Scribd
Upload
113 views

DNA Sequencing Methods

DNA Sequencing Methods

Uploaded by

Subir Das
Copyright
© Attribution Non-Commercial (BY-NC)
Available Formats
Download as PPT, PDF, TXT or read online on Scribd
113 views

DNA Sequencing Methods

DNA Sequencing Methods

Uploaded by

Subir Das
Copyright
© Attribution Non-Commercial (BY-NC)
Available Formats
Download as PPT, PDF, TXT or read online on Scribd
You are on page 1/ 23

Emily Buckhouse

Nitrogenous Bases

Nucleosides

Base linked to a 2-deoxy-D-ribose at 1 carbon

Nucleotides
Nucleosides with a phosphate at 5 carbon

Phosphodiester Bond

DNA Polymerase

Determining the Sequence of DNA

Methods:
1. Chain termination or dideoxy method

F. Sanger

2. Shotgun sequence method

3. 2nd generation sequence methods

Pyrosequencing

Dideoxy (Sanger) Method

4 Steps:
1. Denaturation
2. Primer attachment and extension of bases 3. Termination

4. Gel electrophoresis

Overview: Dideoxy (Sanger) Method


2 3

1 4

Gel electrophoresis

Dideoxy (Sanger) Method


ddNTP- 2,3dideoxynucleotide No 3 hydroxyl Terminates chain when incorporated Add enough so each ddNTP is randomly and completely incorporated at each base

Dideoxy Method
Run four separate reactions each with different ddNTPs Run on a gel in four separate lanes Read the gel from the bottom up

Automated Version of the Dideoxy Method

So Whats Wrong With It?


The dideoxy method is good only for 500-750bp reactions Expensive Takes a while The human genome is about 3 billion bp

Human Genome Project


Began in 1990 Why?

Human evolution Nature versus nurture Causes of disease

Shotgun Sequencing

Used to sequence whole genomes Steps: DNA is broken up randomly into smaller fragments Dideoxy method produces reads Look for overlap of reads
Sequence AGCATGCTGCAGTCATGCT------First Shotgun Sequence -------------------TAGGCTA AGCATG-------------------Second Shotgun Sequence ------CTGCAGTCATGCTTAGGCTA AGCATGCTGCAGTCATGCTTAGGCTA Reconstruction Strand

2nd Generation: Pyrosequencing


Sequencing by synthesis Advantages:

Accurate Parallel processing Easily automated Eliminates the need for labeled primers and

nucleotides No need for gel electrophoresis

Pyrosequencing

Basic idea:
Visible light is generated and is proportional to the

number of incorporated nucleotides 1pmol DNA = 6*1011 ATP = 6*109 photons at 560nm
DNA Polymerase I from E.coli. pyrophospate

From fireflies, oxidizes luciferin and generates light

Pyrosequencing

1st Method
Solid Phase Immobilized DNA 3 enzymes Wash step to remove nucleotides after each addition

Pyrosequencing

2nd Method
Liquid Phase 3 enzymes + apyrase (nucleotide degradation enzyme)
Eliminates need for washing step

In the well of a microtiter plate: primed DNA template 4 enzymes Nucleotides are added stepwise Nucleotide-degrading enzyme degrade previous nucleotides

Pyrosequencing Method:

Pyrosequencing Results:

Pyrosequencing Disadvantages
Smaller sequences Nonlinear light response after more than 5-6 identical nucleotides

Summary
DNA sequencing is a common procedure Dideoxy method

Chain termination method Best for small DNA segments

Whole genome shotgun sequencing


Sequence human genome Fragments larger DNA strand to manageable

chunks

Pyrosequencing
Sequence by synthesis Accurate and fast

References
Applied Biosystems Automated DNA Sequence Chemistry Guide. (2000)

Garrett & Grisham. (2007) Biochemistry. Thomson and Brooks/Cole. 3rd ed. Pgs 337340.
Maxam, A. & Gilbert, W. (1977) A new method for sequencing DNA. Proc. Natl. Acad. Sci. 74, 560-564.

Ronaghi, M. (2001) Pyrosequencing sheds light on DNA sequencing. Genome Res. 11, 3-11.
Sanger, F., Nicklen, S., & Coulson, A.R. (1977) DNA Sequencing with chainterminating inhibitors. Proc. Natl. Acad. Sci. 94, 5463-5467.

Shendure, J. & Ji, H. (2008) Next-generation DNA Sequencing. Nature Biotech. 26, 1135-1145
Venter, C, et al. (2001) The sequence of the human genome. Science. 291, 1304.

You might also like