLAG peptide to the C-terminus of TcpF was generated to follow TcpF expression by

western blot. At the 4 h static time point of AKI induction a band corresponding to the

molecular weight of TcpF-FLAG was detected with the anti-FLAG antibody. Blots were

then stripped and re-blotted with anti-OmpU antibodies to serve as a loading control.

Fluorescence measurements of TcpF-FLAG bands were divided by measurements of

OmpU bands. Results are shown for the wild type strain without plasmid (first column)

and for the ΔtarB strains containing the wild type or mutated TarB cloned on the pMMB

plasmid and either the wild type or mutated tcpF 5’ UTR (tcpF*) chromosomal allele

(columns 2-7). Expression values are standardized to TcpF-FLAG measurements

adjusted for loading in the wildtype strain. D) Competitions in infant mice between ΔtarB

strains carrying the tcpF* allele complemented with ptarB or ptarB* against the same

strains carrying pMMB67EH alone. The strain complemented with ptarB* shows

decreased colonization relative to the empty vector strain. When complemented with

ptarB the competitive index is closer to 1 (Mann-Whitney U test)

56
Figure 2.7: Quantitation of TcpF-FLAG Western blot.

Western blotting to quantitate TcpF-FLAG was performed a total of six times for each

strain (including the shown example). For each experiment, the TcpF-FLAG fluorescence

was divided by OmpU fluorescence and each experimental sample was normalized to the

wildtype for that experiment by being set equal to one. Normalized fluorescence values

were log transformed and evaluated by one sample T-test against one, the normalized

wildtype value. In this analysis only the ΔtarB (ptarB) strains and ΔtarBtcpF* (ptarB*)

had mean normalized fluorescence values significantly different from one.

57
 To determine if the interaction of TarB with the 5’ UTR of tcpF was responsible

for the phenotype in mice, competitions were carried out using tcpF* strain derivatives.

We determined that independent of TarB status, that the tcpF* strains had a colonization

defect compared to parental strain (data not shown), this is why we performed all

competition experiments in the tcpF* background to eliminate this as a potential variable.

Competition of the ΔtarB tcpF*(ptarB*) strain against the same strain carrying empty

vector yielded the expected result of out-competition by the latter strain, which lacks

tarB* (Figure 2.6, panel D). Competition of the ΔtarB tcpF*(ptarB) strain against the

same strain with vector alone yielded a competitive index that was significantly closer to

one, which is expected since neither strain should have an interaction between sRNA and

target. The difference between the two competitive indices was highly significant (p

<0.003).

58
TarB’s anti-colonization phenotype is time-dependent

Another group has evaluated TarB’s colonization phenotype, and they reported a

colonization defect in their ΔtarB mutant in similar in vivo competitions, in contrast to

our findings of an increased colonization phenotype [12]. One difference between their

assay and ours is the time after inoculation at which they evaluated the competitive index.

We investigated whether the length of infection post inoculation impacted the

colonization phenotype of the ΔtarB mutant. Consistent with both studies, the

colonization phenotype of ΔtarB mutant appears to be dependent on the length of time of

the competition experiment (Figure 2.8). At earlier time points of infection, the ΔtarB

mutant displayed a colonization defect. This is particularly interesting as it appears that a

undercolonizing strain actually catches up and surpasses the wild type later in infection.

The implications of this are unclear, but may relate to an emerging picture that TarB’s

activity may be most relevant early during infection, whereas the prolonged inhibition of

its virulence factors may lead to less replication at later time points, at least in the mouse

model of infection. Based on TcpF’s hypothesized function of “micro colon maintenance

” [42], we can suggest a model that accounts for the observed time-dependent

colonization phenotype. Early in infection, TarB’s activity appears to be important, most

likely prior to the time that TcpF’s function is required, hence, misregulation of TcpF

may lead to fewer bacteria being able to initially colonize the small intestinal epithelium.

As the infection progresses, increased production of TcpF may lead to increased

microcolony size, perhaps due to prevention of detachment of bacteria back into the

luminal space of the small intestine where it appears that the organisms are not actively

dividing [60]. This may account for the time-dependent phenotype that we observe.

59
Figure 2.8 The colonization phenotype of the ΔtarB mutant is time-dependent

Competitions were carried out in infant mice and were allowed to progress for 14 hours

and 18 hours as opposed to our previous experiments that were allowed to run for 24

hours. The ΔtarB mutant shows a statistically significant colonization defect at 14 and 18

hours (p < 0.01 one sample T test)

60
Other potential sRNA members of the ToxR regulons

Our high-throughput screens identified 18 potential sRNAs that may be regulated

by ToxT, and most of these remain to be investigated. Some of the sRNAs were

identified in other sRNA discovery experiments [114] or inadvertently, for example, as

being regulated by the global iron regulator in V. cholerae, Fur [155]. We have

performed Northern blots using probes for a number of other potentially ToxT-regulated

sRNAs identified by our screen. The sRNA located between the genes VC0175/VC0176

was identified as differentially regulated and having a potential ToxT binding site nearby.

Northern blots for this sRNA revealed a larger transcript then expected that was induced

upon ToxT expression, though not as robustly as TarB (Figure 2.1, Panel A). We have

tentatively named this new sRNA TarC. In addition, this sRNA is induced during the

static phase of AKI induction, much like TarB, and this increase is not seen in a Δhfq

mutant, though as mentioned in the discussion above, it is not clear whether or not this is

due to the requirement Hfq for TarC stability or decreased ToxT induction in this strain.

Intriguingly, this sRNA is located just downstream of a previously noted TarB target,

VC0177, within the VSP-1 [12]. At this time, It is not clear if there is a connection

between these two findings.

Our initial in vivo characterization of a mutant made in the TarC putative sRNA in

vivo has led to some interesting results. The ΔtarC mutant shows a small, but statistically

significant decrease in its ability to colonize the infant mouse. This growth defect is not

observed in competitions carried out in LB broth. We attempted to complement this

defect by putting tarC on a plasmid, and while the trend in that experiment is towards the

61
compelemented strain outcompeting the ΔtarC strain, the trend was not statistically

significant (figure 5.2 panel C). The implications of these findings are not yet clear, but

we believe that there is a distinct possibility that other ToxT-regulated sRNAs remain to

be discovered and could also yield useful insights into the infectious process.

Although other ChIP-seq style experiments have suggested that ToxT may have

no in vivo relevant binding sites outside of the VPI-1 or the CTXΦ [12], this is at odds

with experiments showing direct binding of ToxT to elements within genes encoding the

MSH pilus as a mechanism of ToxT-based repression of those genes [98]. Certainly other

in vivo factors, such as bicarbonate [77] and fatty acids [96] can influence ToxT’s activity

and ability to bind DNA, and this may partially account for the disagreement between our

results and those from the Mekalanos lab. It is also worth noting that they performed their

ChIP experiments after expression of an epitope-tagged ToxT allele from an inducible

plasmid during growth in LB, there are two potential issues with this approach. First of

all, the physiology of V. cholerae grown LB may be dramatically different from the

physiology of V. cholerae after ingestion by a human from contaminated water, and

hence the presence of other factors that can change ToxT’s activity may not bet he same

in the two environments. Second, the Mekalanos lab used an N-terminally tagged

construct of ToxT [12] for their ChIP experiments, and our experience with some N-

terminally tagged constructs of ToxT is that they have shown reduced activity relative to

the wildtype allele (data no shown) and this may account for their relatively low number

of determined binding sites. Hence, there is a possibility that ToxT could bind to and

effect expression of genes outside the above mentioned regions, and there is a distinct

62
possibility based on this work that sRNAs outside the VPI-1 and CTXΦ could be

controlled in some way by ToxT.

63
Figure 2.9 A third potential ToxT-regulated sRNA

A) ToxT was expressed from an arabinose inducible plasmid in the ΔtoxT background.

Total RNA was extracted at the indicate time points. At the 40 and 60 minute time points,

the band representing TarC is expressed between 3 and 4 fold higher in the pToxT culture

vs the ΔpToxT ΔHLH culture. B) During AKI induction, TarC shows upregulation during

the static phase of culture, similar to TarB. In the Δhfq background, this upregulation is

abrogated, most likely due to reduced expression of ToxT under these conditions, as the

steady state levels of the sRNA during the shaking phase of AKI induction are similar in

the wild type and Δhfq mutant. C) When the ΔtarC::FRT mutant is competed against a

ΔlacZ strain, the ΔtarC::FRT mutant shows a competitive index of 0.68, (p < 0.05

64
compared to ΔtarC::FRT vs ΔlacZ in vitro, Mann-Whitney U test). In a complementation

experiment, a strain carrying tarC (predicted promoter included) on a plasmid showed a

trend towards outcompetition of a ΔtarC strain carrying vector alone, although this trend

was not statistically significant.

65
Discussion

Deep sequencing has allowed the interrogation of processes in bacteria with

unprecedented detail. Here we used two complementary approaches, deep sequencing of

cloned sRNAs and ToxT-bound DNA fragment pulldowns, to identify ToxT-regulated

sRNAs. The number of previously estimated ToxT binding sites in the V. cholerae

genome was between 17 and 20 [89,98]. We have now uncovered what may be a greatly

expanded set of targets for ToxT to coordinate expression of protein coding genes as well

as sRNAs. The results of the pulldown experiment returned regions of a few hundred

basepairs in length that were enriched and many predicted sites are overlapping, which is

due to the size range of the fragments used in the pulldown and the automated analysis of

the pulldown data. Although many of these sites remain to be validated, we are confident

in proposing that the ToxR regulon encompasses more transcripts, both protein coding

and otherwise, than was previously thought.

The results of the sRNA deep sequencing reveal the method to be exquisitely

sensitive. Because of our exclusion of larger RNA transcripts and depletion of tRNA and

5S RNA in the sRNA size range and the use of Illumina massively parallel sequencing

technology, we have achieved tremendous depth of coverage of potential sRNA genes in

V. cholerae [114]. Transcripts represented by ~40 or more reads could be detected by

northern blot (this study and data not shown). However, transcripts represented by fewer

than ~40 reads, which may represent low abundance sRNAs, are difficult or impossible

to detect by northern blot and other methods such as qRT-PCR are needed for

independent validation. Of the 18 candidate ToxT-regulated sRNAs we report here, 11

66
(including tarB) were not identified as putative sRNAs in previous sequencing

experiments or bioinformatics-based approaches to sRNA discovery [114,156],

displaying the depth of information that can be gained with high throughput sequencing

technologies and the conditional expression of sRNAs. In addition to sequencing these

transcripts, we have confirmed the existence of 3 individual sRNAs that were detected in

the sequencing by sequencing and visualized by northern blot. In comparison to other

methods of sRNA discovery, our approach has the advantage of being targeted in its

search for ToxT-regulated sRNAs but unbiased in its identification of sRNAs.

Approaches utilizing RNA binding proteins such as Hfq [131,132], are not exhaustive as

the sRNA we report here likely does not interact with Hfq, though those methods do have

the potential to identify mRNA targets as well as sRNAs. Additionally, this approach

benefits from the vast strides made in high throughput sequencing recently which

generates far more depth of data then microarray based methods [157], including exact 3’

and 5’ ends and unbiased coverage of positive and negative strand sRNAs. Keeping the

latter in mind, this approach can also identify many potential sense and anti-sense sRNAs

[114] overlapping with protein coding genes although these potential sRNAs are not

discussed here.

In this study we identified a new sRNA member of the ToxR regulon that fine-

tunes expression of a virulence factor also within the ToxR regulon, thus adding a new

facet to the elaborate virulence gene regulation program in V. cholerae. However, when

placed in the larger context of V. cholerae pathogenesis, it is not entirely clear why a

repressor of an essential virulence factor would be produced at the same time as the

virulence factor it negatively regulates. The answer may lie in the biphasic nature of V.

67
cholerae gene expression during intestinal colonization [57,60]. The initial induction of

virulence factors requires ToxR/S- and TcpP/H-dependent ToxT expression in the

intestinal lumen. This is followed by a more robust activation of the TCP and CTX

operons closer to the epithelial surface of the small intestine, driven by a positive

feedback loop in ToxT expression that is thought to activated in part by the presence of

bicarbonate [76,77].

Coordination of TcpF expression by TarB appears to have a positive effect on

colonization if the bacteria are coming from a resource poor environment, such as

contaminated pond water, or early during an infection from nutrient rich environment.

However, even then, the differences in colonization efficiency of the ΔtarB mutant are

quite small. In contrast, if the infection is allowed to proceed for 24 hours and the

bacteria are coming from rich media, overexpression of TcpF in the ΔtarB mutant

appears to be beneficial. The reasons for this may relate to the details of the experimental

system used here, wherein immunologically naïve infant mice are used as a host. In

contrast, in nature many hosts in endemic areas will have some level of pre-existing

immunity, and may harbor anti-TcpF antibodies as TcpF is a known antigenic protein

[42]. It is possible that tight repression of TcpF provides a more pronounced fitness

advantage in nature under different conditions then those used here, which would explain

TarB’s presence among all sequenced isolates of toxigenic V. cholerae (data not shown).

Further studies into the functional role of TcpF in colonization may shed more light on

the necessity of the TarB-mediated post-transcriptional regulation observed here.

68
Chapter 3. Other factors contributing to TarB expression

and regulation

Portions of this chapter were published as:

Bradley, E. S., K. Bodi, A. M. Ismail & A. Camilli, (2011) A genome-wide approach to

discovery of small RNAs involved in regulation of virulence in Vibrio cholerae.

PLoS pathogens 7: e1002126.

Acknowledgements

Neil Greene performed anaerobic growth experiments with help from Brian Mehan.

Emily-Kate McDonough provided the fexA mutant. Evan Bradley performed all other

experiments

Because it is counterintuitive that the same system that activates expression of

TarB would also have a negative effect on virulence gene expression, we investigated

other factors that could possibly contribute to TarB expression. Expression of virulence

factors has been linked to different environmental conditions such as the presence of

bicarbonate [77], the presence of free fatty acids [96], and anaerobic conditions [75].

69
Much of this regulation occurs without necessarily altering expression of key upstream

virulence gene activators. Other possible factors responsible for controlling TarB

expression could be entry into the stationary phase. Stationary phase regulation of TarB

could occur by an alternative sigma factor as was observed for the sRNA VrrA [143], or

possibly catabolite repression by the CRP-cAMP complex as carbon sources become

depleted [71]. Population density is also integrated into the decision by V. cholerae to

express virulence factors and the major quorum sensing system acting through HapR can

negatively impact expression of virulence factors [79]

Besides investigating other factors that influence TarB expression, we were

interested in testing the hypothesis that TarB-mediated regulation coordinates expression

of TcpF and other targets spatially and/or temporally during infection. To interrogate

expression from the TarB promoter during infection, we constructed a transcriptional

fusion of a destabilized (reduced half-life) allele of GFP (GFP-ASV) [60,158] to the TarB

promoter. Using this GFP reporter system, we attempted to measure in vivo expression of

TarB. Unfortunately, we had great difficulty visualizing GFP-expressing bacteria in vivo

due possibly to low level expression of the reporter. However, as shown in Figure 3.6. we

were able to investigate expression of mRNA from the promoter fusion to at least

determine at a population average level what the expression of TarB might be during the

course of a V. cholerae infection with the in vivo model.

TarB expression during AKI growth

To further investigate the ability of ToxT to control TarB, we measured

70
expression of TarB under an in vitro virulence factor inducing condition, which is growth

for 4 h in static cultures in AKI broth containing sodium bicarbonate, followed by 4 h

with aeration [76]. Expression of TarB was induced during the initial static phase of

growth, but returned to background levels after 4 h of growth with aeration (shaking)

(Figure 3.1A, top panel). The initial induction was dependent on toxT as well as toxR and

tcpP/H (Figure 3.1, bottom panel), which are genes upstream in the ToxR regulon that

induce ToxT expression [56,159,160]. We also noted that TarB was overexpressed

between 7-10 fold in a ΔtarB strain complemented with TarB in trans despite the fact that

tarB was cloned under the control of its native promoter. This is, however, consistent

with complemented strain’s in vivo phenotype being more dramatic then the parental

strain in competitions with the ΔtarB mutant. Some basal expression of TarB was seen

during culture in LB, which was greatly enhanced at the transition to stationary phase;

however, this increase was independent of ToxT (Figure 3.1B).

During AKI induction in the absence of bicarbonate, ToxT production is

stimulated during static growth but the transition to aerated growth is required for CT

production [70]. All experiments reported here included bicarbonate in the medium over

the course of the experiment, which is sufficient to cause CT production even during

growth without aeration [76,161]. In addition, during AKI induction, 4 h of growth in

static cultures corresponds with entry into stationary phase [70], which may be linked to

expression of TarB as discussed above. Therefore, it is not clear whether the presence of

bicarbonate in the media or the growth phase of the culture is the major ToxT-

independent contributor to TarB expression during AKI induction.

71
Figure 3.1: Northern blots of TarB during AKI induction and growth in LB.

A) To determine the pattern of TarB expression during virulence factor inducing culture

conditions (AKI induction), RNA samples taken after 4 h of static growth, 1 h of shaking

growth and 4 h of shaking growth were blotted for the presence of TarB. TarB was

upregulated during growth in static cultures (top panels). Upregulation of TarB was also

dependent on toxT, toxR and tcpP/H (bottom panels). Expression from the

complementation plasmid ptarB reveals that TarB was overexpressed from this plasmid

7-10 fold when adjusting for 5S rRNA loading, though the overall expression pattern of

TarB remained the same. The pMMB represents the empty vector negative control. B) To

72
investigate TarB’s expression during normal growth in LB, we blotted for the presence of

TarB in cultures grown shaking at 37C in both our ΔtoxT strain and the parental strain.

During growth in LB, tarB is upregulated upon entry into stationary phase, however, this

upregulation was independent of ToxT.

73
Anaerobic growth conditions contribute to TarB expression

Enhanced expression of TarB during late exponential and stationary phase growth

in LB broth and in the static portion of the AKI induction protocol (see above) may be

related to oxygen tension in solution. Recent work has shown that AphB directly senses

anaerobic conditions via a redox sensitive cysteine residue [162] and is likely what is

primarily responsible for driving virulence gene expression under anaerobic condtions.

AphB has been shown to be critical for activation of TcpP/H [71,163], which in turn

activates ToxT expression. To investigate the contribution of oxygen tension during AKI

static growth to TarB expression, we measured expression of toxT, tcpF and the

transcription factor cadC by qRT-PCR, and TarB via the TarB-GFP-ASV fusion over the

static growth period of AKI induction. The cadC gene is activated by the LysR

transcriptional repressor homologue protein AphB under low oxygen and low pH

conditions [72], and its measurement is used here as a method of determining when the

culture is undergoing those conditions.. The results of this experiment are summarized in

Figure 3.2. As measured against expression after 2 h of growth under static conditions,

expression of toxT and tcpF more or less reached maximum by 3 h of static culture

(Figure 3.2 A, top panels), though expression of TarB-GFP-ASV and cadC continued to

rise, suggesting additional activation of the tarB and cadC promoters. Western blotting

for TcpF in the TcpF-FLAG fusion strain grown under the same conditions,

independently confirmed this finding for TcpF (Figure 3.2A, bottom panels). However,

OmpU could not be used as a loading control for this blot as it varies over the course of

AKI induction [164], so we did not carry out quantification.

74
 To investigate the contribution of anaerobiosis to expression of TarB, we prepared

cultures of wildtype and ΔtoxT strains in phosphate buffered LB media, to prevent large

alterations in pH, and with glucose supplementation to support anaerobic growth [165].

