A Module

About DNA
and RNA
Structures
and Functions 1 0
ra d e
o r G
F
What is this module all about?
This module focuses on DNA and RNA
structures and functions. It aims to equip the
students with knowledge about the structures
of these nucleic acids and how these
structures relate to their functions. It also aims
to develop the critical thinking and
independent learning skills of students as they
try to figure out the answers to various
questions related to the topic.
This module is intended for grade 10
students as a starting learning material so as to
facilitate their learning of the concepts about
protein synthesis and DNA replication.
 Our Objectives

At the end of this module, you are expected to:

 describe the structures of the DNA and RNA molecules

 recognize the importance of DNA and RNA molecules in

sustaining life

 compare and contrast the structures and functions of

DNA and RNA molecules
 Let’s Check What You Know!
Answer the following questions:

1. DNA stands for .

2. DNA and RNA are nucleic acids made up of monomers
called .
3. The monomer that make up DNA and RNA molecules has
three components namely
.
4. In DNA, the nitrogen base adenine always complementary
base pairs with .
5. The nitrogen base guanine always complementary base
pairs with .
6. The three types of RNA are .
 What’s the Point?

A nucleic acid is a polymer consisting

of monomers called nucleotides.
Cells contain two types of nucleic
acids:

DNA or deoxyribonucleic acid

RNA or ribonucleic acid

Let us start our quest with DNA…
o In eukaryotic cells
(animals, plants, fungi)
DNA is stored in the
nucleus, which is
separated from the rest of
the cell by a
semipermeable
membrane.
o The DNA is only
organized into
chromosomes during cell
replication.
o Between replications, the
DNA is stored in a
compact ball called
chromatin, and is
wrapped around proteins
called histones to form
nucleosomes.
 DNA IS VITAL FOR LIFE
 The functions of DNA are vital for inheritance,
coding for proteins and the genetic blueprint of
life.

DNA is vital for life

 DNA holds the instructions for an organism's
development and reproduction - ultimately, its
survival.

 DNA holds the code for proteins, which are

complex molecules that do huge amounts of
work around our body.

 DNA controls all the chemical changes which

take place in cells
 At the center is a The DNA Structure
five-carbon sugar
called deoxyribose. Each DNA nucleotide consists of
Attached to one of three components:
the sugar’s carbon
atoms is at least one
phosphate group phosphate group
(PO4). Attached to
the opposite side of
the sugar is a
nitrogen base which
can be: ADENINE (A),
GUANINE (G), nitrogen base
THYMINE (T) or
CYTOSINE (C). 5-carbon sugar
 AMAZING CLUE!
To remember which
among the nitrogen
bases are the
pyrimidines, just think
of the letter ‘Y’. As
you spell the word
 The nitrogen bases in nucleotides ‘pyrimidines’, it has
consist of two general types: the letter ‘Y’, same
as in cYtosine and
*purines: have two-ring
thYmine.
structures
*pyrimidines: have one-ring
structure
 DNA is a
double helix

• In DNA there are two strands of nucleotides that

wind together in a double helix
- the strands run in opposite directions
- the bases are arranged in step-like pairs
- the base pairs are held together by hydrogen
bonding
• The pairing of the bases from the two strands is
very specific
• The complementary base pairs are A-T and G-C
- two hydrogen bonds form between A and T
- three hydrogen bonds form between G and C Say A-T “two”
(hydrogen bonds);
• Each pair consists of a purine and a pyrimidine,
C-G “three”
so they are the same width, keeping the two
(hydrogen bonds)
strands at equal distances from each other
Write the sequence of the complementary DNA
strand from the following DNA template strand
sequence:

TTACACTTGCAACGGCTTAATTGC

Answer: AATGTGAACGTTGCCGAATTAACG
 Mastering Concepts
Let us check if you can label the parts of this blank DNA
molecule. Identify the deoxyribose sugar, phosphate group
and nitrogen bases.
 Mastering Concepts
Check if you got the correct answers!
 Now, let us explore
RNA!

