Ecological Genetics and Genomics 31 (2024) 100244

Contents lists available at ScienceDirect

Ecological Genetics and Genomics

journal homepage: www.elsevier.com/locate/egg

Impact of electrolyzed water treatment on bacterial communities in food

washing processes
Akifumi Hosoda a, *, Yuka Ito a, Takaaki Kojima a, Yki Ogata b, Minami Haga b, Yu Akimoto b,
Miki Shirasawa b, Michiru Kishimoto b
a
Faculty of Agriculture, Meijo University, 1-501 Shiogamaguchi, Tempaku-ku, Nagoya City, Aichi, 468-8502, Japan
b
Department of Nutritional Sciences, School of Nutritional Sciences, Nagoya University of Arts and Sciences, Japan

A R T I C L E I N F O A B S T R A C T

Keywords: Electrolyzed water is expected to have a sterilizing effect on bacteria and viruses, which makes it useful for
Electrolyzed water hygiene management, such as cleaning dishes or medical equipment. Electrolyzed water treatment may affect the
Next-generation sequencing cellular structure of microbes, leading to DNA leakage or degradation. Here, we conducted a next-generation
Nonmetric multidimensional scaling
sequencing (NGS) analysis of bacterial diversity in washing solution to elucidate the impact of cleaning food
surfaces with electrolyzed water. Modified primers were used to evaluate the differences between the existing
primers used to obtain NGS sequences and through statistical analysis. The NGS reads obtained using the
modified primers tended to reveal more Enterobacteriaceae sequences, and fewer mitochondrial sequences than
did those obtained with conventional primers. An UniFrac distance analysis and Nonmetric multidimensional
scaling (NMDS) revealed that the results obtained with the modified primer set made the differences between
samples more distinct. Real-time polymerase chain reaction (PCR) using the template DNA obtained from an
electrolyzed water or sodium hypochlorite solution wash revealed that some of the DNA could not be amplified
using PCR of the 16S rRNA genes suggesting that the DNA fragmentation had occurred due to the electrolyzed
water treatment. Our results revealed that the bacterial species removed from the food surfaces varied depending
on the washing treatment. Electrolyzed water treatment may be advantageous for removing Enterobacteriaceae
from leafy vegetables.

1. Introduction pathogens that are responsible for spoilage. The common chlorine-based
washing method used to process leafy vegetables has various influences
On the surface of leafy vegetables, which are consumed either raw or on the surface microbiota. Chlorine-based washing has been reported to
minimally processed, the phyla Actinobacteria, Bacteroidetes, Firmi­ reduce the number of microbes that inhibit the growth of pathogens in
cutes, and Proteobacteria are predominant [1]. However, the microbial some leafy vegetables [1,6]. Electrolyzed water with an approximately
community structure on the surface of leafy vegetables is far less diverse acidic or neutral pH (2.5–3.5 or 6.5–7.5) has been suggested as an
than that in cultivated soils or marine sediments [2]. Consuming alternative washing solution with disinfection capability comparable to
nonheat-treated food is believed to contribute to human health, as it that of commonly used disinfection chemicals.
may preserve its nutritional content. Recently, foods that fall under this Electrolyzed water is used for various applications, such as the
category, with raw vegetables being a prime example, have increasingly removal of bacteria and viruses on the surfaces of vegetables and fruits,
been processed with sterilization treatments and are readily available sterilization during the processing of seafood and meat, hygiene man­
for purchase. Human pathogens mostly associated with leafy vegetables agement in medical facilities, inhibition of the growth of microorgan­
include pathogenic Escherichia coli, Salmonella spp., and Listeria mono­ isms in water treatment processes, and ensuring safety in the food
cytogenes, but these vary widely according to vegetable type and bac­ processing industry, medical facilities, drinking water treatment, and
terial community structure [3–5]. Assessment of the composition of the agriculture [7]. In recent years, electrolyzed water has also been used for
microbial community is needed because the microbiome present on various tasks, such as disinfecting household bathrooms and kitchens.
fresh products acts as a natural biological barrier against organisms and Furthermore, electrolyzed water is commonly used in various forms,

* Corresponding author.
E-mail address: [email protected] (A. Hosoda).

https://doi.org/10.1016/j.egg.2024.100244
Received 8 February 2024; Received in revised form 7 April 2024; Accepted 10 April 2024
Available online 16 April 2024
2405-9854/© 2024 Published by Elsevier Inc.
A. Hosoda et al. Ecological Genetics and Genomics 31 (2024) 100244