These cultures were prepared in an anaerobic chamber and then grown either aerated in 2

mL or in sealed 10 mL cultures to approximately the same optical density. RNA

extracted from these cultures was used in northern blots for TarB (Figure 3.2B). The

results showed that anaerobic conditions stimulate TarB expression independently of

ToxT. When adjusted for loading, the increases in expression of TarB in the wildtype

culture were approximately 2-fold, indicating that under anaerobic conditions, ToxT does

drive some expression of TarB. Taken together these results suggest that anaerobic

conditions activate TarB. This increase is not likely due to the V. cholerae homologue of

the anaerobic regulator ArcA (annotated FexA), as a Northern blot for TarB performed

on RNA from a fexA mutant grown to late log phase showed no changes relative to the

parental strain (data not shown). Although this protein has been implicated in regulating

virulence genes [166], it does not appear to contribute to TarB regulation under these

conditions. The possible contribution of another anaerobic regulator, Fnr, and the

possibility of a direct effect of AphB on TarB expression, remains to be investigated

75
Figure 3.2: TarB expression under anaerobic conditions.

A) Expression of tcpF, toxT, cadC and gfp from the tarB-gfp fusion. The toxT and

anaerobically upegulated cadC genes were followed by qRT-PCR over the course of AKI

induction. Shown are median expression values of technical triplicates, adjusted for the

rpoB loading control relative to the 2 h time point of AKI induction. Results indicate that

toxT and tcpF reached near maximal induction at 3 h of static growth and expression of

the tarB-gfp fusion and cadC showed the most dramatic increases between 3 and 4 h (top

panel). This result was confirmed at the protein level by western blot of the wildtype

strain carrying the TcpF-FLAG fusion taken through the same AKI induction experiment

(lower panel); loading was adjusted for OD as OmpU levels change with activation of

ToxR. B) Both wildtype and ΔtoxT strains were grown in buffered media containing

glucose either in 2 mL culture tubes with aeration (+O2) or 10 mL sealed culture tubes

prepared in an anaerobic chamber (-O2) at 37oC to early stationary phase. RNA was

extracted and blotted for TarB. The results indicate that TarB is upregulated under

76
anaerobic growth conditions independent of toxT when adjusting for loading.

77
Contribution of the quorum sensing cascade to TarB expression

Because quorum sensing and virulence gene expression are closely linked in V.

cholerae [78], it seemed likely that it may affect TarB expression, possibly through a

mechanism independent of HapR’s regulation of TcpP/H. The two major quorum sensing

systems of Vibrio species both converge at the response regulator LuxO, which is

phosphorylated and active at low culture densities, but inactive and de-phosphorylated at

high cell densities [167]. Phosphorylated LuxO stimulates the expression of a number of

sRNAs (known as the qrr or quorum sensing sRNAs) that negatively regulate HapR

expression [121]. As previously stated, HapR is inhibitory to the virulence cascade via its

inhibition of the aphA promoter [78], and thus LuxO provides a link between quorum

sensing information and virulence gene activation. Because LuxO controls the expression

of a number of other sRNAs and may provide a ToxT-independent means of controlling

TarB expression at low culture densities (possibly when TarB’s activity is most

important), we sought to investigate if the quorum sensing cascade acting through LuxO

contributes to TarB expression independently of its effect on the ToxR regulons. We

performed northern blots on ΔluxO, and a luxO constitutively active mutant (LuxO

L104D) [168] at various points in the growth curve as well as under virulence factor

inducing conditions.

During normal growth, it appeared as though the ΔluxO mutant has an increased

abundance of TarB, especially early in the growth phase. This increased expression was

not seen at later time points in the growth curve, at which point the mutant had the same

TarB abundance as wildtype (Figure 3.3 panel A). This pattern fits with LuxO

78
phosphorylation and activity at low cell densities [169] and implicates LuxO as a

repressor of TarB. However, when these LuxO mutants were investigated during in vitro

virulence factor induction, the opposite results are seen; that is, strains expressing LuxO

show increased expression of TarB (Figure 3.3 panel B).

Because LuxO controls expression of the qrr sRNAs that inhibit HapR, that is in

turn inhibitory towards expression of TcpP/H upstream of ToxT [78], its expression is

critical to induction of ToxT during in vitro virulence factor induction. The results of the

experiment shown in Figure 3.3 panel B suggest that LuxO’s function in this context (via

activation of ToxT expression) contributes more to TarB expression then the mild

repression we observed during growth in LB (Figure 3.3 panel A) Although it is unclear

what these results indicate, it maybe that LuxO has some function in repressing TarB

during normal growth, but once ToxT is induced (something LuxO function is important

in allowing), it appears as though that repression is over-ridden.

79
Figure 3.3: LuxO may contribute to the regulation of TarB under normal growth

conditions

A) Northern blot for TarB in wildtype (WT), ΔluxO and a luxO constitutively active

mutant during normal growth in LB. Abundance of TarB appears to be higher in the

ΔluxO mutant early in the growth phase. B) Northern blot for TarB in wildtype (WT),

ΔluxO and a luxO and a complemented strain grown under virulence factor inducing

conditions. Under these conditions, it appears that LuxO activity contributes to TarB

expression, rather then represses it. This is consistent with LuxO acting through the qrr

sRNAs to repress HapR and allow expression of virulence factors.

80
TarB is likely an Hfq-independent sRNA

We also investigated the role of the RNA chaperone, Hfq, in TarB stability and

action as many sRNAs that act in conjunction with Hfq are destabilized in its absence

[112,170]. The sequence of the TarB sRNA does not reveal a canonical Hfq binding site

(UAUUAA) [171] and thus an interaction with Hfq may not occur. The expression of the

tarB promoter-GFP-ASV fusion was used to measure activity of the TarB promoter

during induction of ToxT from the pToxT plasmid in both Hfq+ and Hfq- strains. In these

same strains, steady state levels of TarB from a native copy of the gene were measured

by northern blot. The results of these experiments are summarized in Figure 3.4 and

indicate that Hfq does not play a detectable role in stabilizing TarB. In addition, we

examined the effect of Hfq deletion on TcpF regulation by qRT-PCR. As shown in

Figure 3.4 Panel A, TcpF transcript does not vary greatly between the Hfq+ and Hfq-

strains used in the experiment, suggesting that Hfq does not affect the ability of TarB to

regulate its targets.

Recent experiments with Hfq have revealed that overexpression of Hfq-binding

sRNAs leads to destabilization of other Hfq-dependent sRNAs within the cell, as the over

expressed sRNA sequester most of the Hfq present within the cell [134]. To further

investigate the Hfq independence of TarB, we examined the effect of TarB

overexpression on a known Hfq-dependent sRNA, VrrA [111]. If TarB binds Hfq, then

we might expect TarB over expression to sequester Hfq, resulting in the destabilization of

VrrA. However, the steady state level of VrrA was not affected by TarB overexpression,

81
consistent with our hypothesis that TarB is an Hfq-independent sRNA.

Figure 3.4: The RNA chaperone Hfq plays no detectable role in TarB stability or in

its interaction with TcpF transcript.

A) The TarB promoter-GFP fusion was made in strains deleted for toxT and carrying

arabinose-inducible ToxT on a plasmid in both the Hfq+ and Hfq- backgrounds. These

strains were then used to measure expression from the tarB promoter-gfp fusion, TarB

from an intact native allele, expression of toxT from the plasmid, and expression of tcpF,

which is a target of TarB by qRT-PCR. Data reported is the relative expression of those

transcripts, adjusted for rpoB in the Hfq+ strain relative to the Hfq- strain. Although

82
expression of all transcripts were higher at 20 minutes post induction in the Hfq+ strain,

the levels were similar before induction and after 40 minutes of ToxT induction. Adjusted

for toxT expression, no differences were observed between Hfq+ and Hfq- strains for

expression of tcpF and gfp from the tarB promoter-gfp fusion. B) A northern blot for

TarB was carried out on the same RNA samples used in Panel A for qRT-PCR, the

results indicate that there is no large difference in steady state level of the TarB sRNA in

the Hfq+ and Hfq- strains, suggesting that Hfq has no role in stabilizing TarB. C) Results

from Panel A were confirmed by western blot for GFP in samples taken from the same

experiment. The results indicate that adjusted for loading, the two strains are expressing

similar amounts of GFP from the tarB-gfp fusion prior to induction and at 40 minutes,

indicating the tarB-gfp fusion is activated by expression of ToxT, as expected. D) To

determine if over expression of TarB alters the stability of other sRNAs, we measured

expression of the sRNA VrrA in cultures expressing TarB from the pJML01-tarB

plasmid for either 15 minutes or 4 hours. In either case, expression of the VrrA sRNA

was identical in cultures expressing TarB or those carrying vector only, indicating that

over expression of TarB does not affect the stability of VrrA

83
TarB and TcpF expression during incubation in pond water

To determine if the expression of TarB and TcpF in the pond contributed to the

reduced in vivo phenotype we observed in the ΔtarB mutant after pond water incubation,

we carried out experiments to measure TarB and TcpF levels over the course of pond

water incubation. The results of these experiments are summarized in Figure 3.5. TcpF

expression was followed through the course of pond water incubation via the C-terminal

FLAG fusion in both the wildtype and ΔtarB backgrounds by anti-FLAG western blot.

The results indicate that the wildtype and ΔtarB mutant show similar levels of TcpF

expression initially, however, over the course of pond incubation, TcpF levels drop in the

wildtype strain, but not the ΔtarB strain. Transcription of TarB, as measured by

production of GFP from the TarB promoter-GFP fusion indicates that levels of TarB

expression do not change dramatically over the course of pond water incubation. The

apparent upregulation of ptarB-GFP(ASV) at the 24 hour timepoint may relate more to

the stability of the gfp mRNA and not increased transcription at that timepoint, as there is

likely little metabolic activity occurring in these cultures after prolonged incubation in

nutrient poor conditions. Northern blots for TarB expression over the course of pond

water incubation suggest that TarB steady state level drops (Figure 3.5 panel C), but this

may be due to the observed wholesale degradation of RNA after increasing time of

incubation in pond water, such that accurate measurements of TarB expression via

Northern blot may not possible. These results indicate that while TarB expression levels

do not vary dramatically over the course of pond water incubation, TcpF protein levels do

84
drop, and this drop was absent in the ΔtarB mutant. This enhanced TcpF expression in

the ΔtarB mutant may contribute to the phenotype of the ΔtarB mutant in vivo after pond

water incubation, as over expression of TcpF in pond water would contribute to

metabolic drain prior to infection or perhaps be responsible for some other subtle defect

in fitness upon entry into the host.

85
Figure 3.5 Expression of TcpF and TarB during pond water incubations.

A) Strains carrying the C-terminal TcpF-FLAG translational fusion or tarB-gfp (ASV)

transcriptional fusion were incubated in pond water for the indicated amounts of time

then lysed by boiling in SDS-loading buffer. Samples were then blotted with anti-FLAG

and anti-GFP antibodies, loading was adjusted for OD. Levels of TcpF protein decline

over the course of pond water incubation, this effect was absent in the ΔtarB mutant. B)

Expression from the TarB promoter, as measured by GFP protein expression from the

TarB-GFP fusion, however, does not vary greatly over the course of pond water

incubation. C) Northern blot for TarB over the prolonged course of pond water

incubation. Adjusted for loading, TarB does not show dramatic differences in abundance

during the course of pond water incubation except at 24 hours when the signal is greatly
86
diminished. This, however, may be due to general degradation of RNA within the culture

after prolonged pond water incubation.

87
In vivo expression of TarB

Although detectable fluorescence above background was produced by the TarB-

GFP-ASV fusion during growth in vitro, bacteria with fluorescence above background

were not detected by examination of tissue sections from infected mice (data not shown).

To attempt to gain some insight into where and when TarB is expressed in vivo,

infections were again carried out using a second reporter strain harboring a tarB

promoter-gfp containing a point mutation in the RBS for gfp that eliminated detectable

translation. This strain was a merodiploid such that the native TarB promoter and sRNA

sequence was still present. Mice were sacrificed at various time points after infection,

small intestines were split into proximal and distal halves, and RNA was extracted and

used for qRT-PCR (Figure 3.6). In both the distal and proximal small bowel, TcpF and

tarB promoter-gfp expression was measured. By using the expression level of these

transcripts at 10 hours as the baseline and adjusting for loading of bacterial RNA by

normalizing to rpoB transcript levels, we observed that expression of tarB and tcpF co-

vary and both increase over the course of infection (see Figure 3.6). While this intuitively

makes sense (the same system which activates TcpF expression also activates TarB

expression), it does seem counter-productive that TcpF is upregulated at the same time

that TarB represses it. This may indicate that TcpF expression at the level of translation is

being tightly controlled by TarB. However, it is worth noting that this experiment yields

information about the population average expressing tcpF and tarB-GFP, and thus

variation at the level of the bacterial cell, if present, would be missed.

88
89
Figure 3.6 In vivo qRT-PCR of the tcpF and the tarB-gfp reporter

Infant mice were infected with a strain of V. cholerae harboring a transcriptional fusion

of the tarB promoter to the gfp open reading frame. This construct contained a mutation

in the ribosomal binding site, such that no detectable GFP protein was produced, but was

instead used as a template for qRT-PCR to assess expression of TarB at various

timepoints of infection. Expression of the tcpF message was also measured. At the

indicated timepoints, mice were sacrificed and the small bowel was split into proximal

and distal halves (A and B, respectively). Total RNA was extracted for use in qRT PCR.

All reported values were adjusted for bacterial load and RNA input using rpoB as a

housekeeping gene. Each reported value is the median of three mice.

90
Discussion

From the above work, it is clear that there are various inputs that modestly affect

TarB expression, including anaerobic conditions, population density, and entry into

stationary phase. The experiments we performed under anaerobic conditions suggest that

oxygen plays a slight repressive role in TarB expression. TarB’s function under low

oxygen tension could be to repress TcpF expression prior to penetration of the mucous

barrier of the small intestine. Upon reaching the epithelial surface, the higher oxygen

tension would contribute to reduced TarB expression, allowing TcpF to be fully

expressed. This would fit with the proposed role of TcpF in colonization of the

epithelium [42]. The intestinal brush border is a highly vascular structure, commensurate

with its role in absorbing nutrients, and it is reasonable to speculate that the luminal space

adjacent to it would have greater oxygen tension then the luminal fluid. The actual

oxygen tension of the small intestinal lumen may be quite low as oxygen-requiring

luciferase reporter systems in bacteria do not function in the small intestine [172,173].

However, to the best of our knowledge, oxygen measurements at the brush border have

not been reported.

The effect of population density on TarB via LuxO mediated repression may be

relevant in the context of infection. V. cholerae is primed to express its virulence factors

when the LuxO system is active at low cell density [78]. As we will describe later, TarB

seems to be generally inhibitory towards the expression of virulence factors within the

VPI-1. At the early stages of a V. cholerae infection, cell density would likely be low

91
and LuxO would be phosphorylated. Repression of TarB at this point may allow for

early expression of virulence factors to allow for initial replication. As has been

demonstrated numerous times, not all organisms during an infection show uniform

virulence factor expression and there is temporal variation in when organisms are

maximally expressing virulence factors [57,60], this level of TarB regulation may be

important in generating this phenomenon.

During incubation in pond water, it does seem as though TarB is expressed at

some level and that this serves some repressive effect against TcpF under these

conditions, although this does not result in a survival defect of the ΔtarB mutant. This

observation may however contribute to the observed virulence defect that the ΔtarB

mutant has after pond water incubation. Perhaps inappropriate expression of TcpF during

growth in pond makes the organisms less fit for a subsequent infection.

However, it is worth noting though that in the end, the most important factor

influencing TarB expression in my experiments is ToxT. The differences seen in TarB

expression under aneaerobic conditions or in the ΔluxO strain during growth in LB were

on the order of 2-fold, whereas expression of ToxT from an arabinose inducible plasmid

results in a 50-fold increase in expression. When the various luxO mutants were grown

under virulence factor inducing conditions, it was clear again that ToxT was the primary

driver of TarB expression, as any repressive effect that the luxO* mutation may have had

on TarB expression was over-ruled by increased expression of ToxT in that strain.

Therefore, I propose that the additional environmental factors of oxygen tension, quorum

sensing and entry into stationary phase, play relatively minor roles in regulating the

expression of TarB, and that instead, ToxT plays the major regulatory role. Hence,

92
factors that influence ToxT expression and activity such as HapR mediated repression of

TcpP/H will be the primary determinants of TarB expression.

93
Chapter 4 Investigating alternative targets of the TarB

sRNA

Acknowledgements

All high-throughput sequencing was performed by the Tufts University Genomics Core

Facility, all individual experiments were performed by Evan Bradley.

The existence of multiple diverse targets of regulation by individual sRNAs is an

increasingly recognized and important paradigm. It suggests that the regulatory network

of sRNAs is expansive and potentially highly complex. Several sRNAs in V. cholerae

have been shown to have multiple targets [104,111] and we wondered if this was also

true for TarB. We have previously shown that TarB negatively regulates TcpF primarily

at the level of translation initiation by occluding the Shine-Dalgarno site and also

modestly reduces tcpF mRNA abundance [92]. Additionally, it has been reported that

TarB, dramatically affects mRNA abundance of vspR [12]. These observations open up

the possibility that yet more factors may be directly or indirectly regulated by TarB. To

test this, we used transcriptional profiling under TarB deletion and TarB over-expressing

conditions during growth under in vitro virulence factor inducing condition [161] in an

attempt to mimic the conditions under which TarB is usually expressed, to hopefully

reveal additional targets that may be missed in LB growth. Here we show that TarB

94
indeed has additional targets predicted to be involved in virulence, nutrient uptake, and

house keeping functions.

Determining alternative direct targets of TarB

To investigate direct and indirect targets of TarB within the host genome, we used

strand-specific high throughput sequencing of cDNA [174] (RNA-seq) generated from

cultures of V. cholerae grown under virulence factor inducing conditions [76]. We

investigated the effects of artificial induction of TarB expression for a brief period (15

minutes) and over the course of the growth (4 hours). Cultures expressing an arabinose-

inducible copy of TarB in a ΔtarB background were compared to vector alone at these

two time points to determine what genes might be differentially regulated. This resulted

in two data sets, genes immediately and thus possibly directly affected by TarB

expression (Appendix Table 3, 15 min after induction), and those possibly indirectly

regulated by TarB (Appendix Table 4, 4 h after induction).

Genes differentially regulated by at least two fold at 15 minutes or at 4 hours were

then cross checked against potential interaction partners of TarB within the V. cholerae

genome as predicted by the sRNA-target prediction program TargetRNA [153]. The same

stringency of search parameters (see Materials and Methods) was used that yielded the

interaction with TcpF, but potential interactions at 5’ ends, 3’ ends and within the coding

sequences of possible mRNA targets were included. This resulted in nine predicted direct

target mRNAs of TarB (including tcpF annotated VC0837). The annotation of these

genes and their expression as measured by RNA-seq at 15 minutes and 4 hours is shown

in Table 3. These genes were evaluated for expression after induction of TarB over the

95
course of growth in the virulence gene inducting condition AKI in three biological

replicates using qRT-PCR (Figure 4.1, panels A and B). We included tcpF in this

analysis to serve as a positive control. Data from individual genes correlates very well

with the RNA-seq data, though interestingly, many genes show opposite changes in

expression at 15 minutes and 4 hours.

Many of these potential target genes showed changes in expression at 15 minutes

after TarB induction, suggesting that they are possible direct targets of TarB. The two

predicted targets that showed the greatest changes in abundance after 15 min of TarB

induction when followed up individually were VCA0686 (repressed 3.8 fold) and

VC1863 (induced 4.5 fold). In the case of VC1863, this is particularly interesting as it

was determined to be a gene regulated, possibly indirectly, by ToxT in a recent study of

genome-wide expression in a ToxT over-expressing strain [12]. Thus, ToxT may act

through TarB to enhance expression of this gene.

96
Figure 4.1 Determination of putative direct targets of TarB.

A) Measurements of mRNA steady state levels of putative direct targets of TarB by qRT-

PCR after 15 minutes (panel A) and 4 hours (panel B) static growth in AKI at 37oC and

TarB induction. Measurements of the tcpF message (a known direct target of TarB) are

included as a control. Shown is the mean and SEM of 3 biological replicates expressing

TarB compared with vector alone. VC1863 and VCA0686 showed the most reliable

changes in expression across experiments. C) The results of competition experiments

carried out with strains deleted for genes that are putative direct targets of TarB. Only one

97
mutant (ΔVC1863) showed a significant deviation from a competitive index of 1 across

experiments (Wilcoxon Signed Rank Test, p < 0.01). This increased colonization

phenotype was not observed in a revertant of VC1863 D) The predicted duplex structure

and mean free energy of pairing between TarB and the 5’ coding region of VC1863 as

predicted by the program RNAhybrid, the TarB sRNA is shown in darker gray.