• Ribonucleic acid or RNA is also vital

for life because it carries out the
instructions encoded in DNA.
• Rememebr DNA = blueprints for life…
but ‘someone’ must be able to read
those blueprints and get that
information outside of the nucleus. It
is the RNA that performs that job!
The RNA Structure
• Ribonucleic acid or RNA is
a single-stranded nucleic
acid also consists of
nucleotides but these
nucleotides contain the
sugar ribose.

• Instead of thymine as
one of its nitrogen bases,
it has uracil, also a
pyrimidine.
The Three Types of RNA
• There are three
types of RNA and
each is involved in
protein synthesis.

• Protein synthesis is
the process in which
the correct amino
acids are connected
together in the order
that is written on the
gene.
 The Three Types of RNA
Messenger RNA
• Messenger RNA (mRNA) is produced in the
nucleus by a process called transcription.
• Messenger RNA carries genetic information
from DNA to the cytoplasm where the amino
acids will be connected together.
 The Three Types of RNA

Transfer RNA

• Transfer RNA (tRNA) is a

carrier molecule for
amino acids, delivering
them to the site of
protein synthesis.
 The Three Types of RNA
Ribosomal RNA

• Ribosomal RNA (rRNA) is the

catalytic component of
ribosomes
• In the cytoplasm, rRNA and
protein combine to form a
nucleoprotein called
ribosome.
• The ribosome binds mRNA
and carries out protein
synthesis.
• What are the similarities of DNA and
RNA?

• How do they differ in structure and

function?
 Let us sum it up!
Similarities Differences
o Both are nucleic acids o DNA is double-stranded
o Their monomers are while RNA is single-
nucleotides consist of stranded
three parts: phosphate o Deoxyribose is the sugar
group, five-carbon sugar of DNA while ribose is the
and nitrogen bases sugar of RNA
o Have sugar-phosphate o DNA has thymine while
backbones RNA has uracil
o Both can be found in the o RNA can also be found in
nucleus the cytoplasm while DNA
 Fire Up Your Neurons!
1. DNA and RNA differ in their 5-carbon sugar because

2. Two of the four nitrogen bases in DNA are purines.

These are .
3. Two of the four nitrogen bases in DNA are pyrimidines.
These are .
4. Pyrimidines have a - ring structure.
5. The nitrogen bases form complementary base pair with
each other and are connected with hydrogen bonds.
Adenine and thymine have hydrogen bonds.
 Fire Up Your Neurons!
6. On the other hand, cytosine and guanine have
hydrogen bonds.
7. In RNA, the nitrogen base thymine is replaced by

8. The type of RNA that carries amino acids to the site of

protein synthesis is .
9. The type of RNA that carries the genetic code from DNA
is called .
10. The type of RNA that combine with protein to form a
nucleoprotein called ribosome is the .
 Answer Key
• Let Us Check What You Know!
1. Deoxyribonucleic acid
2. Nucleotides
3. Phosphate group, five-carbon sugar and
nitrogen bases
4. Thymine
5. Cytosine
6. Messenger RNA, transfer RNA and ribosomal
RNA
 Answer Key
• Fire Up Your Neurons!
1. Deoxyribose is the sugar found in DNA while ribose is the sugar
found in RNA
2. Adenine and guanine
3. Cytosine and Thymine
4. One-ring structure
5. Two
6. Three
7. Uracil
8. Transfer RNA (tRNA)
9. Messenger RNA (mRNA)
10. Ribosomal RNA (rRNA)
 References
• Hoefnagels, M., (2016). General Biology, Books I and II. The McGraw-Hill
Companies, Inc., p. 112-115
• Matira, M., et.al., (2015). Metamorphosis 10. St. Augustine Publications,
Inc., p. 202-204
• Sta. Ana, S., et.al., (2016). Exploring the Realms of Science 10. Jo-Es
Publishing House, Inc., p.145-148
• DNA Structure. Retrieved from
http://webcache.googleusercontent.com/search?
q=cache:460Hzt4JlQgJ:shsu.edu/~agr_www/documents/DNA-
nucleicacids.pptx+&cd=1&hl=en&ct=clnk&gl=ph
• DNA structure and Function, Genetic Engineering and Cancer. Retrieved
from http://legacy.hopkinsville.kctcs.edu/instructors/Jason-Arnold/VLI/
Module%201/m1DNAfunction/m1DNAfunction_print.html