including acidic, slightly acidic, and alkaline solutions. Thus, when Laboratory, Tokyo, Japan) according to the manufacturer’s instructions.
electrolyzed water comes into direct contact with animal tissues, it can The sample preparations and subsequent DNA extraction, NGS analysis,
lead to cell membrane disruption, protein denaturation, and oxidative and real-time polymerase chain reaction (PCR) were conducted three
stress, which affect enzymes and metabolic pathways within the cells [8, times on different dates.
9]. When applied to plants, it may alter cell wall and leaf surface
structures and interfere with photosynthesis and nutrient absorption 2.2. Viable bacterial cell count
[10]. Moreover, electrolyzed water can potentially damage bacterial
biofilms and the cell membranes of microbes (i.e., bacteria, fungi, or Samples (5 mL each) were taken from electrolyzed water (E), hy­
viruses) [11–13]. Acidic electrolyzed water may contain reactive oxygen pochlorite solution (H), and tap water (W) after washing the lettuce
species that induce oxidative stress, potentially damaging the internal plants. These samples were then serially diluted and cultured at 35 ◦ C for
structures of bacteria and fungi and the external structures of viruses. a maximum of 10 h using Petrifilm AC (3 M Japan, Tokyo, Japan) to
Consequently, electrolyzed water exhibits antimicrobial and antiviral measure the viable bacterial cell count. This experiment was conducted
properties. Thus, the mechanisms of the sterilization effect of electro­ three times in accordance with the sample preparation methods
lyzed water, which can damage cell lipid membranes, denature proteins, described above.
and prevent microbe reproduction by cell destruction and cutting DNA
mainly depend on the synergistic effects of HClO and Cl2 with H2O2 and 2.3. Primer design and PCR
OH− species [14,15].
Considering this background, the impact of electrolyzed water ster­ The combinations used to amplify the V3/V4 variable regions of the
ilization on the microbial community structure on the surfaces of fresh 16S rRNA of the bacteria are presented in Table 1. The sample data
vegetables has been reported in many studies, including those based on generated from the 16SnV34–F and 16SnV34-R primer sets were
16S rRNA gene analysis [16–19]. When studying associations between assigned IDs starting with “n.” In this primer set, the forward primer
plants and microorganisms, it is often crucial to conduct bacterial position was adjusted to facilitate the amplification of DNA from
community structure analysis using 16S rRNA gene amplicons. In such Enterobacteriaceae but minimize the amplification of chloroplast or
cases, it is important to exclude chloroplast sequences derived from mitochondrial DNA from washed vegetables. To evaluate the new
plants. Chloroplasts also retain their circular DNA with a 16S rRNA gene, primer set, the S-D-Bact-0341-b-S-17 (341F as follows) and S-D-Bact-
which is remarkably similar to what has been observed for bacteria. The 0785-a-A-21 (785R as follows) primer combinations, which constitute a
rRNA cannot be synthesized de novo and must be inherited from parental conventional primer set for NGS analysis [24], were also used for
cells; thus, it is present in every plant cell [20]. There have been reports amplification and subsequent sequencing. Sample data generated from
of methods for excluding plant-derived genetic information from these analyses were assigned IDs starting with “o.” PCR was performed
next-generation sequencing (NGS) analysis used for bacterial commu­ to amplify the target gene in each sample and apply it for NGS analysis.
nity studies [21–23]. We washed vegetable surfaces with electrolyzed The PCR mixture (50 μL) consisted of nuclease-free H2O, 1 × KOD One
water and conducted microbial community structure analyses of the PCR Master Mix (TOYOBO, Osaka, Japan), primers (10 μM each), and
washing solution using NGS to elucidate how the microbes were affected 50 ng of template DNA. The reaction conditions were as follows: initial
by washing with electrolyzed water. In some samples, however, we denaturation at 95 ◦ C for 1 min, followed by 25 cycles at 98 ◦ C for 10 s,
found that sequences derived from plants, such as chloroplasts or 50 ◦ C for 5 s, and 68 ◦ C for 1 s. A T100 thermal cycler (Bio-Rad, Tokyo,
mitochondria, were more abundant than those derived from bacteria. Japan) was used. The PCR products (5 μL) were subjected to agarose gel
Considering the food hygiene aspect, it is important to assess the extent electrophoresis. To determine whether the PCR products obtained by the
to which bacteria on the surface of vegetables can be removed by elec­ new primer set were of bacterial or chloroplast origin, cloning was
trolyzed water. Therefore, we focused on the Enterobacteriaceae using conducted using In-Fusion technology (Takara Bio, Tokyo, Japan) was
the data obtained from the present analysis. conducted. The proportion of bacterial sequences was then determined
In the present study, we constructed primers that efficiently detect through colony PCR and restriction enzyme digestion of the amplicons,
Enterobacter sequences and reduce the detection of chloroplasts and which were subsequently separated by agarose gel electrophoresis (2 %
mitochondria, and present the results of the investigation. Furthermore, w/v).
statistical analysis and elucidation of the effectiveness of the developed
primers were conducted using the obtained NGS data. 2.4. NGS and DNA quality check