98
 Among other genes that showed reduced expression at 15 minutes of TarB

induction were tcpA within the tcp operon, and ctxA and ctxB within the CtxΦ lysogen

that encode CT. The tcpA mRNA and TcpA protein showed similar changes in

abundance by qRT-PCR and Western blot, respectively, after 15 minutes of TarB

induction at the endpoint of AKI growth (Figure 4.2). The cause of this repression does

not appear to be reduced expression of ToxT in the TarB over-expressing strain, as both

RNA-seq and individual analysis by qRT-PCR indicates that toxT is, if anything, more

highly expressed (Figure 4.2 PanelA). Transcriptional regulators upstream of ToxT also

show enhanced expression in the TarB over-expressing strain: tcpP and tcpH were

significantly upregulated at both 15 minutes and 4 hours after induction, we confirmed

this finding by qRT-PCR (Figure 4.2 panel D), and toxR and toxS were mildly

upregulated at both times, though these increases were not statistically significant. These

findings are consistent with higher levels of ToxT expression. This suggests that TarB

exerts a repressive effect on the TCP operon independent of the major virulence gene

regulators, however, no direct interaction was predicted between TarB and any gene of

the pilus operon or within the VPI-1 other then tcpF. TarB must have a repressive effect

on TcpA and the tcp operon independent of ToxT, this is the only possible explanation

for decreased expression of these genes in the face of higher ToxT expression. A number

of other virulence related genes were predicted to be upregulated by TarB, such as

VCA0446 (the hemagglutinin gene) which we confirmed by qRT-PCR, again suggesting

a complex series of regulatory events downstream of TarB

99
 We investigated whether or not the binding site for TarB on the tcpF message

could account for the repression seen of the entire operon. This was done by utilizing

previously constructed tcpF* and tarB* strains harboring mutations within the 5’ UTR of

tcpF and TarB, respectively, that destroy the interaction between the tcpF mRNA and

TarB [92]. However, no reproducible changes in abundance of TcpA protein or tcpA

mRNA were seen in these strains (data not shown). This is consistent with recent

transcriptional profiling data from infections of infant rabbits with V. cholerae showing

that tcpF may have its own promoter [60,175] and thus may be part of a distinct mRNA.

Hence the repressive effect of TarB on the TCP operon appears to be through some other

mechanism.

100
Figure 4.2 TcpA expression is inhibited by TarB expression.

A) Measurements of mRNA steady state levels of tcpA, ctxA and toxT by qRT-PCR after

4 hours static growth in AKI at 37oC followed by TarB induction for 15 minutes. Despite

toxT mRNA level being elevated in the TarB expressing strain, tcpA mRNA is down-

regulated as was predicted by the RNA-seq experiment.The expression of ctxA, however,

remains largely unchanged. B) Western blot for TcpA expression after the same culture

conditions used in panel A. After blotting for TcpA, membranes were stripped and

reprobed for β-lactamase expressed from the pJML01 plasmid to estimate total protein

101
loading. C) Quantitation of TcpA bands adjusted for β-lactamase loading control. Values

were obtained by measuring total fluorescence of TcpA bands and dividing by the values

for total fluorescence measurements of the β-lactamase bands in the corresponding lanes.

Loading-adjusted TcpA fluorescence values were then normalized to measurements taken

from the pJML01 vector only lanes. D) qRT-PCR for tcpP transcript and VCA0446

(hemagglutinin) transcript. After 4 hours of TarB induction, both are upregulated relative

to vector alone as we would predict based on the RNA-seq data.

102
 Several metabolic genes putatively regulated by TarB (Tables S1 and S2) were

affected differently at 15 minutes than at 4 hours after TarB induction. Using analysis

provided by the Biocyc website (biocyc.org) we determined the metabolic pathways that

were upregulated in the TarB over-expressing strain. Many of these pathways appear to

show different patterns of expression at 15 minutes than at 4 hours of TarB expression.

For example, genes for maltose uptake and metabolism (malE, malP, malQ) and genes

for glutamate biosynthesis are repressed immediately after TarB expression, but

upregulated after 4 hours. How these time-dependent changes in genes affected by TarB

expression occur remains to be investigated.

Pathways that were down-regulated at both 15 minutes and 4 hours of TarB

expression include those involved in nucleotide metabolism and translation. It was

previously shown using fluorescent protein fusions to the rrnB ribosomal RNA promoter

that bacteria expressing the highest levels of tcpA also showed the highest level of

expression from the rrnB promoter, which was inferred to mean this was the most rapidly

growing population [60]. Since TarB appears to be repressive towards virulence gene

expression, it may also repress genes involved in general growth, such as ribosomal

proteins and pathways involved in amino acid biosynthesis. Arguing against this, though,

was the observation that bacteria over-expressing TarB from the pJML01-tarB plasmid

showed no defect in growth curve experiments when compared to vector alone (Figure

4.3). Because of these seeming conflicting results, the implications of the mild repression

observed for nucleotide metabolism and translation genes after TarB over-expression

remain unclear.

103
 Although another group undertook a similar experiment to determine targets of

the TarB sRNA, their findings do not entirely agree with ours [12]. Although one of their

putative targets, VC2706, did appear as significantly regulated in our analysis, the other,

VC0177 (also known as vpsR), did not. The reasons for this are unclear, different growth

conditions (LB vs AKI growth) and our use of direct over-expression of TarB as opposed

to measuring changes in a TarB+ vs TarB- strain both over-expressing ToxT may explain

some of the differences.

Roles of TarB targets in virulence

To determine if any of the genes identified as putative TarB regulated targets

contributed to the previously observed increased colonization phenotype of the ΔtarB

mutant, individual knockouts of several genes was constructed using natural competence

and the Flp/Frt system [176]. Mutants in those genes were then used in competition

experiments with the parental strain to determine if they contributed to the increased

colonization phenotype of the ΔtarB mutant. Of the genes predicted to be direct targets of

TarB, only one, VC1863, had a reproducible phenotype (Figure 4.1, panel C). VC1863 is

part of a predicted amino acid ABC transporter. This deletion mutant had a mild, but

statistically significant colonization advantage over the wild-type strain in competition

experiments in the infant mouse model of colonization.

In a second experiment, in order to model a more natural infection model, the

ΔVC1863 mutant was preincubated in pond water prior to infection of infant mice. The

out-competition phenotype of this mutant was also seen after pond incubation (Figure

4.1, panel C). This mutant did not have an observable phenotype in in vitro competitions

104
or in a growth curve (Figure 4.1 panel C and Figure 4.3) suggesting that this increased

colonization phenotype is specific to colonization of the small intestine. Our data indicate

VC1863 is up-regulated by TarB expression. This phenotype is consistent with TarB

acting as an anti-colonization factor. Some genes that are up-regulated by TarB

expression would be predicted to be detrimental or inhibitory to colonization, and hence,

deletion of these genes may provide a fitness advantage during infection, and that appears

to be the case for VC1863.

105
Figure 4.3 Further characterization of Δ1863 mutant and pJML01-tarB strain

A) Competitions with the ΔVC1863 mutant vs the parental strain in vivo after growth on

LB plates and after 24 hour pond incubation, and competitions carried out in vitro in LB

and in pond water. Only in vivo competitions after growth on LB plates and after 24

hours of incubation in pond are significantly different from a CI of 1 (p < 0.05,

Wilcoxon-signed rank test). C/D) the ΔVC1863 strain shows no significant defect in

growth curves in LB or minimal media when compared to the parental strain carrying a

lacZ deletion. All data points are values reported are for biological triplicates. D) TarB

expression from the pJML01-tarB plasmid does not appear to affect growth in LB as

measured by growth curves.

106
107
 Our lab has previously evaluated another predicted direct target of TarB,

VCA0686 [21], which is predicted to encode the periplasmic component of an iron (III)

uptake system. It showed no observable phenotype in in vivo competitions carried out

previously in our lab. However, VCA0686 has been shown to contribute to survival of V.

cholerae in a pond environment and be induced late in infection [58]. Given that TarB is

up regulated by ToxT, a transcription factor that enhances expression of genes identified

in our lab that are expressed early during infection, it seems logical that TarB may have a

role in repressing genes important in the pond, but not necessary during the early phase of

colonization and replication. In the case of VCA0686, TarB expression appears to down

regulate this transcript. TarB is predicted to bind within the 5’ UTR of this gene (Figure

3) and likely acts by a mechanism similar to how TarB binds and represses TcpF, by

preventing translation at the start codon of the message.

In contrast, TarB appears to up-regulate expression of VC1863. The lowest

energy predicted structure of the 5’ protein coding region of the VC1863 mRNA as

predicted by Mfold [177] reveals a region with one small and two large loops separated

by short stems over which TarB has extensive complementarity (Figure 4.4). It is

possible that, through binding of TarB to this 5’ coding region of the transcript,

expression of VC1863 is somehow enhanced, possibly by the unfolding of a potentially

inhibitor structure shown in Figure 4.4.

108
Figure 4.4 Mfold diagram of 5’ region of VC1863 mRNA

Shown is the predicted folding of the 5’ region of the VC1863 mRNA, the region TarB is

predicted to bind is outlined in grey.

109
TarB directly interacts with the VC1863 and VCA0686 mRNAs

To determine if the changes in expression in VCA0686 and VC1863 are due to

direct interaction of TarB with their mRNAs, we generated point mutations in each gene

that are predicted to abrogate binding to TarB. Mutations in VCA0686 were designed so

as not to alter the coding sequence or ribosome binding site (RBS) of that message.

However, since TarB is predicted to bind with partial complementarity within the coding

sequence of VC1863, some alteration to the amino acid sequence of the gene was

unavoidable. We also generated compensatory mutations in TarB and cloned these

mutant versions into the pJML01 vector. The mutations we constructed are shown in

Figure 4.5, panels A and B. The level of expression of VC1863 and VCA0686 was then

evaluated by qRT-PCR during growth in AKI media after 15 minutes of TarB induction

(Figure 4.5, panels C and D). In the case of VC1863, when either TarB or the mRNA of

VC1863 were mutated, abundance of that mRNA is reduced. However, when the

compensatory mutations in TarB are present, the interaction is restored and the mRNA

abundance is increased. In the case of VCA0686, because TarB appeared to repress that

gene, abundance of the mRNA is increased when mutations are made to either the 5’

UTR of the mRNA or the TarB sRNA, but again, when the complementary mutations are

made in both the message and the sRNA, abundance drops, again suggesting that the

interaction between TarB and this mRNA is direct.

110
Figure 4.5 VCA0686 and VC1863 are direct targets of TarB

A and B) Shown are the interactions between TarB and the mRNAs of the genes

VCA0686 and VC1863 as predicted by TargetRNA. Shown in bold are the mutations we

made in either TarB born on the pJML01 plasmid or on the mRNA of the respective

genes on the chromosome. C) D) qRT-PCR carried out on VCA0686 and VC1863,

respectively, in the various mutant backgrounds after growth in AKI with induction of

TarB for 15 minutes. In the case of VCA0686, repression is restored in the double,

compensatory mutant strain. In the case of VC1863, mRNA levels increase in the double,

compensatory mutant. This suggests that TarB affects these transcripts by direct

RNA/RNA binding.

111
Discussion

Research into sRNAs in V. cholerae is increasingly showing that these sRNAs

frequently have multiple targets [111,178]. TarB appears to be no exception, having at

least four direct targets and numerous proposed indirect targets. These target genes are

associated with a wide variety of cellular processes including virulence via regulation of

TcpF and the tcp operon in general, chemotaxis as demonstrated by its effect on

production of a recently described novel cyclic dinucleotide [12], and nutrient uptake and

physiology as described here. The extent of our knowledge about the processes TarB

regulates are shown in Figure 6. The cumulative result of these complex regulatory

events appears to be an initial positive role in promoting colonization of the small

intestine, but later a slight inhibitory role on net multiplication.

Previous work in our lab has demonstrated that many genes not directly

associated with colonization and growth in the infant mouse model are expressed at this

late stage of infection [58]. Many of these genes are hypothesized to be important in

survival in the aquatic environment after release from the host. Two of the genes found to

be significantly repressed by TarB were previously identified as “late genes” and were

shown to plays roles in surviving the transition from the intestinal tract into pond water

(ref 28). Integrating our knowledge about the targets of TarB and its colonization

phenotype, we can begin to consider a model of TarB’s role during infection.

As has been previously established, repression of chemotaxis appears to be

important to the infectivity of V. cholerae [62,65]. A recent study showed that TarB

negatively regulates VC0177, and that VC0177 is a repressor of the dinucleotide cyclase

112
DncV [12]. DncV sythesizes the cyclic AMP-GMP dinucleotide, which represses the

expression of chemotaxis genes [12]. Thus, through this chain of regulation, TarB

appears to be functioning as a repressor of chemotaxis, which would be predicted to

increase colonization of the small intestine. At the early stage of infection, it appears that

TarB also represses expression of TCP and TcpF. Perhaps these colonization factors are

not needed at the earliest stages of infection or must be tightly related via opposing action

of the ToxT activator and the TarB repressor. In addition, as work here has shown, TarB

regulates other genes that are not required for colonization but instead have been shown

to be important for survival outside of the mouse (including VCA0686, VC1593, and

possibly VC1863). Indeed, expression of at least one of these genes (VC1863) appears to

be detrimental to colonization. All of these regulatory events therefore appear to be

important for early colonization and replication.

However, as the infection progresses, it appears that the repressive effect of TarB

on chemotaxis, tcp and/or other genes inhibits growth somewhat. Consistent with this

hypothesis, recent work using a GFP fusion to the tcpA and rrnB promoters has suggested

that those bacteria expressing TcpA to the highest level are also those bacteria located

adjacent to epithelial cells lining the wall of the small intestine and that is the most

rapidly growing V. cholerae sub-population [60]. Other studies have suggested that late

in infection, chemotaxis genes are up regulated to promote detachment from the intestinal

epithelium and entry into the lumen of the small intestine, or the so called “mucosal

escape response” [49]. One potential hypothesis would be that at later time points of

infection, TarB mediated repression of tcp and tcpF leads to inhibition of growth of these

strains, and thus a ΔtarB population in competition experiment would expand more and

113
overcome its initial colonization defect as we have witnessed in the time course

competition we have carried out here.

It is interesting to note that extended expression of TarB has different effects then

a short course of expression of TarB. Repression of TcpA and the tcp operon was seen at

15 minutes, but not 4 hours, which was confirmed by Western blot. Thus, another

possible explanation for the time-dependent virulence phenotype observed in the ΔtarB

mutant is that extended expression of TarB later in infection leads to different regulatory

events than when TarB is initially expressed early in infection. This could be due to

positive feedback wherein decreased expression of genes mediated by TarB may lead to

events that then cause those genes to be upregulated possibly over-riding TarB mediated

regulation. The low numbers of bacteria present in the small intestine in the infant mouse

model at early times of infection makes this hypothesis difficult to test using, for

example, qRT-PCR on TarB regulated genes. Thus, we have not investigated this

hypothesis experimentally.

Among sRNAs, TarB appears to be somewhat unusual. All of our investigations

into the contribution of Hfq to TarB stability and activity have suggested that TarB acts

independently of Hfq. The fact that TarB is Hfq independent has important implications

for our RNAseq experiments, it suggests that changes in gene expression we see in our

TarB over-expressing strain versus the null are not due to TarB occupying all free Hfq in

the cell. However, the over expression approach may reveal lower affinity interactions

between TarB and potential targets, these interactions may not be biologically relevant.

Additionally, TarB’s interaction VC1863 is somewhat unique, since it binds within the

coding sequence of the mRNA, but seems to enhance its stability, rather then prevent its

114
translation or enhance its degradation it. Other sRNAs identified that bind within the

coding sequences of messages are repressive [118], hence this may indicate a new mode

of sRNA regulation.

115
Table 2 Putative targets of TarB determined by transcriptional profiling using RNA-seq.

Gene Annotation Log2 fold p value 15 Log2 fold change p value 4

change min (pJML01- hours

(pJML01- tarB/vector only)

tarB/vector 4 hours

only) 15min

VC0837 toxin co-regulated pilus 0.094

biosynthesis protein F -3.5 4.20E-14 -0.66

VC0561 Phage integrase 0.0017

-0.23 0.64 1.27

VC1992 formyltetrahydrofolate 0.00039

deformylase

-0.4 0.33 1.46

VC1142 cold shock-like protein CspD 1.04E-08

-0.27 0.53 2.38

VC1863 amino acid ABC transporter, 5.39E-07

periplasmic amino acid-

binding protein

-0.49 0.24 1.92

VC2492 isopropylmalate isomerase 0.024

large subunit

-0.48 0.24 1.24

VCA0686 iron(III) ABC transporter, 1.78E-15

permease protein

-1.75 0.0024 -3.1

VCA0722 Hypothetical protein -0.04 0.93 -1.48 0.0049

116
VCA1051 Hypothetical protein 0.00015

-0.62 0.41 -1.54

117
Table 3 Genes within the Vibrio pathogenicity island 1 operon affected by TarB

expression.

Gene Annotation Log2 fold change p value 15 Log2 fold P value 4 hours

(pJML01- min change

tarB/vector only) (pJML01-

15min tarB/vector

only) 4 hours

VC0837 toxin co-regulated pilus

biosynthesis protein F -3.5 4.20E-14 -0.66 0.094

VC0828 toxin co-regulated pilin -2.34 6.77E-08 0.26 0.51

toxin co-regulated pilus

VC0836 biosynthesis protein E -2.26 8.83E-08 -0.46 0.31

toxin co-regulated pilus

VC0834 biosynthesis protein S -2.19 9.40E-08 -0.2 0.65

toxin co-regulated pilus

VC0835 biosynthesis protein T -2.22 1.48E-07 -0.42 0.34

toxin co-regulated pilus

VC0827 biosynthesis protein H 1.65 0.0046 2.3 1.48E-08

toxin co-regulated pilus

VC0826 biosynthesis protein P 1.64 0.0056 2.2 3.33E-08

VC0824 tagD protein -2.08 0.00028 0.32 0.43

118
Chapter 5 Perspectives and Future Directions

Future Directions

Here we have shown that new high throughput techniques can isolate sRNAs that

were previously undetected and could not be predicted using bioinformatics or older

sequencing methods [114,179]. In addition, we show the power of these tools to facilitate

genome wide searches for genetic elements. Our experiments have expanded the list of

possible sRNAs present in the V. cholerae genome and have expanded our appreciation

of the diversity of possible sRNAs within bacterial genomes as being transcribed not only

from intergenic regions, but from within ORF’s and anti-sense to them as well. Still, we

have only scratched the surface of transcriptional changes in V. cholerae that occur in the

sRNA size range during ToxT expression. As was previously mentioned, direct

sequencing and cloning in this experiment detected over twenty thousand potential sRNA

transcripts. While it is certain many of these cloned products were the result of random

RNA degradation, determining which transcripts are true sRNAs is an analysis we have

not completed. That being said, degradation products of larger transcripts can still have

biological activity, and some even require it [135]. This data set represents a large

potential pool of sRNAs many of which not have been predicted by bioinformatic

approaches, but the potential for false positives still exists. The data we have generated

here could guide further studies into sRNA discovery as well as the contribution sRNAs

make towards gene regulation during infection.

We have greatly expanded the list of putative ToxT binding sites within the

genome and though there is some disagreement between our data and ChIP-seq

119
experiments performed by other researchers, it is clear that ToxT influences more then

processes simply associated with expression of the classical virulence factors (the TCP,

CT and the accessory colonization factors). Either directly or via downstream regulators,

such as TarA and TarB, ToxT definitely has an impact on the physiology of the

organism. As was mentioned before, determining which of these binding sites are

relevant in vivo and which make significant contribution to gene regulation in vivo

remains to be determined.

