Degenerate Primer Design

Degenerate Primers
• A PCR primer sequence is called degenerate if some of its positions
have several possible bases.

• The degeneracy of the primer is the number of unique sequence

combinations it contains.

• We study the problem of designing a pair of primers with prescribed

degeneracy that match a maximum number of given input
sequences.
• A PCR primer sequence is called degenerate if some of its positions
have several possible bases (Kwok et al., 1994).

• For example, in the primer GG{C,G}A{C,G,T}A, the third position is C or

G and the fifth is C, G, or T.

• The degeneracy of the primer is the number of unique sequence

combinations it contains.

• For example, the degeneracy of the above primer is 6.

• Suppose one has a collection of related target sequences, e.g., DNA
sequences of homologous genes, and the goal is to design primers
that will match as many of them as possible.

• A naïve solution would be to align the sequences without gaps, count

the number of different nucleotides in each position along the
alignment, and seek a primer-length window (typically 20–30) where
the product of the counts is low.

• When degeneracy is too high, unrelated sequences may be amplified

as well, losing specificity.
Primer sequence:
• Avoid degeneracy in the 3 nucleotides at the 3' end, i.e., if possible
use Met- (AUG) or Trp- (UGG) encoding triplets at the 3' end

• To increase primer–template binding efficiency, reduce degeneracy by

allowing some mismatches between the primer and template,
especially towards the 5' end, but not the 3' end

• Try to design primers with less than 4-fold degeneracy at any given
position.
Nucleotide codes

A Adenine
G Guanine
C Cytosine
T Thymine
U Uracil
R Purine (A or G)
Y Pyrimidine (C or T)
N Any nucleotide
W Weak (A or T)
S Strong (G or C)
M Amino (A or C)
K Keto (G or T)
B Not A (G or C or T)
H Not G (A or C or T)
D Not C (A or G or T)
V Not T (A or G or C)
 Degenerate Primer Design
Seq 1: 5’-
TGGAGTATACCATCGTAATGGGGCACCTTGACGCGGATGACGAAGGCTTTGACGGAACTATGGAAGGTACA
Seq 2: 3’-ACCTCATATGGTAGCATTACCCCGTGGAA….. 5’
5’-TGGAGTATTCCATCATAATGGGGCACCTTGACGCGGATGACGAAGGCTTTGACGGAACTATGGAAGGTACA

Degenerate primer sequence:

5’-TGGAGTATWCCATCRTAATGG
PCR Amplification
Components of PCR Volume Master Mix 5 Reactions
PCR mixed reagent (dNTPS, Mg2+, DMSO, 12.5 uL PCR 62.5 ul
TaqPol)
Forward Primer (P1/ F) , 10uM 1 ul P1 5 ul
( Final Conc.: 0.25-0.4uM)
Reverse Primer (P2/ R), 10uM 1 ul P2 5 ul
( Final Conc.: 0.25-0.4uM)
DNA Template (~10-100ng/ul) use 10 ng 1 ul - -
MQ water (milli-Q) 9.5 ul MQ 47.5
Total 25 uL Total V 120 uL

C1V1 = C2V2 3 samples to PCR, Prepare a MASTER-MIX: How

many reactions should you prepare?
(10uM) (x vol) = (0.4uM) (25ul)
Negative control
X = 1 uL Positive control

120ul / 5 = 24 ul + 1 ul of (sample or control)

PCR Amplification
Draw a ramp of the PCR amplification involving 40 cycles of 95oC initial denaturation for 2 minutes;
amplification with denaturation at 98oC for 10 secs, annealing at 60oC for 30S, extension at 72oC for 1.5
minutes; final extension at 72oC for 5 minutes and storage at 4oC infinitum.

95C 98C
10s 72C
2m 72C
1.5m 5m
60C

30s 4C

40 X infinitum
DNA Quantification using
spectrophotometry
Principles
• Spectrophotometry uses the fact that there is a relationship between
the absorption of ultraviolet light by DNA/RNA and its concentration
in a sample.