2. Materials and methods The purity and quantity of the DNA were examined by measuring the
UV absorption spectrum of the preparation using a DS-11 microvolume
2.1. Sample preparation and DNA extraction spectrophotometer (DeNovix, Tokyo, Japan). For analysis of archaeal
and bacterial community structures, the V3/V4 region of the 16S rRNA
Electrolyzed water (80–100 ppm of available chlorine concentration gene was amplified using a new primer set (i.e., 16SnV34–F and
[ACC]) generated by an electrolyzed water purification system (VOX- 16SnV34-R) or the conventional primer set 341F/785R [25] with 1 ng of
40TA; Hoshizaki, Aichi, Japan) and sodium hypochlorite solution pre­ each DNA as a template. The amplicons were purified using AMPure XP
pared at 200 ppm were used as washing solutions. The ACC of both beads (Beckman Coulter, Brea, CA, USA) and sequenced on an Illumina
solutions was measured using an ACC meter (AQ-202P; Shibata Scien­ MiSeq system (Illumina, San Diego, CA, USA) using 2 × 300 base-pair
tific, Tokyo, Japan). The pH of the washing solutions was measured (bp) paired-end reads. In addition, for samples where PCR amplifica­
using a pH meter. Commercially available lettuce was used as the model tion was not observed, real-time PCR (StepOne Plus; Thermo Fisher
leafy vegetable and was washed using the following method. Approxi­ Scientific, Carlsbad, CA, USA) was conducted using a primer set (i.e.,
mately 125 g of lettuce was cut into pieces approximately 5 cm square. 16S_V3-4_F and 16S_V3-4_R, as specified in Table 1) designed within the
The lettuce pieces were then washed in each of 1.5 L of washing solution primer set used for NGS analysis. The template DNA fragmentation was
(i.e., electrolyzed water designated as E, hypochlorite solution desig­ confirmed by obtaining dissociation curve data through real-time PCR.
nated as H, or tap water designated as W). The microorganisms present The PCR mixture (20 μL) comprised nuclease-free H2O, Fast SYBR Green
in each wash fluid were collected using presterilized filters (mixed cel­ Master Mix (Thermo Fisher Scientific), primer (10 μM each), and 2 ng of
lulose acetate with 0.45 μm pore size, 47 mm diameter). The filters were template DNA. The reaction conditions were initial denaturation at
stored at − 20 ◦ C until bacterial DNA from the material trapped by the 95 ◦ C for 20 s, followed by 40 cycles at 95 ◦ C for 3 s and 60 ◦ C for 30 s.
filter was extracted using Extrap Soil DNA Kit Plus ver2 (BioDynamics After 95 ◦ C for 15 s and 60 ◦ C for 60 s reaction, the temperature of the

2
A. Hosoda et al. Ecological Genetics and Genomics 31 (2024) 100244

Table 1
Primers used for NGS analysis and real-time PCR.
Primer name Sequence Author

16SnV34–F 5′- ACACTCTTTCCCTACACGACGCTCTTCCGATCTAGACACGGTCCAGACT -3′ This study

16SnV34-R 5′- GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTGACTACCAGGGTATCTAATCC -3′ This study
S-D-Bact-0341-b-S-17 5′- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG -3′ Klindworth et al., 2012)
S-D-Bact-0785-a-A-21 5′- GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATCC -3′ Klindworth et al., 2012)
16S_V3-4_F 5′- CCTACGGGNGGCWGCAG -3′ This study
16S_V3-4_R 5′- GACTACHVGGGTATCTAATCC -3′ This study

samples was increased from 60 ◦ C to 95 ◦ C at 0.3 ◦ C per second, leading pipeline. A taxonomy analysis of a representative sequence for the
to the denaturation of PCR products to generate the dissociation curve. candidate V3/V4 reads was conducted using the SILVA reference data­
base [26] to obtain operational taxonomic units (OTUs) (>99 %). The
permutational multivariate analysis of variance (PERMANOVA) and
2.5. Sequence data processing and statistical analysis α-diversity measurements were calculated using QIIME 2. The following
statistical analyses were performed using R software (v. 4.3.2) and its
Sequence reads that showed a perfect match of the end sequences to vegan package (v. 2.6–4) [27]. A β-diversity index was calculated for
the primer sequences were selected using the fastq_barcode_splitter in each pair of samples. Nonmetric multidimensional scaling (NMDS) was
the FASTX toolkit. The 3′ end sequence was trimmed of both primer and performed to determine the changes in the community structure in each
50 bp, and the noise-removal reads were processed using a QIIME 2

Fig. 1. Relative abundance of microbial phyla (family level) in the electrolyzed water (E), hypochlorite solution (H), and tap water (W) samples determined using the
new primer sets.

3
A. Hosoda et al. Ecological Genetics and Genomics 31 (2024) 100244

sample. Oxalobacteraceae, and Pseudomonadaceae families) in all three treat­

ment groups (Fig. 1). The α diversity indices between electrolyzed water
(E), hypochlorite solution (H), and tap water (W) fluid calculated by
2.6. Accession numbers of NGS sequencing reads PERMANOVA were 2.52 (p = 0.001) for the new primer set and 1.76 (p
= 0.002) for the conventional primer set. In addition, the Faith phylo­
The data have been deposited with links to BioProject accession genetic diversity (PD) index values between electrolyzed water (E),
number PRJDB17442 in the DDBJ BioProject database. hypochlorite solution (H), and tap water (W) fluid were 7.61 (p = 0.022)
for the new primer set and 9.30 (p = 0.098) for the conventional primer
3. Results and discussion set. Analysis of the weighted UniFrac β diversity demonstrated a distinct
phylogenetic response between the E, H, and W microcosms (Fig. 2). The
3.1. Assessment of the new primer used for bacterial community analysis primary axis explained 55.6 % of the variation, and the secondary axis
via NGS explained 23.6 % with new primer, while 67.4 % of primary axis and
14.1 % of secondary axis with conventional primer (Supplementary
According to the analysis of the NGS reads generated using the new Fig. 1), showing that microbial diversity is relatively similar in H and W,
primers, the chloroplast sequences were not removed completely. but not in E samples. This trend was evaluated by the Bray–Curtis index
Nevertheless, 90 % of the mitochondrial sequences were removed from (data not shown). A Mantel test was conducted to determine the cor­
the amplicon sequences. Reads derived from the amplicon using the new relation between microbial diversity and environmental parameters,
primers and the conventional primers were subjected to taxonomy which included viable cell count (CC), available chlorine concentration
analysis as a classifier based on the SILVA database. Note that chloro­ (ACC), and pH of the wash fluids. The results indicated that the H sample
plast and mitochondrial sequences were removed by executing the communities were correlated with the cell counts (r = 0.486, p < 0.025),
QIIME 2 taxa filter-table command. As a result, 846,489 reads (from the but those in the E, W, and H samples were not significantly correlated
new primer, sample names designated as nE00) and 470,129 reads (from with any factor (Table 2). When investigating the bacterial diversity
the conventional primer, sample names designated as oE00) were ob­ using primers for the 16S rRNA gene, it is possible to amplify the 16S
tained. Our results might be unavoidable because it has been docu­ rRNA region of chloroplasts with these primers. However, we must note
mented that chloroplast sequences can still be detected in the DNA that these 16S rRNA gene primers are not intentionally designed to
extracted from the leaves and surfaces of plants [21]. In the case of the target chloroplast sequences; rather any amplification is likely due to
new primers, however, Enterobacteriaceae reads showed an increase in incidental similarity. Therefore, it is necessary to assess the validity of
the percentage of sequences detected by 20%–50 % in the E and H the obtained results when using 16S rRNA primers are used for the NGS
samples. This result was preferable for our purposes. analysis with template DNA that may contain chloroplast sequences.
An analysis of the bacterial composition showed that the sequences
within all the evaluated sites were affiliated with 43 bacterial families.
Four families with percentages of OTUs above 0.1 % were considered the
most abundant (from the Beijerinckiaceae, Comamonadaceae,