Prior to this work, the existence of sRNAs under the control of the ToxR regulon

were hypothesized [114], but had never been isolated or observed. We now understand,

through our work and the work of two other labs [144], that not only do such sRNAs

exist, but one, TarB regulates the production of a novel cyclic di-nucleotide [12] and has

important effects on virulence gene regulation during infection [92]. Further study of

TarB and its downstream targets could yield valuable insights into spatial and temporal

expression patterns of virulence genes and help us understand better how the infectious

process is orchestrated by V. cholerae to the detriment of the host. Despite the work here,

a definitive explanation of TarB’s function in vivo remains elusive, though we do now

have an in-depth analysis of what it regulates. While we have elucidated much about the

regulation and targets of the TarB sRNA, its dynamic expression during infection

remains to be investigated. We generated a number of different transcriptional fusions of

fluorescent proteins to the TarB promoter, but none yielded detectable fluorescence in

sections of small intestine taken from mice infected with these strains, though they did

colonize to approximately wild-type levels (data not shown). Given the time-dependent

phenotype of the ΔtarB mutant and its regulation of genes that appear to be important for

120
survival outside of the host environment, understanding where and when TarB is

expressed would be critical to understanding its role in infection and to help us better

understand the infectious cycle of V. cholerae.

Transcriptional profiling of a TarB over-expressing strain compared to a null

yielded a large number of genes that were differentially regulated between the two

conditions. While direct binding could be predicted and validated for two of these

targets, the mechanisms by which the other genes are regulated, including the tcp operon,

remains unknown. Clearly TarB is effecting more then just virulence gene expression,

but what regulators are acting down stream of TarB? Are these targets transcription

factors or are they affecting mRNA abundance by some other mechanism? There is

clearly more to be done to understand the factors downstream of TarB.

Among sRNAs, TarB appears to be unusual. Its stability and activity appear to be

Hfq independent, which is not commonly seen among trans-acting sRNAs. It also

appears to regulate one of its targets (VC1863) by binding within the coding sequence of

that gene, another unusual feature. These findings highlight the diversity of sRNA-

mediated regulation in bacteria and suggest that new mechanisms and modes of

regulation by sRNAs remain to be discovered. It is possible that TarB acts through as-yet

undetermined mechanisms to regulate mRNA and protein levels, since it does not utilize

the classic Hfq machinery that many other sRNAs act through. Does it utilize other

chaperones instead? Or is this an unusual case of a sRNA acting completely on its own?

Investigating the mechanisms of TarB mediated regulation may reveal new insights into

how sRNAs regulate gene expression in bacteria.

121
 Because of these unusual findings with respect to how TarB works, it maybe

beneficial to determine what proteins TarB interacts with, if any. The use of RNA

aptamer tags would be particularly useful in this kind of study [180]. An aptamer tagged

TarB allele could also be used as biochemical evidence of TarB’s interaction with the

binding partners we elucidate in this study, strengthening the genetic evidence we have

already put forward.

Biochemical evidence of TarB’s interaction with the targets determined here

would be beneficial beyond simply confirming previous results. The genetic technique of

mutating a sRNA of interest, then mutating its target, and restoring the interaction

between the sRNA and the target by making the two mutations in the same bacteria is

powerful evidence of an interaction between the two molecules, but it is not without

potential fault. For example, mutating the sequence of the sRNA or the target could

disrupt secondary structure critical to function outside of the base paring interaction that

allows the two to interact, and may result in off target effects which may affect the

phenotype under study or make a negative result difficult to interpret. Co-purification of

target mRNA with aptamer tagged sRNAs or the observation of duplex formation by

alerted RNA mobility on native gels [130] would provide additional evidence for

interaction without potentially altering the sRNA or mRNA function.

Many unexplored avenues exist to determine what contribution TarB makes and

how other sRNA’s control gene expression during infection in V. cholerae. Though we

and other labs have begun to determine what genes are controlled by sRNAs in V.

cholerae, the data we have generated seems to suggest that there is a layer of control and

complexity to expression of virulence factors that has been previously unappreciated.

122
123
sRNAs as members of the ToxR regulon

In the course of this work we have uncovered two new sRNA members of the

ToxR regulon in V. cholerae, called TarA and TarB. Both are expressed from genes

within the Vibrio Pathogenicity Island-1 (VPI-1), an island that also harbors genes for the

TCP and virulence gene regulators. TarA and TarB were discovered independently by

other groups using different methods [12,144]. These two sRNAs take part in the

regulation of important processes during infection in animal models and they highlight

some important features of sRNA-mediated regulation.

A key facet of regulation by sRNAs is that it can occur very quickly. In an

examination of the genes controlled by ToxT by RNA-seq by another group, it was

shown that VC1863 was upregulated after 15 minutes of ToxT expression [12]; our work

here suggests that this upregulation of VC1863 occurs via TarB. This would indicate that

steady state levels of VC1863 could be increased without altering transcription of the

gene after only 15 minutes of expression of the primary factor upstream of TarB (ToxT).

Although direct targets of ToxT were also upregulated at this time, TarB may have the

advantage of acting on existing mRNAs. Within 2 minutes of induction of the TarA

sRNA, expression of its target, ptsG mRNA is reduced [144]. Such quick responses may

provide a fitness advantage during the highly dynamic and stressful infection process.

Another interesting feature of TarB is it’s ability to regulate a very recently

acquired genetic element. The Vibrio Seventh Pandemic island (VSP-1) is a gene cluster

that appeared to have emerged in the V. cholerae genome within the last century [10],

and yet TarB, which is encoded in the more ancestral VPI-1, is capable of regulating a

124
gene within this island. Recent publications suggest that sRNAs are emerging as

important regulators of genes acquired by horizontal transfer relatively recently in

evolutionary time. The mutation of a single base-pair within one of two homologous

genes acquired by horizontal transfer in Salmonella typhimerium resulted in

discrimination between the two transcripts by the SgrS sRNA [181]

This exemplifies what may be a unique ability of sRNAs to rapidly acquire new

targets. In order for a protein-based transcription factor to acquire a new target gene, the

amino acid sequence of the protein would need to mutate, or alternatively a DNA element

within the promoter of the target gene would need to mutate to allow an existing

regulator to bind. Such mutations in a hypothetical protein regulator would likely be a

very low frequency event, as it would require not only the proper amino acid change(s) to

recognize a new promoter, but the mutations must not adversely affect the folding or

stability of the protein, nor affect its binding to pre-existing targets. On the other hand,

mutation within the promoter region of the new target gene that results in the recruitment

of a pre-existing regulator is likely to be more relatively more frequent. But what about

sRNAs acquiring new target mRNAs? Mutations occurring within the 5’ UTR of an

mRNA that allow for targeting by a pre-existing sRNA should be on par, in terms of

frequency, with the mutations in promoter sequences that would allow binding of new

regulators. Both would require that mutations occur within the appropriate location

within the promoter/5’ UTR. However, perhaps the most frequent of all would be the

occurrence of mutations within pre-existing sRNAs that direct it to new target mRNAs.

Such an event was hypothesized to occur in the hld gene within the Staphylococcus

aureus agr locus [182]. This locus is thought to have mediated biofilm formation in non-

125
pathogenic strains of S. aureus, however the hld RNA transcript acquired mutations that

allowed it to become an RNA regulator of a large number of virulence-related genes and

it became a central regulator of virulence in some strains virulent strains of S. aureus.

This hypothesis is based on the nature of targeting by sRNAs, which typically occurs

through base pairing to mRNAs over relatively short sequences of pseudo-

complementary. Thus, new mutations could occur in in positions within the sRNA that lie

outside (or even in non-critical positions within) the pseudo-complementary regions in

order to gain a new target, but which do not adversely affect binding to the pre-existing

target. This may be how TarB evolved to control a recently acquired gene cluster.

TarA and TarB also highlight co-evolution between mobile genetic elements and

the core genome of pathogens. The VPI-1 is hypothesized to, at least at one time, have

been a mobile element, though experiments to prove this have been controversial

[43,183]. Despite this, TarA and TarB, which are encoded within the VPI-1, appear to

regulate genes outside the VPI-1 and within the core genome of V. cholerae, again

highlighting the ability of sRNAs to readily acquire new targets. TarA and TarB join a

growing list of sRNAs encoded by mobile elements in various bacteria that affect

expression of core genes [140,141,142].

Understanding TarB’s role during infection

The work we present here paints an interesting if sometimes contradictory picture

of what the role of TarB is during infection. While TarB appears to be generally

inhibitory towards virulence factor expression (e.g. repressing TcpA and TcpF), and to

126
chemotaxis as well [12], this regulation appears to be important only under a particular

set of conditions, those being early in infection and when coming from a resource poor

environment. However, as the infection progresses, TarB’s repression of these genes,

seemingly counterintuitively, results in reduced net replication of V. cholerae within the

host. But, perhaps there is a logical explanation to this finding. Previous work in our lab

using the infant mouse model has characterized 24 hours as a “late” timepoint during

infection, in which many genes that do not affect V. cholerae’s ability to replicate in the

host begin to be expressed [58]. Some of these genes are instead involved in

dissemination to the aquatic environment, a step which is clearly important to the life

cycle of this pathogen. Thus, perhaps TarB is needed to repress virulence genes at this

late stage of infection in order to allow a subset of bacteria to switch from a

“colonization/replication” mode of gene expression, to a “dissemination/nonreplicating”

mode of gene expression, and that is why we see the phenotypes we do.

A diagram of the current state of our knowledge based on our experiments and

other work on TarB is shown in Figure 5.1. It appears that quite a few processes are

affected by expression of TarB and the impact of TarB expression on those metabolic

pathways remains to be investigated, however, it does lend some insights into what

pathways may be important in the host. For example, maltose utilization genes have

previously been shown to be activated by ToxT [12]. They are however, repressed in the

TarB expressing strain at 15 minutes (see Appendix Table 3) and activated after 4 hours

of TarB expression (see Appendix Table 4). This may suggest that TarB initially

downregulates maltose utilization early in infection, but that this regulation is reversed

later in infection, hence different carbon sources may be utilized at different times.

127
 A process that is consistently affected by TarB expression is translation. A large

number of ribosomal proteins are downregulated in the TarB expressing strain at both 15

minutes and 4 hours of expression. This may indicate that TarB is repressing this process,

perhaps to allow for transition into the hypothesized dissemination state. Another process

that may regulate growth rate is TarB’s affect on amino acid metabolism, which is

affected differently depending on how long TarB is expressed. Although expression of

TarB showed no effect on growth in vitro (Figure 4.2), the contribution of TarB

expression to growth rate in vivo, where growth conditions are likely to be subobtimal,

remains to be investigated.

128
Figure 5.1 A map of TarB’s down stream regulated genes

Shown on the left are the genes that TarB has either been shown to directly regulate here

or elsewhere. Positive interactions are denoted with an arrow, negative interactions are

denoted with a blocked line. Downstream genes include the putative amino acid ABC

transporter VC1863, the putative iron (III) uptake system VCA0686, tcpF, potentially

VC2706, and VC0177, also known as vspR , which is a regulator of genes within the

VSP-1. Additionally, shown on the right are the results our transcriptional profile

experiment, which suggest that TarB, through one or more regulatory intermediates,

affects expression of the entire tcp operon, as well as effecting metabolic genes involved

in maltose metabolism, amino acid metabolism and nucleotide metabolism. These results

129
suggest a far more complex regulatory network influenced by TarB then was previously

appreciated.

130
Chapter 6 Materials and Methods

Bacterial growth conditions

V. cholerae O1 serogroup El Tor biotype isolate E7946 and derivatives were grown at

37°C in LB broth with aeration. For AKI induction, strains were grown in AKI broth

(1.5% peptone, 0.4% yeast extract, 0.5% NaCl, 0.3% NaCHO3) statically for 4 h at 37°C

followed by aeration for 4 h 37°C. To induce expression of cloned genes on plasmids,

arabinose was added to 0.04% (for pToxT derivatives) or 0.1% (for pJML01 derivatives)

upon reaching mid-exponential phase (optical density at 600 nm [OD] = 0.3). All DNA

manipulations were done in E. coli DH5α or derivatives with plasmids maintained with

the appropriate antibiotics.

Strain construction

All PCR reactions were carried out with EasyA polymerase according to the

manufacturer’s specifications using the indicated primers, the sequences of which can be

found in Table 4. The descriptions of all plasmids used in this study are included in Table

6.

Plasmids pToxT and pToxT ΔHLH plasmids we constructed by PCR

131
amplification of the toxT ORF including native RBS from gDNA from either wildtype V.

cholera E6749 or an E6749 strain carrying an internal deletion of the helix-loop-helix

DNA binding domain [57] using primers NcoI_ToxT_F and XbaI_ToxT_R. This PCR

product was then cloned into the NcoI and XbaI sites of the pBAD24 plasmid [184] to

allow expression of ToxT upon addition of L-arabinose. Unmarked deletions of

chromosomal genes were constructed by SOE PCR introduced using a derivative of the

pCVD442 allelic exchange vector, pCVD442-lac which contains the pUC19 LacZ gene

and MCS, as described [185].[185].

Point mutations in the tarB gene were generated by SOE PCR using primers

xbaI_TarB comp_F, TarB_mut_R1 and TarB_mut_F2 and SacI_TarB_comp_R, using

E6749 genomic DNA as template. PCR products were mixed in a one to one ratio, and

added to a PCR reaction run for 25 cycles at an annealing temperature of 50oC without

primers and the mutated sRNA sequence plus promoter were amplified with

XbaI_TarB_comp_F and SacI_TarB_comp_R which contain SacI and XbaI restriction

sites which were subsequently used for cloning into pMMB67EH to generate ptarB*. The

wildtype complementation vector ptarB was generated by cloning a PCR product

generated using XbaI_TarB_comp_F and SacI_TarB_comp_R primers and genomic

DNA as a template.

Point mutations in the tcpF 5’ UTR were also generated by SOE PCR using

primers XbaI_TcpF_mut_F1, TcpF_mut_R1, TcpF_mut_R2 and XbaI_TcpF_mut_R2

using an identical procedure as above. The final ~2kb product containing the mutated

tcpF 5’ UTR sequence which was subsequently cloned into the XbaI site of the

pCVD442-lac vector which was then mated into strains of interest. Double crossovers

132
were selected on 10% sucrose plates. Individual double crossovers were screened for the

mutated sequences by sequencing with the TcpF seq primer and the XbaI_TarB_comp_F

primer and confirming double crossover by streaking on 10% sucrose as well as

ampicillin containing plates to ensure sucrose resistance and ampicillin sensitivity.

C-terminal FLAG fusions to TcpF were generated by amplification of the C-terminal 346

bp using the TcpF_qt_F primer and the TcpF-FLAG_R primer to add the FLAG amino

acid sequence [186], this product was subcloned into Topo pCR2.1 (Invitrogen). The

resulting plasmid was cut using KpnI and EcoRV and the insert containing the C

terminus of TcpF with the FLAG fusion was cloned into a modified pGP704 suicide

vector [187] which contains a chloramphenicol resistance drug marker in place of an

ampicillin marker (pGP704cat). This construct was then mated into strains of interest and

single crossovers were selected for on chloramphenicol plates at 2 µg/mL. Proper

insertions were confirmed by PCR using the TcpF-FLAG reverse primer and TcpF seq

forward primer. A merodiploid strain was constructed by plasmid integration resulting in

the placement of GFP(ASV) under the control of one copy of the TarB promoter

followed by the native TarB locus downstream of the integrated plasmid sequence. The

plasmid borne fusion was generated by amplifying the +3 to -376 positions in the TarB

promoter from E6749 genomic DNA using primers TarB_F and TarB_-300_R and

subcloning the product into pCR2.1 yielding ptarB-300. GFP was amplified from

pGfpmut3.1 plasmid (Clonetech) using primers Fgfp2 and Rgfp2 which adds a ribosomal

binding site and SacI site at the 5’ end and the destabilizing (ASV) [158]C terminal

amino acids and a SmaI site at the 3’ end. The GFP(ASV) PCR product was cloned in a

triple ligation with the SacI/EcoRV fragment from ptarB-300 into pGP704cat digested

133
with SmaI to generate the transcriptional fusion. The resulting plasmid (pTarB-GFP) was

mated into E6749 strains and single crossovers were selected on chloramphenicol and

confirmed by PCR using primers Rgfp2 and XbaI_ΔTarB_R2.

sRNA deep sequencing

Single colonies of strain AC3763 (ΔtoxT) transformed with either pToxT or pToxTΔHLH

plasmids were picked and grown in LB broth containing streptomycin and ampicillin

both at 100 µg/mL overnight. Strains were back diluted from overnight cultures to an OD

of 0.03 in 200 mL LB supplemented with streptomycin and ampicillin both at 100 µg/mL

and were grown with aeration at 37°C until the strains reached mid-exponential phase

(OD = 0.3). Arabinose was then added to 0.04% to induce expression of toxT alleles from

pToxT plasmids, and induction was allowed to proceed for 20 minutes prior to RNA

extraction. Total RNA was purified from the bulk culture by phenol/chloroform

extraction and isopropanol precipitation. Cloning and sequencing of sRNA was carried

out as previously described [114], sequences of the micro RNA cloning linkers (IDT)

used are included in table S4. In order to further decrease tRNA and 5S rRNA in the final

sequenced products, the depletion step described in the previously published procedure

was carried out twice with the addition of an oligo targeting the serGCC tRNA (5’-

GCGGTGAGTGAGAGATTCGAACTCTC-3’). The final cDNA products were prepared

for Illumina Genome Analyzer II sequencing using Illumina primers 1a, 1b and 1c (table

S1) for the first 10 cycles of PCR, followed by gel purification and Illumina primers 2a

and 2b (table S1) for the final 4 cycles of PCR followed by PCR clean up (Stratagene).

Final products were run on a Bioanalyzer High-Sensitivity DNA chip (Agilent) prior to

134
Illumina sequencing to normalize loading of the two samples and ensure quality of the

libraries. The libraries were pooled and placed on one lane of an Illumina Genome

Analyzer IIx paired-end sequencing run at Tufts University Core Facility. Briefly, a

paired-end sequencing run sequences both the 5' and 3' end of every DNA molecule

attached to the flowcell. The first read is downstream of linker 1 and the second read is

downstream of linker 2 (ToxT library) or linker 3 (ΔHLH library) so that for every pair,

the directionality of the original RNA molecule could be determined. Sequence reads

were trimmed to remove linker sequences and filtered so that 100% of the sequenced

bases in each read had a minimum quality score of 5 (base call accuracy at least 68%).

Reads were aligned to the O1 biovar N16961 genome (NCBI Accession Nos.

NC_002505, NC_002506) using Bowtie (http://bowtie-bio.sourceforge.net). Reads

matching rRNA or tRNA regions were removed from the alignment, leaving 1,062,048

reads in the ToxTΔHLH library and 2,212,216 reads in the ToxT library. Unique

transcripts totaled 6,815 for ToxTΔHLH and 27,787 for ToxT. The alignments were then

processed to generate a library of clustered transcripts using the method previously

described [114]. This resulted in 3,309 clusters for the ToxTΔHLH library and 12,534

clusters for ToxT library. Clustered reads were output into "gff" format and viewed using

GenomeView (http://genomeview.org). The number of reads in sRNA clusters were

normalized by dividing the number of reads in that cluster by the ratio of MtlS reads in

that library to total MtlS reads. For example normalized readsToxT = cluster readsToxT/

(MtlSToxT/(MtlSToxT + MtlSToxT HLH)). In the final output table, a cutoff was made of at
Δ

least 500 normalized reads between either library. This generated a list of 765 potential

sRNA transcripts that represent the most abundant transcripts in either library which may

135
represent true sRNA transcripts.