• The absorption maximum of DNA/RNA is approximately 260 nm.

• This figure is an average of the absorption of the individual

nucleotides that vary between 256 and 281 nm.
Quantitation
40 × OD260 of the sample = concentration of RNA (μg/mL)

50 × OD260 of the sample = concentration of DNA (μg/mL)

That is, when the OD260 of the sample is 1 the concentration of RNA will be approximately 40 µg/mL
(50 µg/mL for DNA).
• It is also possible to assess the degree of purity of the nucleic acids by
examining the absorption at other wavelengths in which protein and
polysaccharides have known absorption maxima.

• Proteins are known to absorb strongly at 280 nm and polysaccharides

may be identified by their maximum at 230 nm.

• Therefore, the ratio of measurements of these three wavelengths

230, 260, and 280, may indicate the degree of purity of the nucleic
acid sample.
• For example, a sample containing only RNA following an extraction
method is judged as being uncontaminated if the ratio is
(A230:A260:A280) = 1: 2: 1

• For DNA (A230:A260:A280) = 1: 1.8: 1.

• If there is significant deviation from this, then it is evident that

contaminants are present and that further purification of the sample
is necessary.
• In many cases, the purity and the concentration may be further
obscured by the presence of reagents that are used in the extraction
process itself.

• Some of these have characteristics that are evident on a

spectrophotometric scan that includes the three wavelengths
indicated.

• Therefore, when using spectrophotometry in the analysis of DNA or

RNA it is necessary to be aware of the potential problems that may
result in misleading figures
 Absorbance spectrum

Results of a spectrophotometric scan from Results of a spectrophotometric scan from Results of a spectrophotometric scan
200–320 nm of a solution containing: (A) 33 200–320 nm of a solution containing: (A) 16 from 200–320 nm of a solution
µg/mL of tRNA alone (OD260:OD280) 2.1:1; (µg/mL of tRNA (OD260:OD280) 2.16:1; (B) containing: (A) 16 µg/mL of tRNA
(B) also contains the same concentration of contains the same concentration of RNA, (OD260:OD280) 2.3:1; (B) contains the
tRNA, however, 16 (µL/mL of phenol is however, 32 µL/mL of phenol is present. same concentration of RNA, however,
present representing a 1.6 × 10−3% solution. (OD260:OD280) 1.87:1. 132 µM of guanidinium thiocyanate is
(OD260: OD280) 2.03:1. present (OD260:OD280) 2.1:1; (C)
contains 2.4 M guanidinium
thiocyanate and the (OD260:OD280)
cannot be measured.
• DNA concentration can be determined by measuring the absorbance
at 260 nm (A260) in a spectrophotometer using a quartz cuvette.

• For greatest accuracy, readings should be between 0.1 and 1.0.

• An absorbance of 1 unit at 260 nm corresponds to 50 µg genomic

DNA per ml (A260 =1 for 50 µg/ml; based on a standard 1 cm path
length.

• This relation is valid only for measurements made at neutral pH,

therefore, samples should be diluted in a low-salt buffer with neutral
pH (e.g., Tris·Cl, pH 7.0).
• Pure DNA has an A260/A280 ratio of 1.8–2.0 in 10 mM Tris·Cl, pH 8.5.

• Strong absorbance at A280 resulting in a low A260/A280 ratio indicates the

presence of contaminants, such as proteins.

• Strong absorbance at 270 nm and 275 nm may indicate the presence

of contaminating phenol.

• Absorbance at 325 nm suggests contamination by particulates in the

solution or dirty cuvettes.
What do the ratios indicate?
• A260/A280 ratio of ~1.8 is generally accepted as “pure” for DNA;

• A260/A280 ratio of ~2.0 is generally accepted as “pure” for RNA

• A260/A280 ratio of <1.8 is indication of abundant protein contamination

•
• A260/A230 ratio of ~2.0 – 2.2 is generally accepted as “pure” for DNA

• A260/A230 ratio of <2.0 is generally regarded as contamination with polysaccharides