Fig. 2. (a) Beta diversity estimation comparing microbial communities in the E, H, and W samples by permutational multivariate analysis of variance. (b) Weighted
UniFrac distances comparing communities based on the phylogenetic relatedness of their constituent bacteria. E, electrolyzed water; H, hypochlorite solution; W,
tap water.

4
A. Hosoda et al. Ecological Genetics and Genomics 31 (2024) 100244

Table 2 solution led to the growth of viable cells, resulting in survival at

Relationships between bacterial community structure and environmental factors approximately 105 cells/mL, whereas tap water resulted in survival at
in OTUs of E, H and W samples as revealed by the Mantel test. 107 cells/mL (data not shown). The antibacterial effect of electrolyzed
All_OTUs E_OTUs H_OTUs W_OTUs water is specific to certain bacteria and does not similarly exhibit effi­
Viable cell counts R 0.129 − 0.161 0.486 0.336
cacy against a broad range of bacterial species [7,41]. Some bacterial
p value 0.217 0.693 0.025 0.114 strains, spores, and microorganisms within biofilms may resist electro­
ACC R − 0.0242 0.0851 0.467 0.103 lyzed water treatment. Consequently, as general bacterial growth me­
p value 0.579 0.367 0.200 0.333 dium agar plates were used for this cultivation, specific identification of
pH R 0.116 0.0627 − 0.299 − 0.105
bacterial species was not possible. However, some of the bacterial spe­
p value 0.122 0.411 0.833 0.528
cies identified in the washing fluid through NGS analysis indicated that
E_OTUs, H_OTUs and W_OTUs means OTUs obtained from E, H and W samples, they could grow under the given culture conditions.
respectively. Because a non-metric multidimensional scaling (NMDS) analysis was
All_OTUs means OTUs combined E, H and W samples.
commonly used method for comparing microbial communities [42], all
the OTUs without chloroplasts or mitochondrial reads were subjected to
3.2. Bacterial community composition of the wash fluid NMDS analysis for each sample to determine the clustering of the sam­
ples (Fig. 3). The stress value of the E, H, and W sample communities in
Approximately 100,000 sequences were obtained from each elec­ the NMDS was 0.128. Sequence similarities obtained from NMDS plots
trolyzed water, hypochlorite solution, and tap water sample using the were observed within each group in the W and H samples, and it was
new or conventional primer sets. However, the reads of five samples revealed that there was no clustering in the E sample. Furthermore,
(oE3, oH3, oH5, oH6, and oW1) obtained by the conventional primer set when OTUs and environmental factors (CC, ACC, and pH) were calcu­
were <10,000 (Supplementary Fig. 2). These sequences with more than lated using R software’s “envfit” function for the three samples, it
a 0.1 % similarity ratio were clustered into 43 OTUs per sample at the 99 demonstrated that the CC appropriately explained the variability in the
% similarity level (Supplementary Table 1). The results of the NGS for W sample (p > 0.001). By contrast, ACC (p > 0.20) and pH (p > 0.68)
microbial community analysis at the family level are illustrated in Fig. 1, were not able to explain the variability in any of the samples appro­
because the family level best reflects the microbial community infor­ priately. This trend was also observed in the NMDS plots generated using
mation comprehensively and in detail. The dominant families included the conventional primer set (Supplementary Fig. 3). The viable cell
Comamonadaceae, Enterobacteriaceae, Limnochordaceae, Rhizobia­ count from the cultivation experiment was approximately two orders of
ceae, Thermoactinomycetaceae, and Xanthomonadaceae, which were magnitude greater in the W sample, as follows, suggesting that the
most prevalent in the electrolyzed water samples. The Bacillaceae and bacteria were washed away in the fluid. However, the bacteria in the E
Paenibacillaceae families were most prevalent in the H samples, but the or H samples were sterilized as well as washed away during the washing
tendency of predominant families in the H samples was the same as that treatment. The substantial variability observed in the NMDS plot for the
in the E samples. The Erwiniaceae, Microbacteriaceae, Micrococcaceae, E samples seemed to be due to PCR product bias or the poor quality of
Oxalobacteraceae, Sphingomonadaceae, and Yersiniaceae families were the template DNA. The results confirming the quality of the template
most prevalent in the W samples. Pseudomonadaceae were predominant DNA by real-time PCR revealed that amplification of the target gene was
after all three treatments. The Comamonadaceae, Erwiniaceae, Micro­ achieved from tap water DNA, whereas there was no amplification of the
bacteriaceae, Micrococcaceae, Oxalobacteraceae, Paenibacillaceae, DNA from electrolyzed water. In addition, the melting curve shapes
Pseudomonadaceae, Rhizobiaceae, Sphingomonadaceae, Xanthomona­ determined by real-time PCR suggested fragmentation of the template
daceae, and Yersiniaceae families included the plant growth-promoting DNA in the electrolyzed water samples (data not shown). Li et al. re­
rhizobacteria (PGPR) and plant-associated bacteria [28–38]. The ported that the primary bactericidal effect of HClO in slightly acidic
observation of Enterobacteriaceae together with PGPR and Limnochor­ electrolyzed water may involve the generation of chlorinated de­
daceae, was presumed to have originated from residues remaining from rivatives of nucleotide bases, causing DNA damage, indicating that
the compost in the food samples. template DNA was fragmented in this experiment [10].
The NGS analysis of the bacterial community structure collected
3.3. Assessing the impact of washing vegetables with electrolyzed water from the washing fluid revealed an abundance of plant-derived chloro­