ToxT overexpression and purification

E. coli strain BL21(DE3) was transformed with the plasmid pMAL-TEV-His-thr-ToxT

(table s3). The resulting strain was grown on LB agar plates containing ampicillin and a

single colony was picked for growth of a 4 mL overnight culture. The overnight culture

was used to inoculate 1 L LB broth containing ampicillin at 100 µg/mL and was grown

with aeration at 37°C. Transcription was induced once the culture had reached

exponential phase (OD=0.5-1) by addition of IPTG to 1 mM. Induction was allowed to

proceed shaking at 20°C for 16 h, after which, cell pellets were collected by

centrifugation and resuspended in 20 mL lysis buffer (20 mM Tris-HCl pH8, 2 mM DTT,

1 mM EDTA, 250 mM NaCl) plus Complete protease inhibitors (Roche). Cell pellets

were lysed and the lysate was cleared by centrifugation at 18,000 rpm in a SS34 rotor.

The cleared lysate was then applied to a 5 mL dextrin MBPtrap column (GE Life

sciences). The column was washed with lysis buffer followed by elution with MBP

elution buffer (as lysis buffer, + 1 mM maltose). The elution fractions were subsequently

diluted 10-fold with buffer QB1A (20 mM Tris-HCl pH8.0, 1 mM DTT) and applied to

an 8 mL Source15Q anion exchange column equilibrated in QB1A. The protein was

eluted using a 0 to 20% gradient of QB1B (20 mM Tris-HCl pH8.0, 1 M NaCl, 1 mM

DTT) developed over 25 column volumes. The peak fractions were diluted 5-fold in

SB1A buffer (25 mM phosphate buffer pH6.0, 1 mM DTT) and applied to a 8 mL

Source15S cation exchange column equilibrated in SB1A. The protein was eluted using a

15 to 35% gradient QB1B (25 mM phosphate buffer pH6.0, 1 mM DTT, 1M NaCl),

136
which resulted in two peaks, the second peak was known to be a soluble aggregate and

was discarded. The initial peak was split into two aliquots, one of which was applied to a

Superose 12 gel filtration column in EMSA buffer (10 mM Tris-HCl pH7.5, 200 mM

KCl, 10 mM βME) for use in mobility shift assays, the other aliquot was cleaved with

TEV protease overnight at 4°C and subsequently diluted 5-fold in SB1A and applied to a

2 mL Source15S cation exchange column to separate His-ToxT from the cleaved MBP

fusion protein. His-ToxT was eluted from this column with a 35 to 100% gradient of

SB1B developed over 12 column volumes. Finally, His-ToxT peak fractions were applied

to a Superdex 75 gel filtration column in EMSA buffer. These final steps did leave a

small amount of TEV protease in the final purified product.

Affinity purification of ToxT binding sequences

Genomic libraries were prepared by centrifuging 10 mL of overnight growth of wild type

(AC53) V. cholerae, washing 2x with TBS and resuspending in 5 mL TBS. To generate

gDNA fragment sizes of 300 to 1,000 bp, the cell pellet was subjected to four 30 second

sonication cycles on ice using a sonicator micro tip (Branson); each sonication cycle was

separated by a 30 second incubation on ice. After sonication, RNAase A was added to a

concentration of 2 µg/mL, the samples were incubated at 37°C for 20 min to allow for

degradation of RNA. DNA was purified with 2 rounds of extraction with citrate buffered

phenol:chloroform (Ambion) followed by a final extraction with chloroform only and

then concentrated by ethanol precipitation. Fragmented DNA was used to prepare three

different bar-coded libraries using adapters BC1a/BC1b, BC2a/BC2b and BC3a/BC3b

(Table 5) as described [151]. For the final amplification and purification of bar-coded

137
libraries, ten PCR reactions were done using linkered and size selected gDNA as template

using primers Olj 139 and 140 and EasyA polymerase (Stratagene). PCR conditions were

as follows, denaturation for 5 minutes at 95°C, annealing for 30 seconds at 65°C,

elongation for 30 seconds at 72°C, cycling back to denaturation at 95°C for 30 seconds

for 15 cycles after which reactions were pooled and incubated with 50 µL ExoSAP-IT

(USB) at 37°C for 1 h. Final purification of libraries was carried out by

phenol:chloroform extraction and ethanol precipitation and resuspension of libraries in

100 µL deionized water.

Binding reactions contained 15 µg bar-coded DNA library in a total volume of

250 µL with 200 nM purified His6-tagged ToxT purified as above or with His6-tagged

TEV protease in EMSA buffer with 10 µg/mL sheared salmon sperm DNA, 0.3 mg/mL

BSA and 10% glycerol. Reactions were allowed to incubate with gentle mixing at 37°C

for 1 h, after which the reaction was added to a microcentrifuge spin column (Pierce)

packed with a 50 µL bead volume column of HisPur cobalt resin (Pierce) that had been

equilibrated in the above buffer. The reaction was allowed to bind to the column by

mixing gently at 37°C for 1 h. Flow through was then collected by spinning the column

in a microcentrifuge at 3,000 x g for 1 minute. The column was washed 3x by gentle

resuspension of the bead volume in 250 µL of EMSA buffer with the above additions,

followed by centrifugation. The column was washed an additional 3x as above, but in

EMSA buffer only. After the final wash, the bead volume was resuspended in 10 mM

Tris-HCl pH8 and boiled for 5 minutes and allowed to cool to room temperature, then

incubated with proteinase K (5 µg/ml) for 30 minutes at 65°C, followed by boiling for 5

minutes. After centrifugation for 1 min at 3,000 x g, the resulting 100 µl of the

138
supernatant fluid was purified by using a PCR purification kit (Qiagen) and then

subjected to 10 cycles of PCR amplification with primers Olj139 and Olj140, repurified,

quantified on the Bioanalyzer high sensitivity DNA chip (Agilent), and subjected to deep

sequencing, along with aliquots of the input libraries prior to pulldown, using the

Illumina Genome Analyzer II on the paired end setting.

Reads from the Illumina libraries were aligned to the N16961 genome. Sequence

alignment and assembly were performed as described above. After alignment, reads that

did not match the genome were discarded and the sets were normalized so that each set

contained the same number of reads. Alignment positions were shifted by half their insert

length as determined by each mapped pair, giving the center position of each sequenced

DNA molecule. These positions were then tabulated and used to generate a coverage map

of the genome using a rolling average with window size of 35 bases. Coverage maps

were generated for every sample. For each genomic DNA and corresponding pulldown

sample, an enrichment map was created, which represented the ratio of the values from

the pulldown sample over that of the genomic DNA sample. Enrichment maps were then

scanned to identify regions that had more than 3x the average coverage for more than 100

consecutive positions. The false discovery rate (FDR) was then calculated by performing

the same analysis with the control and pulldown samples switched. At 3x coverage, the

FDR was 0.03 and 199 enriched sites were identified totaled between the libraries, of

which 67 were observed in both replicates. Significance of each enriched region was

assessed using two methods [188]. First, the number of reads in that region in the control

sample was used to generate a Poisson distribution. This was then used to assess the

probability of the same number of reads occurring in the pulldown sample. Using this

139
method, all regions identified had a p-value of < 1x10-98. Second, a Z-score was found by

comparing the proportion of tags in the control sample to that in the pulldown. All of the

regions identified had a significant difference in the proportion of tags counted between

the control and pulldown samples, with z-scores > 7.7. The nucleotide sequences from

the overlapping set were used as a training set for finding motifs using MEME 4.1.0. We

allowed MEME to find motifs that occurred at least one time in each fragment. The motif

reported in Figure 2.1 Panel C is the lowest E-value motif for the 67 sites combined in

both libraries.

Mobility Shift Assays

Primers TarB promoter R and TarB promoter F were used to amplify the upstream 100

bp of TarB, predicted to contain promoter elements and ToxT binding sites to serve as a

probe in the mobility shift assay. The PCR product was purified (Stratagene) and 3.3

pmoles was end-labeled using T4 Polynucleotide Kinase (NEB) and 32P γ-ATP according

to the manufactures instructions, and then purified using a Performa DTR spin cartridge

(Edge Biosciences). A negative control probe of similar size consisting of 4.5S RNA

sequence was prepared in parallel. The binding reaction occurred in 20 µL with 3 nM

labeled probe and varying concentrations of purified MBP-his-thr-ToxT in EMSA with

10 mM 10 µg/mL sheared salmon sperm DNA, 6 µg/mL BSA, 10% glycerol and 0.002%

Orange G dye added. Binding was allowed to occur for 30 minutes at 30°C followed by

loading of the entire reaction onto a 5% TBE-Polyacrylamide gel, which was then run at

140
100V for 60 minutes. The gel was then used to directly expose a phosphor screen and the

image was read on a FLA-9000IR using the IP setting.

AKI induction experiments

For AKI induction experiments, strains were grown overnight with aeration at 37°C in

LB broth containing streptomycin at 100 µg/mL, and the appropriate antibiotics for

vector maintence (ampicillin at 50 µg/mL for pMMB-based plasmids, ampicillin at

100µg/mL for pBR based palsmisd). For strains carrying the TcpF C-FLAG integration

in the wild type background and TarB-GFP strains, chloramphenicol at 2 µg/mL was

included as well. Overnight cultures were then diluted into prewarmed AKI media [161]

containing 0.3% NaHCO3 and ampicillin at 50 µg/mL (again excluded for the wild type

background strain and TarB-GFP fusions) to an OD of 0.01. Strains were grown statically

in an incubator at 37C for the indicated times at which culture aliquots were removed for

analysis. After 4 hours of static growth, cultures were split into 1 mL aliquots and grown

shaking at 37C for 4 hours. For induction of pJML01-based plasmids during AKI growth,

L-arabinose was added to a final concentration of 0.1% either at the end point of static

growth, or it was included in the medium during growth

Anaerobic growth

For anaerobic growth experiments, overnight cultures were prepared by inoculation of

strains into phosphate buffered LB media containing 60 mM K2HPO4, 33 mM KH2PO4,

0.5% glucose and 100 µg/mL streptomycin. These cultures were grown overnight in an

anaerobic chamber and used to subsequently inoculate either 2 mL aerated cultures or 10

141
mL cultures in sealed tubes prepared in the anaerobic chamber to an OD of

approximately 0.01. Aerobic and anaerobic cultures were then grown in parallel in a

shaking 37C incubator to approximately the same OD and snap frozen on liquid nitrogen

and subsequently used for RNA extraction and northern blots. For each culture the pH of

the media was measured after growth was recorded and ranged between 6.3 and 6.5 for

anaerobic cultures and 6.7 to 6.8 for aerobically grown cultures.

Pond Water Incubations

For pond water incubation experiments, strains were grown overnight on M9 minimal

media + glucose plates containing the proper antibiotics. Overnight growth was

resuspended in saline and washed twice. After the final wash, strains were resuspended in

filter-sterilized pond water and inoculated into 2 mL culture tubes of filter sterilized pond

water to an OD of 0.1 and incubated shaking at 37oC for the indicated times. At those

times, culture aliquots were prepared either for western blot by centrifugation followed

by resuspension in sample buffer and boiling or diluted to a density of 1 x 103/µL as

measured by OD for mouse infections.

ToxT induction experiments

Experiments involving induction of ToxT from the arabinose inducible plasmid were

carried out similarly to those used in sRNA sequencing experiments. Overnight cultures

of the indicated strains were grown at 37°C overnight in LB containing the appropriate

antibiotics. Overnight cultures were then diluted to an OD of 0.03 in 25 mL of the same

media and allowed to grow shaking at 37°C. Once cultures reached mid-exponential

142
phase (OD =0.3), arabinose was added to a final concentration of 0.04% and induction

was allowed to proceed for 1 h with 2 mL aliquots of culture taken at the indicated times

and either spun down for western blot analysis or snap frozen in liquid nitrogen for RNA

extraction later.

Northern Blots

Between 2.5-10 µg of total RNA purified using the Ambion mirVana kit from the

indicated cultures was run on 10% TBE-urea polyacrylamide gels. Prior to transfer, gels

were stained with GelStar (Invitrogen) and scanned on the FLA-9000IR (Fuji) to assess

total RNA loading in each well and to use for normalization during quantification. RNA

was transferred to Hybond N+ membranes (Amersham) in 1x TBE using the Mini Trans-

Blot Cell apparatus (Bio-Rad) according to the manufacturer’s instructions. Blots were

prehybridized in Ultrahyb (Ambion) prior to addition of probe. RNA probes were

transcribed from PCR-derived templates with T7 promoters using 32P-UTP and T7

polymerase (Promega) according to the manufacturer’s instructions. Ambion Decade

ladder labeled with 32P-ATP was run alongside RNA samples to provide estimations for

the sizes of RNA bands. Hybridzation was carried out at 65°C overnight followed by

washing 3x with low stringency buffer (2x SSC + 0.05% SDS) wash at room temp,

followed by washing 3x with high stringency buffer (0.2xSSC + 0.05% SDS) at 65°C.

Blots were then exposed to phosphor storage screens (Fuji) overnight. The image was

subsequently read on a FLA-9000IR scanner. When reporting quantification,

measurements taken from the phosphor screen after exposure were divided by fluorescent

measurements of the 5S rRNA taken prior to transfer to normalize signal for loading

143
using the MultiGage software (Fuji).

qRT-PCR

Total RNA was purified from cultures grown under the indicated conditions using the

mirVana RNA purification kit. Total RNA was treated with DNAase with the TURBO-

DNAfree kit (Ambion) prior to reverse transcription. cDNA used as template was

generated using iScript complete kit (BioRad) from 2 µg of total RNA using random

hexamers. Quantitative PCR was run using Strategene Mv3005P equipment and MxPro

qPCR software. Each sample was measured in technical triplicate. In all cases, controls

lacking reverse transcriptase were included to assess DNA contamination, all results were

either below the baseline of detection, or were subtracted from values obtained with those

templates.

Western Blots

For western blot analysis of TcpF and GFP expression, strains carrying the TcpF C-

terminal FLAG allele or the TarB-GFP fusion were grown under the indicated conditions

at which times 2mL culture aliquots were removed. Culture aliquots were immediately

centrifuged at 10,000 x g for 5 minutes to pellet cells, and supernatants were removed.

Cell pellets were boiled in 50 µL (static timepoints and plasmid induction experiments)

or 100 µL (4 h aeration timepoint) of SDS loading buffer (50 mM Tris-HCl, pH6.8, 2%

SDS, 0.5% bromophenol blue, 10% glycerol, 100 mM βME). Samples were cooled and a

144
volume adjusted for differences in OD was loaded on an SDS-polyacrylamide gel

electrophoresis (PAGE) gel and run 90 minutes at 125 V. Proteins were transferred to a

nitrocellulose membrane at 25V for 1 h. Membranes were loaded onto the SNAP-ID

Western blotting system (Millipore) and blocked with 1x NAP blocking agent (G

Biosciences) diluted in PBS + 0.01% Tween-20. Primary antibody to the FLAG peptide

(Invitrogen) or against GFP (Abcam) was added to the membrane 1:600 or 1:1200

respectively, diluted in 3 mL 1x NAP block for 10 minutes and the membrane was

washed with 90 mL PBS + 0.01% Tween-20. Secondary antibody (Invitrogen) (Cy5

conjugated goat anti mouse for anti-FLAG blots or Cy5 conjugated goat anti rabbit for

GFP blots,) was added to the membrane at 1:600 and diluted in 3 mL 1x NAP block for

10 minutes and the membrane was washed with 90 mL PBS + 0.01% Tween-20. Bands

were visualized using the Cy5 setting the FLA-9000IR. After visualization of TcpF-

FLAG, blots were stripped by incubating in 20 mL acid stripping buffer (25 mM glycine

pH2, 1% SDS) shaking for 30 minutes followed by washing 2x with 20 mL PBS + 0.01%

Tween-20. After stripping, blots were reprobed as above with primary anti-OmpU at

1:600 in 1x NAP block and secondary Cy5 conjugated goat anti-rabbit (Invitrogen) again

in 1x NAP block and scanned on Cy5 setting on the FLA-9000IR.

Fluorescence measurements were quantified using MultiGage software (Fuji).

Measurements TcpF-FLAG bands, adjusted for area and background, were divided by

fluorescence measurements of corresponding OmpU bands adjusted for area and

background. Loading-adjusted fluorescence values were then standardized to wild type

expression and reported as fold expression of TcpF relative to wild type expression. The

experiment shown is representative of six biological replicates.

145
Western blots to determine TcpA expression in strains harboring pJML01 based plasmids

during AKI growth were performed as above with the following exceptins. The primary

antibody (rabbit anti-TcpA) was at a 1/3000 dilution in NAP block made in TBS/T (Tris-

buffered sailine with 0.01% tween)

Mouse infections

Single strain infections and competition assays in infant mice, LB broth and filter

sterilized pond water were performed with the TarB unmarked deletion strain (AC3744)

(LacZ+) and wild type with a lacZ deletion (AC3745) for 24 h as described [189].[189].

Inputs for competition assays and single strain infections were prepared by growth

overnight on LB plates containing the appropriate antibiotics followed by resuspension in

LB to an approximate density of 1 x 103/µL as measured by OD, mixing of equal

volumes of either culture (for competition experiments) then inoculation of infant mice

by oral gavage. Samples from pond water incubations were prepared as described above,

mixed in equal volumes and then used for innocualtion of infant mice. Immediately after

inoculation, input ratios and total CFU were determined by plating on LB plates

containing 5-bromo-4-chloro-3-indolyl-D-galactopyranoside (X-gal). The target input

dose for all experiments was 105 bacteria/mouse, although over the course of the

experiments doses ranged between 104 and 106. Results are shown by the competition

index (CI), which is the ratio of mutant CFU to wild type CFU normalized for the input

ratio. To show complementation in trans in all assays in this study, ΔtarB derivatives

(LacZ+) were complemented with either ptarB or ptarB* and were competed against the

146
respective isogenic strain (LacZ-) carrying the pMMB67EH plasmid alone. CIs for these

experiments are expressed as the ratio of mutant to complemented CFU corrected for

input. To assess plasmid loss frequency, output plates were replica plated onto LB agar

plates containing streptomycin and ampicillin at 100 µg/mL and X-Gal at 40 µg/mL to

determine plasmid containing CFUs, and LB agar plates containing streptomycin and X-

Gal to determine total CFUs.

Growth curves

Growth of strains was determined by measured OD using a Bio-Tek microplate reader.

Cultures grown overnight in LB plus streptomycin and (ampicillin at 50µg/mL for

complemented strains) or M9 glucose plus streptomycin and (ampicillin at 50µg/mL for

complemented strains) were resuspended to an OD of 0.01 in the respective media and

pipetted into a 96-well plate in triplicate. Each growth curve was performed in biological

triplicate. Bacteria were grown with aeration for 17 h at 37°C in the microplate reader

with the OD being read every 17 minutes.

RNA-seq experiments

For each RNAseq experiment, three biological replicates were prepared from

cultures carrying pJML01-tarB or pJML01 only after induction for the entire course of

AKI growth or for 15minutes at the end point of AKI growth. Strand specific cDNA

libraries were prepared for Illumina sequencing using the dUTP labeling method as

147
described by Levin et al [174] with some modifications.Strand specific cDNA libraries

were prepared for Illumina sequencing using the dUTP labeling method as described by

Levin et al [174] with some modifications. Total RNA was extracted using the RNAeasy

kit (Qiagen) and was treated with Microbe Express (Ambion) to deplete ribosomal RNA.

RNA was then sheared by sonication in a Branson Sonifier cup sonicator (ask Ayman

about this) at maximum amplitude for 2 minutes total with 10 second pulses on and 5

seconds off.