plast sequences not only in the tap water samples but also in the elec­
The dominant taxa detected in the NGS reads in the E samples were trolyzed water and hypochlorite water samples. Although electrolyzed
Comamonadaceae, Enterobacteriaceae, Rhizobiaceae, Thermoactino­ water is generally believed not to affect the quality or surface structure
mycetaceae, and Xanthomonadaceae. In addition, the H samples changes of foods, including plants [19,43], these results suggest the
revealed a dominance of Bacillaceae and Paenibacillaceae. Conversely, possibility of damaging the cell membrane of the plant cell surface. The
NGS reads belonging to Erwiniaceae, Micrococcaceae, Oxalobacter­ damage to plant cell membranes by electrolyzed water could lead to
aceae, and Yersiniaceae were predominant in the W sample. Pseudo­ changes in cell permeability and substance leakage. Therefore, attention
monadaceae exhibited a high read count in all three treatments. No should be given to factors such as the duration of the washing process
significant differences in these trends were observed between the two and the chlorine concentration. The importance of parameters such as
primer sets used in this study (Fig. 1 and Supplementary Fig. 2.). washing time and chlorine concentration should be considered when
Washing with electrolyzed water or hypochlorite solution has been re­ evaluating the effect of electrolyzed water to avoid potential damage to
ported to reduce the biofilm formation of Enterobacteriaceae, which was cell membrane integrity during the food washing process.
detected as predominant in the sample [39]. The destruction of the
surface structure of bacterial cells by electrolyzed water treatment has 4. Conclusions
also been reported [15]. Furthermore, the combination of ultrasound
and electrolyzed water treatment has been associated with damage to The primers used in this study were unable to selectively eliminate
the cell surface of Bacillaceae and its spores, demonstrating bactericidal the chloroplast sequences derived from food during NGS analysis.
effects [18,40]. These findings and our results suggest that Cl− and HClO However, we observed that these primers could reduce the number of
contribute to decreased adhesion between the plant surface and bacte­ mitochondrial sequences by approximately 90 % and increase the
rial cell surfaces, especially for Enterobacteriaceae. detection frequency of Enterobacteriaceae by a few percent. In future
In subsequent bacterial culture experiments with the washing fluid, bacterial NGS analyses derived from food samples, it is essential to
we found that treatment with electrolyzed water and hypochlorite design primers that amplify the target 16S rRNA gene sequences while

5
A. Hosoda et al. Ecological Genetics and Genomics 31 (2024) 100244

Fig. 3. Nonmetric multidimensional scaling was performed based on the Bray–Curtis similarity of the bacterial communities in each sample using a new primer.
Arrows indicate the environmental factors calculated by R software’s “envfit” function.

minimizing the simultaneous amplification of food-derived DNA. that may be removed by washing with electrolyzed water.
When lettuce surfaces were washed with electrolyzed water or tap
water, the extent to which the bacterial community structures were CRediT authorship contribution statement
removed exhibited significant differences. After treatment with elec­
trolyzed water and sodium hypochlorite solution, Bacillaceae, Coma­ Akifumi Hosoda: Writing – review & editing, Writing – original
monadaceae, and Enterobacteriaceae were efficiently removed, while draft, Conceptualization. Yuka Ito: Investigation, Data curation.
tap water treatment efficiently removed Erwiniaceae and Oxalobacter­ Takaaki Kojima: Investigation, Data curation. Yki Ogata: Investiga­
aceae. These observed bacterial families were presumed to inhabit the tion, Data curation. Minami Haga: Investigation, Data curation. Yu
surfaces of plants or be PGPRs. However, no significant differences were Akimoto: Investigation, Data curation. Miki Shirasawa: Investigation,
observed in the bacterial communities rinsed off with electrolyzed Data curation. Michiru Kishimoto: Supervision, Resources, Project
water. On the other hand, the Mantel test revealed that the bacterial administration, Conceptualization.
communities in the sodium hypochlorite solution were correlated with
the viable cell counts in the wash fluid. In the analysis using NMDS to
Declaration of competing interest
assess the similarity between samples, clusters were also observed be­
tween the W and H samples, while no distinct cluster was observed in the
The authors declare that they have no known competing financial
E sample. This difference is attributed not only to the similarity of the
interests or personal relationships that could have appeared to influence
detected reads but also to the type of washing solution and the viability
the work reported in this paper.
of the bacteria being removed, indicating that clustering was influenced
by the combination of these factors. While other studies have found that
Data availability
electrolyzed water treatment has a minimal impact on bacterial com­
munities [41], we found that the bacterial species that were washed off
Data will be made available on request.
by electrolyzed water or sodium hypochlorite solution treatment
significantly differed from those that were washed off by tap water.
Acknowledgements
Previous research has reported on the destruction of bacterial biofilms
and the bactericidal effects of electrolyzed water treatment. To our
We thank associate professor Kouhei Nakamura for his technical
knowledge, this study is the first to clarify the potential bacterial species
assistance of NGS analysis. This study was supported in part by JSPS