Sheared RNA was then reverse transcribed using SuperScript III RT (Invitrogen)

using a modified protocol. The reaction was carried out with 250ng of random hexamers

with a 1 hour extension time at 55C and no heat denaturation step. RT reactions were

cleaned up on Performa spin columns (Edge Biosciences). Second strand synthesis was

carried out with the given units of the following enzymes, 2U RNAaseH, 40U E. coli

DNA polymerase I, 10U E. coli DNA ligase in NEB 10x Second Strand Synthesis buffer

supplemented 4mM DTT and 800 µM dNTPs with dUTP substituted for dTTP for 2.5

hours at 16C. Second strand synthesis reactions were then cleaned up with a PCR clean

up column (Stratagene). Double stranded cDNA was then blunted with NEB quick

blunting kit, A tails were then added using Exo – Klenow fragment (NEB) and Illumina

TruSeq adapters were ligated with the NEB quick ligation kit. Final linked cDNA

products were then gel purified or treated with Aline Size Selector beads to isolate

fragmetns between 200 and 400bp in length. Size selected, linked cDNA wa then treated

with 1U of USER enzyme (NEB) to remove dUTP residues incorporated into the second

strand. USER was heat inactivated and cDNA was amplified using primers Olj344 and

Olj335 and Phusion DNA polymerase in High Fidelity buffer (NEB). Libraries were

148
sequenced on the Illumina Hi-Seq at the Tufs University Genomics Core Facility

Analysis of transcript abundance was performed to compare cultures expressing

TarB from vector alone using the CuffDiff [190] software package to perform RPKM

analysis. Each set of 3 biological replicates was compared to the corresponding replicates

carrying vector only, a cut off of p < .01 was used to determine genes that were

significantly differentially regulated between the strains.

Table 4 Primers used in this study

Name Sequence
ToxT_NcoI_F GCCCATGGTATCTTCAGAGTAGAACGCAATGA
ToxT_XbaI_
R GCTCTAGATTATTTTTCTGCAACTCCTGTCA
CTCTTTCCCTACACGACGCTCTTCCGATCTGATTGATGGTGCC
IL1a TACAG
GGCATTCCTGCTGAACCGCTCTTCCGATCTGTCCTTGGTGCCC
IL1b GAGTG
GGCATTCCTGCTGAACCGCTCTTCCGATCTGCTGGAATTCGCG
IL1c GTTAAA
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACAC
IL2a GACGCTCTTCCGATCT
CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGC
IL2b TGAACCGCTCTTCCGATCT
ΔtoxT_F1_(X
baI) GCTCTAGATTCTCTGCTCGGCTTTTAGC
GTAAACGTATTCCATTACATTGCGTTCTACTCTGAAGATATAT
ΔtoxT_R1 A
CAGAGTAGAACGCAATGTAATGGAATACGTTTACTTGATCCT
ΔtoxT_F2 A
ΔtoxT_R2_(X
baI) GCTCTAGATTTGACACATCGACCTTGGA

149
ΔtoxT_F0 CTACGGATTCAAGGGGGAG
ΔtoxT_R0 TCCTGAACGTCATCTAGTGGT
toxT_NdeI_F GCCATATGATTGGGAAAAAATCTTTTCAAACTAA
toxT_BamHI
_R GCGGATCCTTATTTTTCTGCAACTCCTGTCAACAT
MtlS_Rev CCGTTGGTGATTCCATTCG
MtlS_For TCCCCCGTTGGATGTTCCG
ΔtarA_F1-
SphI GCGCATGCTCGCTTGTATGTTTGGACGA
ΔtarAR1 TTCGGTTTAGCACTCCCTAACTTTATTTTCCTAAAGACAAA
ΔtarA_F2 GGGAGTGCTAAACCGAATGAATTATAATGAGAATTACTTT
ΔtarA_R2-
SphI GCGCATGCCCCCCAAGCTTTTAATTTTT
TAATACGACTCACTATAGGGCGCCAAAAAGTGCTTAATCG
T7_tarB_F
tarB_R AAAACAAAATCATCTTTCATAACAGC
ΔtarB_F1_Xb
aI GCTCTAGAGTGTTGGTGCTGCACACTCT
ΔtarB_R1 AGCAATGTAACCAACCTCAAATATTAACCCTTAGGATATTC
TTGAGGTTGGTTACATTGCTTTTTAACGCTCTTGTTTCTATTTA
ΔtarB_F2 AGC
ΔtarB_R2_Xb
aI GCTCTAGACCTTTCCCAAATTGAGTTCG
Δhfq_F1_xbaI GCTCTAGAACTGATTTATCGAGGGATGG
Δhfq_R1 GATCCAGAAATGGGTCTTGTAGAGATTGCC
Δhfq_F2 CCCATTTCTGGATCGTCCAGCAGAGAAGTCT
Δhfq_R2_xba
I GCTCTAGATTACGCAAAGTAGGATCGAG
T7_tarA_F TAATACGACTCACTATAGGG CCAAACGTAAGGGGCAAAAT
tarA_R ATAATTCATTCGGTTTAGCACTCC
tarA_comp_F GATGTGAAAAATCAGCTTTTATCGT
tarA_comp_R
_ ATTTGCAATCTAATTCTGCAGTTG
xbaI_tarB_ co
mp_F GCTCTAGATTGAGGTTGGTTACATTGCTATAA
sacI_tarB _co
mp_R GCGAGCTCGCTTAAATAGAAACAAGAGCGTTAAAA

TarB_promot TGTATGTTTATAGTGCCAGTAT

150
er_F
TarB_promot
er_R_-100 CATAAGCTTAAATAGAAACAAGA
TarB_promot
er_R_-300
TTTAAAGATAGAGTGATCGCG
4.5s_F CTGGTCCTCCCGCAACAC
4.5s_R GAGACCCCAGCCACATC
TcpF_mut_F1
_-_xbaI GCTCTAGAGAGGGAGTGGGCATCTATGA
tcpF_mut_F2
TTCTAGTTTATAGTGAGGTATTATGAGATATAAAAAAACCTT
AATG
tcpF_mut_R1 ATACCTCACTATAAACTAGAACTTAGTTTATCAACGAGCG
tcpF_mut_R2
_-xbaI GCTCTAGACCGTTAAGTTGCCACTAGGC
tcpF_mut_F0 TGAAAATTATCTCCAAGAAGTATAGGC
tcpF_mut_R0 TTGACCACTTGTAACCATTATGC
CATGATATGTTACAAGCTGACCTATAAGCACTTTTTGGCGCA
tarB_mut_R1 CTGCGG
TTATAGGTCAGCTTGTAACATATCATGAGGTAACCGCTCATG
tarB_mut_F2 TATG
tcpF_qt_F TGGTGCAATGATCGCAGTAT
tcpF_qt_R CCGTTAAGTTGCCACTAGGC
Vca_0638_qt
_F CGGTTTAGTGCGCCATTATT
Vca_0638_qt
_R CCATACACTTCCGCCAGAAT
Vc0177_qt_F TAACGGTGAAGGGAGTGGTC
Vc0177_qt_R TGGTTCCAGTTCAGGGAATC
Vc0937_qt_F TTGGTTGATGTGCAAGGTGT
Vc0937_qt_R TCAGCGACTTTCAAATCACG
Vc2506_qt_F CAGCCAAGCTCAACAAAACA
Vc2506_qt_R CATCAAACAGGCTCAAAGCA
CadC_qt_F TATGTGGTGACGGTGCCTAA
CadC_qt_R TTCGGCTTGCTTGATTTCTT
tcpF_C- TTAGCTCTAGTTATTTGTCATCGTCATCCTTGTAGTCTTTAAA
FLAG-_R GTTCTCTGAATATGC
Olj139 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACAC

151
 GA
CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGC
Olj140 TGAAC
GCGAGCTCTTTAGGATTTATTAAAATGCGTAAAGGAGAAGAA
CTT
Fgfp2
GCGCCCGGGCTAAACTGATGCAGCGTAGTTTTCGTCGTTTGCT
GCAGGCCTTTTGTATAGTTCATCCATGCC
RGFP2
nheI tarB F GCGCTAGC ACATGAGCGGTTACCTCATG
sphI tarB R GCGCATGC AACAAAAAAAAGGCGCACCGC
Olj 335 CAAGCAGAAGACGGCATACGAGAT
Olj 344 AATGATACGGCGACCACCGAGATC
Vca0686 qt F CCTACTCTAGCTTCTGTATGCTGG
Vca0686 qt R GAATGATGCTGATCAGTGAGCC
VC1142 qRT
F GTTTTATTTGCCCGGAAGGT
VC1142 qRT
R TTGCTGATTGTCCCTCGATT
VCA0722
qRT F GATCCAACAGGCGAGCTTAC
VCA0722
qRT R GTTTGTTCCAATTCGGCTGT
VCA1051
qRT F GACATTGGTACCAGCGGTTT
VCA1051
qRT R TGGCACCACAGTTTTACCAA
VC1863 qRT-
GAGATGCAAGTGGAGTGCAA
F
VC1863 qRT-
ACGCCCTTCAAACCTTCTTT
R
VC2492 qRT-
TGGCGATCATTGGTAAAACA
F
VC2492 qRT-
TTGCCAATAGTCGACAGCAG
R
VC1992 qRT-
CCACTGTGTGTCCCATGAAG
F
VC1992 qRT-
GGCAAGAAACTGTGGTGGAT
R
VC0516 qRT-
GCGAATATGGCGCTAAAGAG
R

152
VC0516 qRT-
TGAGTTTTCTGCGTTGTTCG
F
FRT-Kan F ATTCCGGGGATCCGTCGAC
FRT-Kan-R TGTAGGCTGGAGCTGCTTC
ΔVC1142 F1 TGAAAGCGACCATGATGAAA
GTCGACGGATCCCCGGAAT
ΔVC1142 R1 TAGTGGATTGATTGCCACACTAGC
GAAGCAGCTCCAGCCTACA
ΔVC1142 F2 CATCCCTCATGCATTTTATAACTGATG
ΔVC1142 R2 CACACTGCGCTGAATCACTT
Δvca0722 F1 CACTGGCACTTTCTTCGACA
Δvca0722 R1 GTCGACGGATCCCCGGAAT CATCGCGCTTACCTCATCGTTA
GAAGCAGCTCCAGCCTACA
Δvca0722 F2 TAAGCCAAACTGTAAGCTTTTTTATC
Δvca0722 R2 CGGTCTTTGCCCAAATTAAA
Δvca1051 F1 CTTGCGTACCTTGTGGGATT
GAAGCAGCTCCAGCCTACA
Δvca1051 R1 TAATACGCTTTAATACCGAACTCAC
Δvca1051 F2 GTCGACGGATCCCCGGAAT CATTACCTTACCTCACGTTGTTG
Δvca1051 R2 TGCTGTGATTGCCTCTATCG
Δvc1863 F1 GAGGTTTTAGGTAGGCAAG
GTCGACGGATCCCCGGAAT
Δvc1863 R1 AATAAAAGCGCTTCTTATCACTTCG
GAAGCAGCTCCAGCCTACA
Δvc1863 F2 CATACTCCTGTGATTGTTTGTCTTA
Δvc1863 R2 GTCAAATGGGCTACTTCTAACA
Δvc1992 F1 TGTTCGGCTCGGGTAAATAG
GTCGACGGATCCCCGGAAT
Δvc1992 R1 CATTGATAACAACTTCCATGCAAAAA
Δvc1992 F2 GAAGCAGCTCCAGCCTACA TAACGAACCCTCAGCAGT
Δvc1992 R2 GCTTGATTGTGACGGGTG
Δvc2492 F1 CAGTGTATCTATCGCATC
Δvc2492 R1 GTCGACGGATCCCCGGAAT CATTGCTTCTTCCTTGAG
Δvc2492 F2 GAAGCAGCTCCAGCCTACA TAATTCAAGGAGAACCCCA
Δvc2492 R2 AATAAAGGGATAGCTCAGG
ΔVC0516 F1 GCAAAGCTTAGTTGCCGAAG
GTCGACGGATCCCCGGAAT
ΔVC0516 R1 TAGTAGTAATAAACAATTCTAAGGCC

153
 GAAGCAGCTCCAGCCTACA
ΔVC0516 F2 CATGATGTACCACCAAAATAGTC
ΔVC0516 R2 GTTCAAAGTGCGATTGCTGA
SacI VC1863
F GCGAGCTC ATTTATTAGATGGGCAAATAGAGGC
XbaI VC1863
R GCTCTAGA TTATTCACCGTAAACGTCATACTTG
VC1863 mut
R1 AAAAAGTGGTTATATGGGACAGCATTAATTGCCACAACATAT

VC1863 mut
F2 GTTACCCCACTATATGTTGTGGCAATTAATGCTGTCCC

VCA0686
mut sacI F1 GCGAGCTC CGCAAAAATTGATGCAGAGA

VCA0686
mut R1 TTCGTGCaTgcacaaaccttattattgactcgg TGAGTCGCACTTAACCTGC

VCA0686 ccgagtcaataataaggtttgtgcAtGCACGAA
mut F2 CATGAGCCTTCTCAAGCGCT
VCA0686mut
R2 xbaI Gctctaga CTTCTTCCAACGAAGGATGC
tarB VC1863 CTTATAGGTCAGCTTGTAACAATACATGAGG
mut R1
tarB VC1863 TGTTACAAGCTGACCTATAAGCACTTTTTGG
mmut F2
tarB TTCGTGTATTCATACAAGCTGACGATTAACG
VCA0686 F2 ACTTTTTGGCGCA
tarB CGTTAATCGTCAGCTTGTATGAATACACGAA
VCA0686 R1 GTAACCGCTCAT
vrrA R t7 TAATACGACTCACTATAGGGAAAACGCCCAAAACAATCTG
vrrA F ACTGGCCGTCAAATTTGGTT
tarB R AAAACAAAATCATCTTTCATAACAGC

T7 tarB F TAATACGACTCACTATAGGGCGCCAAAAAGTGCTTAATCG
DtarC F1 TAGCGTCGAGATGACACACC
GTCGACGGATCCCCGGAAT
DtarC R1
TTTCACAGAAAGACGCAAAAAAAGA
GAAGCAGCTCCAGCCTACA
DtarC F2
AACTGATTTCATAATCTGTATCAAAAAAAAT

154
DtarC R2 AGGCAAGTGAAGCAACATCA
sacI TarC F GC GAGCTC GCCTTTACACCAGAGCCAAT
xbaI TarC R GC TCTAGA CCACCCCAAACATACAAACA

Table 5 Barcoded adapters and sRNA cloning linkers for constructing Illumina
sRNA-seq libraries [151]

Name Sequence barcode

Linker1 rAppCTGTAGGCACCATCAAT/3ddC/
Linker2 rAppCACTCGGGCACCAAGGA/3ddC/
Linker3 rAppTTTAACCGCGAATTCCAG/3ddC/
BC1a AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTAC AACC
ACGACGCTCTTCCGATCTAACCT
BC1b P- AACC
GGTTAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGAC
CGATCTCGTATGCCGTCTTCTGCTTG
BC2a AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTAC TTGG
ACGACGCTCTTCCGATCTTTGGT
BC2b P- TTGG
CCAAAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGAC
CGATCTCGTATGCCGTCTTCTGCTTG
BC3a AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTAC CCAA
ACGACGCTCTTCCGATCTCCAAT
BC3b P- CCAA
TTGGAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGAC
CGATCTCGTATGCCGTCTTCTGCTTG

Table 6 Plasmids used in this study

Name Description Reference

pBAD24 pBR322 based plasmid with [184]
arabinose inducible
promoter and ampR
selectable marker
pToxT pBAD24 backbone with This study
toxT ORF and RBS cloned
into the NcoI/XbaI site
pToxT (ΔHLH) pBAD24 back bone with This study
toxT ΔHLH ORF and RBS
loned into the NcoI/XbaI
site
pMMB 67EH Apr, IncQ broad-host-range [191]
cloning vector

155
ptarB pMMB67EH with fragment This study
containing the tarB
sequence, promoter and
terminator cloned into the
SacI/XbaI sites
ptarB* pMMB67EH with fragment This study
containing the tarB
sequence, promoter and
terminator cloned into the
SacI/XbaI sites
pMAL-TEV-His-thr-toxT pMAL vector from NEB This study
modified to contain a TEV
protease cleavage site, a 6x
his tag and a thrombin
cleavage site in between
MBP and toxT, the toxT
ORF was cloned into the
NdeI/BamHI site of this
vector
ptarA Topo vector pCR 2.1 This study
containing the tarA
sequence including
promoter and previously
described toxboxes
pGEM-T Empty vector containing the Promega
colE1 origin, used as no
insert control for
competitions against ptarA
containing strain
pGP704 cm tcpF C-FLAG Derivitive of the pGP704 This study
plasmid containing the CAT
gene swapped for bla and
the C-terminal 300 base
pairs of the tcpF ORF with
in-frame FLAG tag cloned
into the EcoRV/KpnI sites.
Used for generating the C-
Terminal FLAG fusion to
TcpF
ptarB-300 Topo vector pCR2.1 This study
containing the +3 to -380bp
of the tarB promoter
pTarB-GFP(ASV) Derivitive of the pGP704 This study
plasmid containing the CAT
gene swapped for bla and
the -380 to +3bp of the

156
 TarB promoter cloned
ahead of the Gfp(ASV) [60,
158] allele in the SmaI site
pJML01 Modified pBAD24 back [109]
bone altered to make
transcription start at the
NheI site
pJML01-tarB Modified pBAD24 back This study
bone with the tarB sRNA or
various mutations made in
in the tarB sequence cloned
into the NheI/SphI site
pJML01-tarB1863mut Mutant allele of tarB cloned This study
into the into the NheI/SphI
site of pJML01 to restore
interaction with the mutated
VC1863 allele
pJML01-tarB0686mut Mutant allele of tarB cloned Promega
into the into the NheI/SphI
site of pJML01 to restore
interaction with the mutated
VCA0686 allele
p1863 comp pMMB67EH with fragment This study
the VC1863 open reading
frame and upstream
sequence into the SacI/XbaI
sites
pBR-flp A pBR322 based plasmid This study
containing the flp
recombinates gene under
the control of the λ pR
promoter and a tempreture
sensitive allele of the
lambda repressor (λ cI857)

pCVD442-lac A deriviative of the [185]

pCVD442 allelic exchange
vector carrying the sacB
gene for sucrose counter
selection and the lacZ gene
and MCS from the pUC19
vector

157
pTarC A derivative of the pMMB This study
plasmid with the sequence
of the putative TarC sRNA
sequence, promoter
included

Table 7 strains

Name Genotype Source

AC53 Wiltype E7946 El Tor, O1 Laboratory Collection
Ogawa
AC3745 ΔlacZ This study
AC3763 ΔtoxT This study
AC3744 ΔtarB This study
AC3748 ΔtarBΔlacZ This study
AC3746 ΔtarA This study
AC3749 ΔtarAΔlacZ This study
AC3757 ΔtarBΔtoxT This study
AC3794 ΔtarBtcpF* This study
AC3795 ΔtarBΔlacZtcpF* This study
AC3765 Δhfq This study
AC468 ΔtoxR (ΔHLH) C6709 El Laboratory Collection
Tor O1 Inaba
AC522 ΔtcpPH::KanR res-tet-res Laboratory Collection
C6709 El Tor O1 Inaba
AC3780 tarB* This study
AC3781 tcpF* This study
AC3782 tarB*tcpF* This study
AC4099 ΔVC1142::FRT This study

AC4125 ΔVCA0722::FRT This study

AC4127 ΔVC1992::FRT This study

AC4128 ΔVC2492::KanR This study

AC4145 ΔVC0516::FRT This study

AC4138 ΔVCA0722::FRT ΔlacZ This study

AC4140 ΔVC1863::FRT ΔlacZ This study

158
AC4148 VCA1051::KanR This study

AC4158 ΔtarB VC1863mut This study

AC4171 ΔtarB VCA0686mut This study

AC4092 ΔtarC::FRT This study

AC4131 ΔtarC::FRT ΔlacZ This study

All strains, except where noted, are derivatives of wildtype E7946

References
1. Koch R (1883) An address on cholera and its bacillus. BMJ 2: 403–
407.
2. Seas C, Gotuzzo E (2009) Mandell: Mandell, Douglas, and Bennett's Principles and
Practice of Infectious Diseases. 8 p.
3. Waldor MK, Mekalanos JJ (1994) Emergence of a new cholera pandemic: molecular
analysis of virulence determinants in Vibrio cholerae O139 and development of a
live vaccine prototype. The Journal of infectious diseases 170: 278-283.
4. Nelson EJ, Harris JB, Morris JG, Calderwood SB, Camilli A (2009) Cholera
transmission: the host, pathogen and bacteriophage dynamic. Nat Rev Micro 7:
693-702.
5. Waldor MK, Mekalanos JJ (1996) Lysogenic conversion by a filamentous phage
encoding cholera toxin. Science 272: 1910-1914.
6. Bishop AL, Camilli A (2011) Vibrio cholerae: lessons for mucosal vaccine design.
Expert review of vaccines 10: 79-94.
7. Safa A, Nair GB, Kong RY (2010) Evolution of new variants of Vibrio cholerae O1.
Trends in microbiology 18: 46-54.
8. Wachsmuth K, Blake P, Olsvik O (1994) Vibrio cholerae and Cholera. Washington,
D.C.: ASM Press.
9. Almagro-Moreno S, Boyd EF (2009) Sialic acid catabolism confers a competitive
advantage to pathogenic vibrio cholerae in the mouse intestine. Infection and
immunity 77: 3807-3816.
10. Dziejman M, Balon E, Boyd D, Fraser CM, Heidelberg JF, et al. (2002) Comparative
genomic analysis of Vibrio cholerae: genes that correlate with cholera endemic
and pandemic disease. Proceedings of the National Academy of Sciences of the
United States of America 99: 1556-1561.
11. Murphy RA, Boyd EF (2008) Three pathogenicity islands of Vibrio cholerae can
excise from the chromosome and form circular intermediates. Journal of
Bacteriology 190: 636-647.
12. Davies BW, Bogard RW, Young TS, Mekalanos JJ (2012) Coordinated Regulation of
Accessory Genetic Elements Produces Cyclic Di-Nucleotides for V. cholerae
Virulence. Cell 149: 358-370.