6
A. Hosoda et al. Ecological Genetics and Genomics 31 (2024) 100244

KAKENHI Grant Number JP20K05407 and JP23K04654 from the Min­ [21] R. Artimová, L. Hleba, S. Javoreková, J. Maková, J. Medová, J. Medo, Chloroplast
excluding primers for metagenomic analysis of bacteria in plant tissues,
istry of Agriculture, Forestry and Fisheries of Japan, and by Institute of
J. Microbiol. Biotechnol. Food Sci. 12 (2022) e9650, https://doi.org/10.55251/
Health and Nutrtion in Nagoya University of Arts and Science, Japan. jmbfs.9650, e9650.
[22] B. Beckers, M. Op De Beeck, S. Thijs, S. Truyens, N. Weyens, W. Boerjan,
J. Vangronsveld, Performance of 16s rDNA primer pairs in the study of rhizosphere
Appendix A. Supplementary data and endosphere bacterial microbiomes in metabarcoding studies, Front. Microbiol.
7 (2016) 650, https://doi.org/10.3389/fmicb.2016.00650.
Supplementary data to this article can be found online at https://doi. [23] M. Nakano, 16S rRNA gene primer validation for bacterial diversity analysis of
vegetable products, J. Food Protect. 81 (2018) 848–859, https://doi.org/10.4315/
org/10.1016/j.egg.2024.100244.
0362-028X.JFP-17-346.
[24] A. Klindworth, E. Pruesse, T. Schweer, J. Peplies, C. Quast, M. Horn, F.O. Glöckner,
References Evaluation of general 16S ribosomal RNA gene PCR primers for classical and next-
generation sequencing-based diversity studies, Nucleic Acids Res. 41 (2013) e1,
https://doi.org/10.1093/nar/gks808.
[1] S. Tenzin, A.D. Ogunniyi, S. Ferro, P. Deo, D.J. Trott, Effects of an eco-friendly
[25] J.G. Caporaso, C.L. Lauber, W.A. Walters, D. Berg-Lyons, C.A. Lozupone, P.
sanitizing wash on spinach leaf bacterial community structure and diversity, Appl.
J. Turnbaugh, N. Fierer, R. Knight, Global patterns of 16S rRNA diversity at a depth
Sci. 10 (2020) 2986, https://doi.org/10.3390/app10082986.
of millions of sequences per sample, Proc. Natl. Sci. 108 (2011) 4516–4522,
[2] I. Bashir, A.F. War, I. Rafiq, Z.A. Reshi, I. Rashid, Y.S. Shouche, Phyllosphere
https://doi.org/10.1073/pnas.1000080107.
microbiome: diversity and functions, Microbiol. Res. 254 (2022) 126888, https://
[26] P. Yilmaz, L.W. Parfrey, P. Yarza, J. Gerken, E. Pruesse, C. Quast, T. Schweer,
doi.org/10.1016/j.micres.2021.126888.
J. Peplies, W. Ludwig, F.O. Glöckner, The SILVA and “all-species living tree project
[3] A.V. Chinchkar, A. Singh, S.V. Singh, A.M. Acharya, M.G. Kamble, Potential
(LTP)” taxonomic frameworks, Nucleic Acids Res. 42 (2014) D643–D648, https://
sanitizers and disinfectants for fresh fruits and vegetables: a comprehensive review,
doi.org/10.1093/nar/gkt1209.
J. Food Process. Preserv. 46 (2022) e16495, https://doi.org/10.1111/jfpp.16495.
[27] R Core Team, R: A Language and Environment for Statistical Computing, 2019.
[4] C.M. Marik, J. Zuchel, D.W. Schaffner, L.K. Strawn, Growth and survival of Listeria
https://www.R-project.org/.
monocytogenes on intact fruit and vegetable surfaces during postharvest handling:
[28] T. Islam, M.N. Hoque, D.R. Gupta, N.U. Mahmud, T.I. Sakif, A.G. Sharpe,
a systematic literature review, J. Food Protect. 83 (2020) 108–128, https://doi.
Improvement of growth, yield and associated bacteriome of rice by the application
org/10.4315/0362-028X.JFP-19-283.
of probiotic Paraburkholderia and Delftia, Front. Microbiol. 14 (2023) 1212505,
[5] M. Mkangara, Prevention and control of human Salmonella enterica infections: an
https://doi.org/10.3389/fmicb.2023.1212505.
implication in food safety, Int. J. Food Sci. 2023 (2023), https://doi.org/10.1155/
[29] P. Singh, R.K. Singh, H.-B. Li, D.-J. Guo, A. Sharma, P. Lakshmanan, M.K. Malviya,
2023/8899596.
X.-P. Song, M.K. Solanki, K.K. Verma, Diazotrophic bacteria Pantoea dispersa and
[6] H. Shi, C. Li, H. Lu, J. Zhu, S. Tian, Synergistic effect of electrolyzed water
Enterobacter asburiae promote sugarcane growth by inducing nitrogen uptake and
generated by sodium chloride combined with dimethyl dicarbonate for inactivation