159
13. Greenough DBaWB (1992) Cholera. New York: Plenum Publishing Corporation. 372
p.
14. Murley YM, Behari J, Griffin R, Calderwood SB (2000) Classical and El Tor
biotypes of Vibrio cholerae differ in timing of transcription of tcpPH during
growth in inducing conditions. Infect Immun 68: 3010-3014.
15. Mukhopadhyay AK, Garg S, Saha PK, Takeda Y, Bhattacharya SK, et al. (1996)
Comparative analysis of factors promoting optimal production of cholera toxin by
Vibrio cholerae O1 (classical & E1Tor biotypes) & O139. Indian J Med Res 104:
129-133.
16. DiRita VJ, Neely M, Taylor RK, Bruss PM (1996) Differential expression of the
ToxR regulon in classical and E1 Tor biotypes of Vibrio cholerae is due to
biotype-specific control over toxT expression. Proc Natl Acad Sci U S A 93:
7991-7995.
17. Skorupski K, Taylor RK (1997) Control of the ToxR virulence regulon in Vibrio
cholerae by environmental stimuli. Molecular microbiology 25: 1003-1009.
18. Bhattacharya SK (1995) Cholera outbreaks: role of oral rehydration therapy. Journal
of the Indian Medical Association 93: 237-238.
19. Guerrant RL, Carneiro-Filho BA, Dillingham RA (2003) Cholera, diarrhea, and oral
rehydration therapy: triumph and indictment. Clinical infectious diseases : an
official publication of the Infectious Diseases Society of America 37: 398-405.
20. Wozniak RA, Fouts DE, Spagnoletti M, Colombo MM, Ceccarelli D, et al. (2009)
Comparative ICE genomics: insights into the evolution of the SXT/R391 family
of ICEs. PLoS genetics 5: e1000786.
21. Schild S, Nelson EJ, Bishop AL, Camilli A (2009) Characterization of Vibrio
cholerae outer membrane vesicles as a candidate vaccine for cholera. Infection
and immunity 77: 472-484.
22. Date KA, Vicari A, Hyde TB, Mintz E, Danovaro-Holliday MC, et al. (2011)
Considerations for oral cholera vaccine use during outbreak after earthquake in
Haiti, 2010-2011. Emerging infectious diseases 17: 2105-2112.
23. Calain P, Chaine JP, Johnson E, Hawley ML, O'Leary MJ, et al. (2004) Can oral
cholera vaccination play a role in controlling a cholera outbreak? Vaccine 22:
2444-2451.
24. Miller CJ, Feachem RG, Drasar BS (1985) Cholera epidemiology in developed and
developing countries: new thoughts on transmission, seasonality, and control.
Lancet 1: 261-262.
25. Colwell RR, Huq A (1994) Environmental reservoir of Vibrio cholerae. The causative
agent of cholera. Annals of the New York Academy of Sciences 740: 44-54.
26. Meibom KL, Li XB, Nielsen AT, Wu CY, Roseman S, et al. (2004) The Vibrio
cholerae chitin utilization program. Proceedings of the National Academy of
Sciences of the United States of America 101: 2524-2529.
27. Alam M, Sultana M, Nair GB, Siddique AK, Hasan NA, et al. (2007) Viable but
nonculturable Vibrio cholerae O1 in biofilms in the aquatic environment and their
role in cholera transmission. Proceedings of the National Academy of Sciences of
the United States of America 104: 17801-17806.
28. Miller CJ, Drasar BS, Feachem RG (1982) Cholera and estuarine salinity in Calcutta
and London. Lancet 1: 1216-1218.

160
29. Lara RJ, Neogi SB, Islam MS, Mahmud ZH, Yamasaki S, et al. (2009) Influence of
catastrophic climatic events and human waste on Vibrio distribution in the
Karnaphuli estuary, Bangladesh. EcoHealth 6: 279-286.
30. Meibom KL, Blokesch M, Dolganov NA, Wu CY, Schoolnik GK (2005) Chitin
induces natural competence in Vibrio cholerae. Science 310: 1824-1827.
31. Blokesch M, Schoolnik GK (2007) Serogroup conversion of Vibrio cholerae in
aquatic reservoirs. PLoS pathogens 3: e81.
32. Taylor RK, Miller VL, Furlong DB, Mekalanos JJ (1987) Use of phoA gene fusions
to identify a pilus colonization factor coordinately regulated with cholera toxin.
Proceedings of the National Academy of Sciences of the United States of America
84: 2833-2837.
33. Klose KE (2000) The suckling mouse model of cholera. Trends in microbiology 8:
189-191.
34. Finkelstein RA, LoSpalluto JJ (1969) Pathogenesis of experimental cholera.
Preparation and isolation of choleragen and choleragenoid. The Journal of
experimental medicine 130: 185-202.
35. Finkelstein RA, LoSpalluto JJ (1970) Production of highly purified choleragen and
choleragenoid. The Journal of infectious diseases 121: Suppl 121:163+.
36. Kirn TJ, Jude BA, Taylor RK (2005) A colonization factor links Vibrio cholerae
environmental survival and human infection. Nature 438: 863-866.
37. Parsot C, Mekalanos JJ (1992) Structural analysis of the acfA and acfD genes of
Vibrio cholerae: effects of DNA topology and transcriptional activators on
expression. J Bacteriol 174: 5211-5218.
38. Merrell DS, Hava DL, Camilli A (2002) Identification of novel factors involved in
colonization and acid tolerance of Vibrio cholerae. Mol Microbiol 43: 1471-1491.
39. Craig L, Pique ME, Tainer JA (2004) Type IV pilus structure and bacterial
pathogenicity. Nature reviews Microbiology 2: 363-378.
40. Giron JA, Gomez-Duarte OG, Jarvis KG, Kaper JB (1997) Longus pilus of
enterotoxigenic Escherichia coli and its relatedness to other type-4 pili--a
minireview. Gene 192: 39-43.
41. Donnenberg MS, Zhang HZ, Stone KD (1997) Biogenesis of the bundle-forming
pilus of enteropathogenic Escherichia coli: reconstitution of fimbriae in
recombinant E. coli and role of DsbA in pilin stability--a review. Gene 192: 33-
38.
42. Kirn TJ, Taylor RK (2005) TcpF is a soluble colonization factor and protective
antigen secreted by El Tor and classical O1 and O139 Vibrio cholerae serogroups.
Infect Immun 73: 4461-4470.
43. Faruque SM, Zhu J, Asadulghani, Kamruzzaman M, Mekalanos JJ (2003)
Examination of diverse toxin-coregulated pilus-positive Vibrio cholerae strains
fails to demonstrate evidence for Vibrio pathogenicity island phage. INFECTION
AND IMMUNITY 71: 2993-2999.
44. Faruque SM, Asadulghani, Saha MN, Alim AR, Albert MJ, et al. (1998) Analysis of
clinical and environmental strains of nontoxigenic Vibrio cholerae for
susceptibility to CTXPhi: molecular basis for origination of new strains with
epidemic potential. Infect Immun 66: 5819-5825.

161
45. Pratt JT, Ismail AM, Camilli A (2010) PhoB regulates both environmental and
virulence gene expression in Vibrio cholerae. Molecular microbiology 77: 1595-
1605.
46. Kirn TJ, Bose N, Taylor RK (2003) Secretion of a soluble colonization factor by the
TCP type 4 pilus biogenesis pathway in Vibrio cholerae. Mol Microbiol 49: 81-
92.
47. Krebs SJ, Kirn TJ, Taylor RK (2009) Genetic mapping of secretion and functional
determinants of the Vibrio cholerae TcpF colonization factor. Journal of
bacteriology 191: 3665-3676.
48. Vanden Broeck D, Horvath C, De Wolf MJ (2007) Vibrio cholerae: cholera toxin.
The international journal of biochemistry & cell biology 39: 1771-1775.
49. Nielsen AT, Dolganov NA, Otto G, Miller MC, Wu CY, et al. (2006) RpoS controls
the Vibrio cholerae mucosal escape response. PLoS pathogens 2: e109.
50. McCardell BA, Madden JM, Shah DB (1985) Isolation and characterization of a
cytolysin produced by Vibrio cholerae serogroup non-O1. Canadian journal of
microbiology 31: 711-720.
51. Trucksis M, Galen JE, Michalski J, Fasano A, Kaper JB (1993) Accessory cholera
enterotoxin (Ace), the third toxin of a Vibrio cholerae virulence cassette.
Proceedings of the National Academy of Sciences of the United States of America
90: 5267-5271.
52. Fasano A, Baudry B, Pumplin DW, Wasserman SS, Tall BD, et al. (1991) Vibrio
cholerae produces a second enterotoxin, which affects intestinal tight junctions.
Proceedings of the National Academy of Sciences of the United States of America
88: 5242-5246.
53. Levine MM, Kaper JB, Herrington D, Losonsky G, Morris JG, et al. (1988) Volunteer
studies of deletion mutants of Vibrio cholerae O1 prepared by recombinant
techniques. Infection and immunity 56: 161-167.
54. Jude BA, Martinez RM, Skorupski K, Taylor RK (2009) Levels of the secreted Vibrio
cholerae attachment factor GbpA are modulated by quorum-sensing-induced
proteolysis. Journal of bacteriology 191: 6911-6917.
55. Peterson KM (2002) Expression of Vibrio cholerae virulence genes in response to
environmental signals. Current issues in intestinal microbiology 3: 29-38.
56. Childers BM, Klose KE (2007) Regulation of virulence in Vibrio cholerae: the ToxR
regulon. Future Microbiol 2: 335-344.
57. Lee SH, Hava DL, Waldor MK, Camilli A (1999) Regulation and temporal
expression patterns of Vibrio cholerae virulence genes during infection. Cell 99:
625-634.
58. Schild S, Tamayo R, Nelson EJ, Qadri F, Calderwood SB, et al. (2007) Genes
induced late in infection increase fitness of Vibrio cholerae after release into the
environment. Cell Host & Microbe 2: 264-277.
59. Abuaita BH, Withey JH (2011) Termination of Vibrio cholerae virulence gene
expression is mediated by proteolysis of the major virulence activator, ToxT.
Molecular microbiology 81: 1640-1653.
60. Nielsen AT, Dolganov NA, Rasmussen T, Otto G, Miller MC, et al. A bistable switch
and anatomical site control Vibrio cholerae virulence gene expression in the
intestine. PLoS Pathog 6.

162
61. Lin W, Kovacikova G, Skorupski K (2007) The quorum sensing regulator HapR
downregulates the expression of the virulence gene transcription factor AphA in
Vibrio cholerae by antagonizing Lrp- and VpsR-mediated activation. Molecular
microbiology 64: 953-967.
62. Merrell DS, Butler SM, Qadri F, Dolganov NA, Alam A, et al. (2002) Host-induced
epidemic spread of the cholera bacterium. Nature 417: 642-645.
63. Hartley DM, Morris JG, Jr., Smith DL (2006) Hyperinfectivity: a critical element in
the ability of V. cholerae to cause epidemics? PLoS medicine 3: e7.
64. Alam A, Larocque RC, Harris JB, Vanderspurt C, Ryan ET, et al. (2005)
Hyperinfectivity of human-passaged Vibrio cholerae can be modeled by growth in
the infant mouse. Infection and immunity 73: 6674-6679.
65. Butler SM, Camilli A (2004) Both chemotaxis and net motility greatly influence the
infectivity of Vibrio cholerae. Proceedings of the National Academy of Sciences
of the United States of America 101: 5018-5023.
66. Butler SM, Nelson EJ, Chowdhury N, Faruque SM, Calderwood SB, et al. (2006)
Cholera stool bacteria repress chemotaxis to increase infectivity. Molecular
microbiology 60: 417-426.
67. Karaolis DK, Somara S, Maneval DR, Johnson JA, Kaper JB (1999) A bacteriophage
encoding a pathogenicity island, a type-IV pilus and a phage receptor in cholera
bacteria. Nature 399: 375-379.
68. Higgins DE, Nazareno E, DiRita VJ (1992) The virulence gene activator ToxT from
Vibrio cholerae is a member of the AraC family of transcriptional activators. J
Bacteriol 174: 6974-6980.
69. Yu RR, DiRita VJ (1999) Analysis of an autoregulatory loop controlling ToxT,
cholera toxin, and toxin-coregulated pilus production in Vibrio cholerae. J
Bacteriol 181: 2584-2592.
70. Medrano AI, DiRita VJ, Castillo G, Sanchez J (1999) Transient transcriptional
activation of the Vibrio cholerae El Tor virulence regulator toxT in response to
culture conditions. Infect Immun 67: 2178-2183.
71. Kovacikova G, Skorupski K (2001) Overlapping binding sites for the virulence gene
regulators AphA, AphB and cAMP-CRP at the Vibrio cholerae tcpPH promoter.
Mol Microbiol 41: 393-407.
72. Kovacikova G, Lin W, Skorupski K (2010) The LysR-type virulence activator AphB
regulates the expression of genes in Vibrio cholerae in response to low pH and
anaerobiosis. Journal of Bacteriology 192: 4181-4191.
73. Goss TJ, Seaborn CP, Gray MD, Krukonis ES (2010) Identification of the TcpP-
binding site in the toxT promoter of Vibrio cholerae and the role of ToxR in
TcpP-mediated activation. Infection and immunity 78: 4122-4133.
74. Krukonis ES, Yu RR, Dirita VJ (2000) The Vibrio cholerae ToxR/TcpP/ToxT
virulence cascade: distinct roles for two membrane-localized transcriptional
activators on a single promoter. Molecular microbiology 38: 67-84.
75. Marrero K, Sanchez A, Rodriguez-Ulloa A, Gonzalez LJ, Castellanos-Serra L, et al.
(2009) Anaerobic growth promotes synthesis of colonization factors encoded at
the Vibrio pathogenicity island in Vibrio cholerae El Tor. Res Microbiol 160: 48-
56.

163
76. Iwanaga M, Yamamoto K, Higa N, Ichinose Y, Nakasone N, et al. (1986) Culture
conditions for stimulating cholera toxin production by Vibrio cholerae O1 El Tor.
Microbiol Immunol 30: 1075-1083.
77. Abuaita BH, Withey JH (2009) Bicarbonate Induces Vibrio cholerae virulence gene
expression by enhancing ToxT activity. Infect Immun 77: 4111-4120.
78. Zhu J, Miller MB, Vance RE, Dziejman M, Bassler BL, et al. (2002) Quorum-sensing
regulators control virulence gene expression in Vibrio cholerae. Proceedings of
the National Academy of Sciences of the United States of America 99: 3129-
3134.
79. Kovacikova G, Skorupski K (2002) Regulation of virulence gene expression in Vibrio
cholerae by quorum sensing: HapR functions at the aphA promoter. Molecular
microbiology 46: 1135-1147.
80. Waters CM, Lu W, Rabinowitz JD, Bassler BL (2008) Quorum sensing controls
biofilm formation in Vibrio cholerae through modulation of cyclic di-GMP levels
and repression of vpsT. Journal of bacteriology 190: 2527-2536.
81. Kovacikova G, Skorupski K (2001) Overlapping binding sites for the virulence gene
regulators AphA, AphB and cAMP-CRP at the Vibrio cholerae tcpPH promoter.
Molecular microbiology 41: 393-407.
82. Liang W, Pascual-Montano A, Silva AJ, Benitez JA (2007) The cyclic AMP receptor
protein modulates quorum sensing, motility and multiple genes that affect
intestinal colonization in Vibrio cholerae. Microbiology 153: 2964-2975.
83. Tischler AD, Camilli A (2005) Cyclic diguanylate regulates Vibrio cholerae virulence
gene expression. Infection and immunity 73: 5873-5882.
84. Cotter PA, Stibitz S (2007) c-di-GMP-mediated regulation of virulence and biofilm
formation. Current opinion in microbiology 10: 17-23.
85. Beyhan S, Tischler AD, Camilli A, Yildiz FH (2006) Transcriptome and phenotypic
responses of Vibrio cholerae to increased cyclic di-GMP level. Journal of
bacteriology 188: 3600-3613.
86. Tamayo R, Tischler AD, Camilli A (2005) The EAL domain protein VieA is a cyclic
diguanylate phosphodiesterase. The Journal of biological chemistry 280: 33324-
33330.
87. Provenzano D, Lauriano CM, Klose KE (2001) Characterization of the role of the
ToxR-modulated outer membrane porins OmpU and OmpT in Vibrio cholerae
virulence. Journal of bacteriology 183: 3652-3662.
88. Provenzano D, Klose KE (2000) Altered expression of the ToxR-regulated porins
OmpU and OmpT diminishes Vibrio cholerae bile resistance, virulence factor
expression, and intestinal colonization. Proceedings of the National Academy of
Sciences of the United States of America 97: 10220-10224.
89. Withey JH, Dirita VJ (2006) The toxbox: specific DNA sequence requirements for
activation of Vibrio cholerae virulence genes by ToxT. Mol Microbiol 59: 1779-
1789.
90. Childers BM, Weber GG, Prouty MG, Castaneda MM, Peng F, et al. (2007)
Identification of residues critical for the function of the Vibrio cholerae virulence
regulator ToxT by scanning alanine mutagenesis. J Mol Biol 367: 1413-1430.
91. Bellair M, Withey JH (2008) Flexibility of Vibrio cholerae ToxT in transcription
activation of genes having altered promoter spacing. J Bacteriol 190: 7925-7931.