defense-related gene expression, Front. Microbiol. 11 (2021) 600417, https://doi.
of Listeria monocytogenes on lettuce, J. Sci. Food Agric. 103 (2023) 7905–7913,
org/10.3389/fmicb.2020.600417.
https://doi.org/10.1002/jsfa.12884.
[30] R. Ouertani, A. Ouertani, M. Mahjoubi, Y. Bousselmi, A. Najjari, H. Cherif,
[7] S. Palamae, W. Temdee, J. Buatong, B. Zhang, H. Hong, S. Benjakul, Enhancement
A. Chamkhi, A. Mosbah, H. Khdhira, H. Sghaier, New plant growth-promoting,
of safety and quality of ready-to-cook Asian green mussel using acidic electrolyzed
chromium-detoxifying microbacterium species isolated from a tannery wastewater:
water depuration in combination with sous vide cooking, Innovat. Food Sci. Emerg.
performance and genomic insights, Front. Bioeng. Biotechnol. 8 (2020) 521,
Technol. 87 (2023) 103391, https://doi.org/10.1016/j.ifset.2023.103391.
https://doi.org/10.3389/fbioe.2020.00521.
[8] A. Fadriquela, M.E.J. Sajo, J. Bajgai, D.-H. Kim, C.-S. Kim, S.-K. Kim, K.-J. Lee,
[31] A.S. Ayangbenro, O.O. Babalola, Reclamation of arid and semi-arid soils: the role of
Effects of strong acidic electrolyzed water in wound healing via inflammatory and
plant growth-promoting archaea and bacteria, Curr. Plant Biol. 25 (2021) 100173,
oxidative stress response, Oxid. Med. Cell. Longev. 2020 (2020) 2459826, https://
https://doi.org/10.1016/j.cpb.2020.100173.
doi.org/10.1155/2020/2459826.
[32] S.H. Ham, A.R. Yoon, H.E. Oh, Y.G. Park, Plant growth-promoting microorganism
[9] S. Yano, J. Wang, S. Kabayama, T. Hara, Electrolyzed hydrogen water protects
Pseudarthrobacter sp. NIBRBAC000502770 enhances the growth and flavonoid
against ethanol-induced cytotoxicity by regulating aldehyde metabolism-
content of Geum aleppicum, Microorganisms 10 (2022) 1241, https://doi.org/
associated enzymes in the hepatic cell line HepG2, Antioxidants 10 (2021) 801,
10.3390/microorganisms10061241.
https://doi.org/10.3390/antiox10050801.
[33] H.-P. Li, Y.-N. Gan, L.-J. Yue, Q.-Q. Han, J. Chen, Q.-M. Liu, Q. Zhao, J.-L. Zhang,
[10] H. Li, D. Liang, J. Huang, C. Cui, H. Rao, D. Zhao, J. Hao, The bactericidal efficacy
Newly isolated Paenibacillus monticola sp. nov., a novel plant growth-promoting
and the mechanism of action of slightly acidic electrolyzed water on Listeria
rhizobacteria strain from high-altitude spruce forests in the Qilian Mountains,
monocytogenes’ survival, Foods 10 (2021) 2671, https://doi.org/10.3390/
China, Front. Microbiol. 13 (2022) 833313, https://doi.org/10.3389/
foods10112671.
fmicb.2022.833313.
[11] L.-l. Cai, H.-j. Hu, Q. Lu, H.-h. Wang, X.-l. Xu, G.-h. Zhou, Z.-l. Kang, H.-j. Ma,
[34] C. Gruet, M. Alaoui, F. Gerin, C. Prigent-Combaret, A. Börner, D. Muller,
Morphophysiological responses of detached and adhered biofilms of Pseudomonas
Y. Moënne-Loccoz, Genomic content of wheat has a higher influence than plant
fluorescens to acidic electrolyzed water, Food Microbiol 82 (2019) 89–98, https://
domestication status on the ability to interact with Pseudomonas plant growth-
doi.org/10.1016/j.fm.2019.01.007.
promoting rhizobacteria, Plant Cell Environ. 46 (2023) 3933–3948.
[12] J.G. Lemos, A. Stefanello, M.V. Garcia, A.F. Furian, A.J. Cichoski, M.V. Copetti,
[35] S. Debnath, A. Das, D. Maheshwari, P. Pandey, Treatment with atypical rhizobia,
Potential of electrolyzed water to inactivate bread and cheese spoilage fungi, Food
pararhizobium giardinii and ochrobactrum sp. modulate the rhizospheric bacterial
Res. Int. 162 (2022) 111931, https://doi.org/10.1016/j.foodres.2022.111931.
community, and enhances lens culinaris growth in fallow-soil, Microbiol. Res. 267
[13] Y. Takeda, H. Uchiumi, S. Matsuda, H. Ogawa, Acidic electrolyzed water potently
(2023) 127255, https://doi.org/10.1016/j.micres.2022.127255.
inactivates SARS-CoV-2 depending on the amount of free available chlorine
[36] C. Mazoyon, M. Catterou, A. Alahmad, G. Mongelard, S. Guénin, V. Sarazin,
contacting with the virus, Biochem. Biophys. Res. Commun. 530 (2020) 1–3,
F. Dubois, J. Duclercq, Sphingomonas sediminicola Dae20 is a highly promising
https://doi.org/10.1016/j.bbrc.2020.07.029.
beneficial bacteria for crop biostimulation due to its positive effects on plant
[14] B.-K. Chen, C.-K. Wang, Electrolyzed water and its pharmacological activities: a
growth and development, Microorganisms 11 (2023) 2061, https://doi.org/
mini-review, Molecules 27 (2022) 1222, https://doi.org/10.3390/
10.3390/microorganisms11082061.
molecules27041222.
[37] A. Kumar, L. Rithesh, V. Kumar, N. Raghuvanshi, K. Chaudhary, A.K. Pandey,
[15] H.-J. Kim, C.N. Tango, R. Chelliah, D.-H. Oh, Sanitization efficacy of slightly acidic
Stenotrophomonas in diversified cropping systems: friend or foe? Front. Microbiol.
electrolyzed water against pure cultures of Escherichia coli, Salmonella enterica,
14 (2023) https://doi.org/10.3389/fmicb.2023.1214680.
Typhimurium, Staphylococcus aureus and Bacillus cereus spores, in comparison
[38] M.A. Hamada, E.R. Soliman, Characterization and genomics identification of key
with different water hardness, Sci. Rep. 9 (2019) 4348, https://doi.org/10.1038/
genes involved in denitrification-DNRA-nitrification pathway of plant growth-
s41598-019-40846-6.
promoting rhizobacteria (Serratia marcescens OK482790), BMC Microbiol. 23
[16] R.E. Ampiaw, M. Yaqub, W. Lee, Electrolyzed water as a disinfectant: a systematic
(2023) 210, https://doi.org/10.1186/s12866-023-02941-7.
review of factors affecting the production and efficiency of hypochlorous acid,
[39] H. Tao, Q. Liao, Y. Xu, H.-L. Wang, Efficacy of slightly acidic electrolyzed water for
J. Water Process Eng. 43 (2021) 102228, https://doi.org/10.1016/j.
inactivation of Cronobacter sakazakii and biofilm cells, J. Food Protect. 85 (2022)
jwpe.2021.102228.
511–517, https://doi.org/10.4315/JFP-21-263.
[17] J. Hao, J. Zhang, X. Zheng, D. Zhao, Bactericidal efficacy of slightly acidic
[40] R. Lv, A.I. Muhammad, M. Zou, Y. Yu, L. Fan, J. Zhou, T. Ding, X. Ye, M. Guo,
electrolyzed water (SAEW) against Listeria monocytogenes planktonic cells and
D. Liu, Hurdle enhancement of acidic electrolyzed water antimicrobial efficacy on
biofilm on food-contact surfaces, Food Qual. Saf. 6 (2022) fyab038, https://doi.
Bacillus cereus spores using ultrasonication, Appl. Microbiol. Biotechnol. 104
org/10.1093/fqsafe/fyab038.
(2020) 4505–4513, https://doi.org/10.1007/s00253-020-10393-6.
[18] C. Zhang, G. Yang, P. Shen, Y. Shi, Y. Yang, Y. Liu, X. Xia, S. Wang, Inactivation
[41] C. Botta, I. Ferrocino, M.C. Cavallero, S. Riva, M. Giordano, L. Cocolin, Potentially
mechanism of slightly acidic electrolyzed water on Bacillus cereus spores, Food
active spoilage bacteria community during the storage of vacuum packaged
Microbiol 103 (2022) 103951, https://doi.org/10.1016/j.fm.2021.103951.
beefsteaks treated with aqueous ozone and electrolyzed water, Int. J. Food
[19] W. Zhang, J. Cao, W. Jiang, Application of electrolyzed water in postharvest fruits
and vegetables storage: a review, Trends Food Sci. Technol. 114 (2021) 599–607,
https://doi.org/10.1016/j.tifs.2021.06.005.
[20] F.W. Lefler, D.E. Berthold, H. Dail Laughinghouse IV, CyanoSeq: a database of
cyanobacterial 16S rRNA sequences with curated taxonomy, J. Phycol. 59 (2023)
470–480, https://doi.org/10.1111/jpy.13335.

7
A. Hosoda et al. Ecological Genetics and Genomics 31 (2024) 100244

Microbiol. 266 (2018) 337–345, https://doi.org/10.1016/j. [43] A. Tomás-Callejas, G. Martínez-Hernández, F. Artés, F. Artés-Hernández, Neutral
ijfoodmicro.2017.10.012. and acidic electrolyzed water as emergent sanitizers for fresh-cut mizuna baby
[42] G. Mangse, D. Werner, P. Meynet, C.C. Ogbaga, Microbial community responses to leaves, Postharvest Biol. Technol. 59 (2011) 298–306, https://doi.org/10.1016/j.
different volatile petroleum hydrocarbon class mixtures in an aerobic sandy soil, postharvbio.2010.09.013.
Environ. Pollut. 264 (2020) 114738, https://doi.org/10.1016/j.
envpol.2020.114738.