164
92. Bradley ES, Bodi K, Ismail AM, Camilli A (2011) A genome-wide approach to
discovery of small RNAs involved in regulation of virulence in Vibrio cholerae.
PLoS pathogens 7: e1002126.
93. Weber GG, Klose KE (2011) The complexity of ToxT-dependent transcription in
Vibrio cholerae. The Indian journal of medical research 133: 201-206.
94. Krishnan HH, Ghosh A, Paul K, Chowdhury R (2004) Effect of anaerobiosis on
expression of virulence factors in Vibrio cholerae. Infect Immun 72: 3961-3967.
95. Navarre WW, Porwollik S, Wang Y, McClelland M, Rosen H, et al. (2006) Selective
silencing of foreign DNA with low GC content by the H-NS protein in
Salmonella. Science 313: 236-238.
96. Lowden MJ, Skorupski K, Pellegrini M, Chiorazzo MG, Taylor RK, et al. (2010)
Structure of Vibrio cholerae ToxT reveals a mechanism for fatty acid regulation
of virulence genes. Proc Natl Acad Sci USA 107: 2860-2865.
97. Shakhnovich EA, Hung DT, Pierson E, Lee K, Mekalanos JJ (2007) Virstatin inhibits
dimerization of the transcriptional activator ToxT. Proceedings of the National
Academy of Sciences of the United States of America 104: 2372-2377.
98. Hsiao A, Xu X, Kan B, Kulkarni RV, Zhu J (2009) Direct regulation by the Vibrio
cholerae regulator ToxT to modulate colonization and anticolonization pilus
expression. INFECTION AND IMMUNITY 77: 1383-1388.
99. Peterson KM, Mekalanos JJ (1988) Characterization of the Vibrio cholerae ToxR
regulon: identification of novel genes involved in intestinal colonization. Infect
Immun 56: 2822-2829.
100. Altuvia S (2007) Identification of bacterial small non-coding RNAs: experimental
approaches. Current Opinion in Microbiology 10: 257-261.
101. Fozo EM, Makarova KS, Shabalina SA, Yutin N, Koonin EV, et al. (2010)
Abundance of type I toxin-antitoxin systems in bacteria: searches for new
candidates and discovery of novel families. Nucleic acids research 38: 3743-3759.
102. Vogel J (2009) A rough guide to the non-coding RNA world of Salmonella. Mol
Microbiol 71: 1-11.
103. Hammer BK, Bassler BL (2007) Regulatory small RNAs circumvent the
conventional
quorum sensing pathway in pandemic Vibrio cholerae. PNAS: 5.
104. Song T, Wai SN (2009) A novel sRNA that modulates virulence and environmental
fitness of Vibrio cholerae. RNA biology 6: 254-258.
105. Loh E, Dussurget O, Gripenland J, Vaitkevicius K, Tiensuu T, et al. (2009) A trans-
acting riboswitch controls expression of the virulence regulator PrfA in Listeria
monocytogenes. Cell 139: 770-779.
106. Richards GR, Vanderpool CK (2011) Molecular call and response: the physiology of
bacterial small RNAs. Biochimica et biophysica acta 1809: 525-531.
107. Opdyke JA, Kang JG, Storz G (2004) GadY, a small-RNA regulator of acid
response genes in Escherichia coli. Journal of bacteriology 186: 6698-6705.
108. Liu JM, Camilli A (2009) A broadening world of bacterial small RNAs. Curr Opin
Microbiol.
109. Viegas SC, Arraiano CM (2008) Regulating the regulators: How ribonucleases
dictate the rules in the control of small non-coding RNAs. RNA biology 5: 230-
243.

165
110. Rutherford ST, van Kessel JC, Shao Y, Bassler BL (2011) AphA and LuxR/HapR
reciprocally control quorum sensing in vibrios. Genes & development 25: 397-
408.
111. Song T, Sabharwal D, Wai SN (2010) VrrA mediates Hfq-dependent regulation of
OmpT synthesis in Vibrio cholerae. Journal of molecular biology 400: 682-688.
112. Aiba H (2007) Mechanism of RNA silencing by Hfq-binding small RNAs. Current
Opinion in Microbiology 10: 134-139.
113. Kajitani M, Ishihama A (1991) Identification and sequence determination of the host
factor gene for bacteriophage Q beta. Nucleic acids research 19: 1063-1066.
114. Liu JM, Livny J, Lawrence MS, Kimball MD, Waldor MK, et al. (2009)
Experimental discovery of sRNAs in Vibrio cholerae by direct cloning, 5S/tRNA
depletion and parallel sequencing. Nucleic Acids Res 37: e46.
115. Storz G, Vogel J, Wassarman KM (2011) Regulation by small RNAs in bacteria:
expanding frontiers. Molecular cell 43: 880-891.
116. Papenfort K, Bouvier M, Mika F, Sharma CM, Vogel J (2010) Evidence for an
autonomous 5' target recognition domain in an Hfq-associated small RNA.
Proceedings of the National Academy of Sciences of the United States of America
107: 20435-20440.
117. Frohlich KS, Vogel J (2009) Activation of gene expression by small RNA. Curr
Opin Microbiol 12: 674-682.
118. Pfeiffer V, Papenfort K, Lucchini S, Hinton JC, Vogel J (2009) Coding sequence
targeting by MicC RNA reveals bacterial mRNA silencing downstream of
translational initiation. Nat Struct Mol Biol 16: 840-846.
119. Papenfort K, Said N, Welsink T, Lucchini S, Hinton JC, et al. (2009) Specific and
pleiotropic patterns of mRNA regulation by ArcZ, a conserved, Hfq-dependent
small RNA. Mol Microbiol 74: 139-158.
120. Babitzke P, Romeo T (2007) CsrB sRNA family: sequestration of RNA-binding
regulatory proteins. Current Opinion in Microbiology 10: 156-163.
121. Lenz DH, Miller MB, Zhu J, Kulkarni RV, Bassler BL (2005) CsrA and three
redundant small RNAs regulate quorum sensing in Vibrio cholerae. Molecular
microbiology 58: 1186-1202.
122. Yakhnin H, Pandit P, Petty TJ, Baker CS, Romeo T, et al. (2007) CsrA of Bacillus
subtilis regulates translation initiation of the gene encoding the flagellin protein
(hag) by blocking ribosome binding. Mol Microbiol 64: 1605-1620.
123. Jonas K, Edwards AN, Ahmad I, Romeo T, Romling U, et al. (2009) Complex
regulatory network encompassing the Csr, c-di-GMP and motility systems of
Salmonella Typhimurium. Environ Microbiol.
124. Liu MY, Gui G, Wei B, Preston JF, 3rd, Oakford L, et al. (1997) The RNA molecule
CsrB binds to the global regulatory protein CsrA and antagonizes its activity in
Escherichia coli. J Biol Chem 272: 17502-17510.
125. Wassarman K (2007) 6S RNA: a small RNA regulator of transcription. Current
Opinion in Microbiology 10: 164-168.
126. Vogel J, Wagner E (2007) Target identification of small noncoding RNAs in
bacteria. Current Opinion in Microbiology 10: 262-270.
127. Valentin-Hansen P, Eriksen M, Udesen C (2004) The bacterial Sm-like protein Hfq:
a key player in RNA transactions. Mol Microbiol 51: 1525-1533.

166
128. Nielsen JS, Boggild A, Andersen CB, Nielsen G, Boysen A, et al. (2007) An Hfq-
like protein in archaea: crystal structure and functional characterization of the Sm
protein from Methanococcus jannaschii. RNA 13: 2213-2223.
129. Link TM, Valentin-Hansen P, Brennan RG (2009) Structure of Escherichia coli Hfq
bound to polyriboadenylate RNA. Proc Natl Acad Sci U S A 106: 19292-19297.
130. Maki K, Uno K, Morita T, Aiba H (2008) RNA, but not protein partners, is directly
responsible for translational silencing by a bacterial Hfq-binding small RNA.
Proceedings of the National Academy of Sciences of the United States of America
105: 10332-10337.
131. Sittka A, Lucchini S, Papenfort K, Sharma CM, Rolle K, et al. (2008) Deep
sequencing analysis of small noncoding RNA and mRNA targets of the global
post-transcriptional regulator, Hfq. PLoS genetics 4: e1000163.
132. Christiansen JK, Nielsen JS, Ebersbach T, Valentin-Hansen P, Sogaard-Andersen L,
et al. (2006) Identification of small Hfq-binding RNAs in Listeria
monocytogenes. RNA 12: 1383-1396.
133. Ding Y, Davis BM, Waldor MK (2004) Hfq is essential for Vibrio cholerae
virulence and downregulates sigma expression. Molecular microbiology 53: 345-
354.
134. Moon K, Gottesman S (2011) Competition among Hfq-binding small RNAs in
Escherichia coli. Molecular microbiology 82: 1545-1562.
135. Davis BM, Waldor MK (2007) RNase E-dependent processing stabilizes MicX, a
Vibrio cholerae sRNA. Mol Microbiol 65: 373-385.
136. Urban JH, Vogel J (2007) Translational control and target recognition by
Escherichia coli small RNAs in vivo. Nucleic Acids Res 35: 1018-1037.
137. Pfeiffer V, Sittka A, Tomer R, Tedin K, Brinkmann V, et al. (2007) A small non-
coding RNA of the invasion gene island (SPI-1) represses outer membrane
protein synthesis from the Salmonella core genome. Mol Microbiol 66: 1174-
1191.
138. Geisinger E, Adhikari RP, Jin R, Ross HF, Novick RP (2006) Inhibition of rot
translation by RNAIII, a key feature of agr function. Molecular microbiology 61:
1038-1048.
139. Novick RP, Geisinger E (2008) Quorum sensing in staphylococci. Annual review of
genetics 42: 541-564.
140. Gong H, Vu GP, Bai Y, Chan E, Wu R, et al. (2011) A Salmonella small non-coding
RNA facilitates bacterial invasion and intracellular replication by modulating the
expression of virulence factors. PLoS pathogens 7: e1002120.
141. Padalon-Brauch G, Hershberg R, Elgrably-Weiss M, Baruch K, Rosenshine I, et al.
(2008) Small RNAs encoded within genetic islands of Salmonella typhimurium
show host-induced expression and role in virulence. Nucleic acids research 36:
1913-1927.
142. Pfeiffer V, Sittka A, Tomer R, Tedin K, Brinkmann V, et al. (2007) A small non-
coding RNA of the invasion gene island (SPI-1) represses outer membrane
protein synthesis from the Salmonella core genome. Molecular microbiology 66:
1174-1191.

167
143. Song T, Mika F, Lindmark B, Liu Z, Schild S, et al. (2008) A new Vibrio
choleraesRNA modulates colonization and affects release of outer membrane
vesicles. Mol Microbiol 70: 100-111.
144. Richard AL, Withey JH, Beyhan S, Yildiz F, Dirita VJ (2010) The Vibrio cholerae
virulence regulatory cascade controls glucose uptake through activation of TarA,
a small regulatory RNA. Mol Microbiol 78: 1171-1181.
145. Sittka A, Vogel J (2008) A Glimpse at the Evolution of Virulence Control. Cell Host
& Microbe 4: 310-312.
146. Boisset S, Geissmann T, Huntzinger E, Fechter P, Bendridi N, et al. (2007)
Staphylococcus aureus RNAIII coordinately represses the synthesis of virulence
factors and the transcription regulator Rot by an antisense mechanism. Genes &
development 21: 1353-1366.
147. Liu Y, Wu N, Dong J, Gao Y, Zhang X, et al. (2010) Hfq is a global regulator that
controls the pathogenicity of Staphylococcus aureus. PloS one 5.
148. Coornaert A, Lu A, Mandin P, Springer M, Gottesman S, et al. (2010) MicA sRNA
links the PhoP regulon to cell envelope stress. Molecular microbiology 76: 467-
479.
149. Yu RR, Dirita VJ (2002) Regulation of gene expression in Vibrio choleraeby
ToxT involves both antirepression and RNA
polymerase stimulation. Mol Microbiol 43: 119-134.
150. Stonehouse EA, Hulbert RR, Nye MB, Skorupski KA, Taylor RK (2010) H-NS
binding and repression of the ctx promoter in Vibrio cholerae. Journal of
Bacteriology.
151. Majerczyk CD, Dunman PM, Luong TT, Lee CY, Sadykov MR, et al. Direct targets
of CodY in Staphylococcus aureus. J Bacteriol 192: 2861-2877.
152. Withey JH, DiRita VJ (2006) The toxbox: specific DNA sequence requirements for
activation of Vibrio cholerae virulence genes by ToxT. Mol Microbiol 59: 1779-
1789.
153. Tjaden B (2008) TargetRNA: a tool for predicting targets of small RNA action in
bacteria. Nucleic Acids Res 36: W109-113.
154. Sperandio V, Giron JA, Silveira WD, Kaper JB (1995) The OmpU outer membrane
protein, a potential adherence factor of Vibrio cholerae. Infect Immun 63: 4433-
4438.
155. Davies BW, Bogard RW, Mekalanos JJ (2011) Mapping the regulon of Vibrio
cholerae ferric uptake regulator expands its known network of gene regulation.
Proceedings of the National Academy of Sciences of the United States of
America.
156. Livny J, Teonadi H, Livny M, Waldor MK (2008) High-throughput, kingdom-wide
prediction and annotation of bacterial non-coding RNAs. PLoS One 3: e3197.
157. Selinger DW, Cheung KJ, Mei R, Johansson EM, Richmond CS, et al. (2000) RNA
expression analysis using a 30 base pair resolution Escherichia coli genome array.
Nature biotechnology 18: 1262-1268.
158. Andersen JB, Sternberg C, Poulsen LK, Bjorn SP, Givskov M, et al. (1998) New
unstable variants of green fluorescent protein for studies of transient gene
expression in bacteria. Appl Environ Microbiol 64: 2240-2246.

168
159. Higgins DE, DiRita VJ (1994) Transcriptional control of toxT, a regulatory gene in
the ToxR regulon of Vibrio cholerae. Mol Microbiol 14: 17-29.
160. Krukonis ES, Yu RR, Dirita VJ (2000) The Vibrio cholerae ToxR/TcpP/ToxT
virulence cascade: distinct roles for two membrane-localized transcriptional
activators on a single promoter. Mol Microbiol 38: 67-84.
161. Iwanaga M, Yamamoto K (1985) New medium for the production of cholera toxin
by Vibrio cholerae O1 biotype El Tor. J Clin Microbiol 22: 405-408.
162. Liu Z, Yang M, Peterfreund GL, Tsou AM, Selamoglu N, et al. (2011) Vibrio
cholerae anaerobic induction of virulence gene expression is controlled by thiol-
based switches of virulence regulator AphB. Proceedings of the National
Academy of Sciences of the United States of America 108: 810-815.
163. Kovacikova G, Skorupski K (1999) A Vibrio cholerae LysR homolog, AphB,
cooperates with AphA at the tcpPH promoter to activate expression of the ToxR
virulence cascade. Journal of Bacteriology 181: 4250-4256.
164. Crawford JA, Kaper JB, DiRita VJ (1998) Analysis of ToxR-dependent transcription
activation of ompU, the gene encoding a major envelope protein in Vibrio
cholerae. Mol Microbiol 29: 235-246.
165. Sezonov G, Joseleau-Petit D, D'Ari R (2007) Escherichia coli physiology in Luria-
Bertani broth. Journal of bacteriology 189: 8746-8749.
166. Sengupta N, Paul K, Chowdhury R (2003) The global regulator ArcA modulates
expression of virulence factors in Vibrio cholerae. Infect Immun 71: 5583-5589.
167. Lilley BN, Bassler BL (2000) Regulation of quorum sensing in Vibrio harveyi by
LuxO and sigma-54. Molecular microbiology 36: 940-954.
168. Vance RE, Zhu J, Mekalanos JJ (2003) A constitutively active variant of the
quorum-sensing regulator LuxO affects protease production and biofilm
formation in Vibrio cholerae. Infection and immunity 71: 2571-2576.
169. Bassler BL, Wright M, Silverman MR (1994) Sequence and function of LuxO, a
negative regulator of luminescence in Vibrio harveyi. Molecular microbiology 12:
403-412.
170. Vecerek B, Moll I, Afonyushkin T, Kaberdin V, Blasi U (2003) Interaction of the
RNA chaperone Hfq with mRNAs: direct and indirect roles of Hfq in iron
metabolism of Escherichia coli. Mol Microbiol 50: 897-909.
171. Ishikawa H, Otaka H, Maki K, Morita T, Aiba H (2012) The functional Hfq-binding
module of bacterial sRNAs consists of a double or single hairpin preceded by a U-
rich sequence and followed by a 3' poly(U) tail. RNA 18: 1062-1074.
172. Contag CH, Contag PR, Mullins JI, Spilman SD, Stevenson DK, et al. (1995)
Photonic detection of bacterial pathogens in living hosts. Mol Microbiol 18: 593-
603.
173. Wiles S, Pickard KM, Peng K, MacDonald TT, Frankel G (2006) In vivo
bioluminescence imaging of the murine pathogen Citrobacter rodentium. Infect
Immun 74: 5391-5396.
174. Levin JZ, Yassour M, Adiconis X, Nusbaum C, Thompson DA, et al. (2010)
Comprehensive comparative analysis of strand-specific RNA sequencing
methods. Nature methods 7: 709-715.

169
175. Mandlik A, Livny J, Robins WP, Ritchie JM, Mekalanos JJ, et al. (2011) RNA-Seq-
based monitoring of infection-linked changes in Vibrio cholerae gene expression.
Cell host & microbe 10: 165-174.
176. De Souza Silva O, Blokesch M (2010) Genetic manipulation of Vibrio cholerae by
combining natural transformation with FLP recombination. Plasmid 64: 186-195.
177. Zuker M (2003) Mfold web server for nucleic acid folding and hybridization
prediction. Nucleic acids research 31: 3406-3415.
178. Shao Y, Bassler BL (2012) Quorum-sensing non-coding small RNAs use unique
pairing regions to differentially control mRNA targets. Molecular microbiology
83: 599-611.
179. Livny J, Brencic A, Lory S, Waldor MK (2006) Identification of 17 Pseudomonas
aeruginosa sRNAs and prediction of sRNA-encoding genes in 10 diverse
pathogens using the bioinformatic tool sRNAPredict2. Nucleic acids research 34:
3484-3493.
180. Said N, Rieder R, Hurwitz R, Deckert J, Urlaub H, et al. (2009) In vivo expression
and purification of aptamer-tagged small RNA regulators. Nucleic Acids Res 37:
e133.
181. Papenfort K, Podkaminski D, Hinton JC, Vogel J (2012) The ancestral SgrS RNA
discriminates horizontally acquired Salmonella mRNAs through a single G-U
wobble pair. Proceedings of the National Academy of Sciences of the United
States of America 109: E757-764.
182. Queck SY, Jameson-Lee M, Villaruz AE, Bach TH, Khan BA, et al. (2008) RNAIII-
independent target gene control by the agr quorum-sensing system: insight into
the evolution of virulence regulation in Staphylococcus aureus. Molecular cell 32:
150-158.
183. Karaolis DK, Johnson JA, Bailey CC, Boedeker EC, Kaper JB, et al. (1998) A
Vibrio cholerae pathogenicity island associated with epidemic and pandemic
strains. Proceedings of the National Academy of Sciences of the United States of
America 95: 3134-3139.
184. Guzman LM, Belin D, Carson MJ, Beckwith J (1995) Tight regulation, modulation,
and high-level expression by vectors containing the arabinose PBAD promoter.
Journal of bacteriology 177: 4121-4130.
185. Donnenberg MS, Kaper JB (1991) Construction of an eae deletion mutant of
enteropathogenic Escherichia coli by using a positive-selection suicide vector.
Infection and immunity 59: 4310-4317.
186. Terpe K (2003) Overview of tag protein fusions: from molecular and biochemical
fundamentals to commercial systems. Appl Microbiol Biotechnol 60: 523-533.
187. Miller VL, Mekalanos JJ (1988) A novel suicide vector and its use in construction of
insertion mutations: osmoregulation of outer membrane proteins and virulence
determinants in Vibrio cholerae requires toxR. Journal of bacteriology 170: 2575-
2583.
188. Pepke S, Wold B, Mortazavi A (2009) Computation for ChIP-seq and RNA-seq
studies. Nat Methods 6: S22-32.
189. Camilli A, Mekalanos JJ (1995) Use of recombinase gene fusions to identify Vibrio
cholerae genes induced during infection. Mol Microbiol 18: 671-683.

170
190. Trapnell C, Roberts A, Goff L, Pertea G, Kim D, et al. (2012) Differential gene and
transcript expression analysis of RNA-seq experiments with TopHat and
Cufflinks. Nature protocols 7: 562-578.
191. Morales VM, Backman A, Bagdasarian M (1991) A series of wide-host-range low-
copy-number vectors that allow direct screening for recombinants. Gene 97: 39-
47.

171