MODULE 1&2

IPM
CONCEPTS CATEGORIES AND TYPES OF PESTS
HARMFUL INSECTS
AGRICULTURAL PESTS
VETERINARY INSECTS AND OTHER PESTS
INTRODUCTION TO NATURAL ENEMIES: PARASITOIDS,
PREDATORS, AND POLLINATORS
 LEARNING OUTCOME

To learn Basic about IPM and its components

DEFNITION AND PRINCIPLES OF IPM

WHAT IS PEST
CONCEPTS CATEGORIES AND TYPES OF PESTS
HARMFUL INSECTS
AGRICULTURAL PESTS
BASIC OF VETERINARY INSECTS AND OTHER PESTS
WHAT ARE NATURAL ENEMIES: PARASITOIDS, PREDATORS, AND
POLLINATORS
 PEST - French word ‘Peste’, Latin ‘Pestis’ -plague or contagious
disease
Pest is any animal which is noxious, destructive or trouble some
to man or his interests
A pest is any organism which occurs in large numbers and
conflict with man’s welfare, convenience and profit
A pest is an organism which harms man or his property
significantly or is likely to do so (Woods, 1976)
Insects are pests when they are sufficiently numerous to cause
economic damage (Debacli, 1964)
Pests are organisms which impose burdens on human population
by causing
(i) Injury to crop plants, forests and ornamentals
(ii) Annoyance, injury and death to humans and domesticated
animals
(iii) Destruction or value depreciation of stored products.

Pests include insects, nematodes, mites, snails, slugs, etc. and

vertebrates like rats, birds, etc.

Depending upon the importance, pests may be agricultural forest,

household, medical, aesthetic and veterinary pests.
 PESTS

“A PEST IS ANY ORGANISM WHOSE POPULATION

INCREASES TO THE EXTENT THAT IT STARTS CAUSING
ANNOYANCE, INCONVENIENCE OR INJURY TO MAN, HIS
ANIMALS, PLANTS AND MATERIALS POSSESSIONS. A
PEST MAY BE AN INSECT, MITE, NEMATODE, BIRD,
RODENT, FUNGUS, BACTERIUM, WEEDS OR ANY OTHER
ORGANISMS”
 DAMAGE CONCEPT

• ▶ Injury
• ▶ The physical harm or destruction to a valued
commodity caused by the presence or activities of a
pest
• ▶ consuming leaves, tunnelling in wood, feeding on
blood, etc.
• ▶ Damage
• ▶ The monetary value lost to the commodity as a result of
injury by the pest
• ▶ spoilage, reduction in yield, loss of quality, etc.
• ▶ Any level of pest infestation causes injury, but not all
levels of injury cause damage
 JUST HOW MUCH DAMAGE CAN WE TOLERATE?

▶ At some point, a pest begins to cause enough damage to

justify the time and expense of control measures
▶ But how does one know when this point is reached?
▶ How much financial loss is the pest causing?
▶ How much will it cost to control the pest?
▶ Economic Injury Level
▶ The pest density where economic value of the crop loss
prevented by the control action is equal to the cost of
that control action
▶ Determined through extensive research
 Economic Threshold

▶ Threshold
▶ Stimulus has reached
a sufficient level to
provoke a response
▶ Must be qualified
further
▶ Economic Threshold
▶ Pest density at which
control action must be
taken to prevent the
population from
increasing to the EIL
▶ ET occurs at a lower
population that the
EIL…why?
▶ In weed science,
the ET is equal to the
EIL
 Examples of thresholds

▶ What are some of the thresholds written in our insect fact sheets?
 Categories of pests based on
occurrence
▶ Regular pest: Frequently occurs on crop - Close association e.g.
Rice stem borer, Brinjal (eggplant) fruit borer
▶ Occasional pest: Infrequently occurs, no close association e.g. Caseworm
on rice, Mango stem borer
▶ Seasonal pest: Occurs during a particular season every year e.g. Red
hairy caterpillar on groundnut, Mango hoppers
▶ Persistent pests: Occurs on the crop throughout the year and is
difficult to control e.g. Chilli thrips, mealy bug on guava
▶ Sporadic pests: Pest occurs in isolated localities during some
period. e.g. Coconut slug caterpillar
https://youtu.be/Q8_G-0TJ3Yc
 Categories of pests Based on level of infestation

▶ Epidemic Pest : Sudden outbreak of a pest in a

severe form in a region at a particular time e.g.
Whitefly outbreak in Punjab, Sugarcane wooly
aphid in Karnataka
▶ Currently locust attack in India and
pakistan in 2019-2020
https://youtu.be/YdPzY17k3GY

▶ Endemic pest: Occurrence of the pest in a low level in

few pockets, regularly and confined to particular
area e.g. Rice gall midge infestation in coastal
Karnataka, Red headed hairy caterpillar on
groundnut (peanut) in Karnataka
PARAMETERS OF INSECT POPULATION LEVELS-

GENERAL EQUILIBRIUM POSITION (GEP)

The average density of a population over a long period of time,
around which the pest population over a long period of time, around
which the pest population tends to fluctuate due to biotic and
abiotic factors and in the absence of permanent environmental
changes.
ECONOMIC THRESHOLD LEVEL (ETL)
Population density at which control measure should be
implemented to prevent an increasing pest population from
reaching the ETL.
ECONOMIC INJURY LEVEL (EIL)
The lowest population density that will cause economic damage
Damage boundary (DB)

The lowest level of damage which can be measured. ETL is always

less than EIL. Provides sufficient time for control measures.
 Pest categories according to EIL, GEP & DB

(i) Key pest:-

▶ Most severe and damaging pests
▶ GEP lies above EIL always
▶ Spray temporarily bring population below EIL
▶ These are persistent pests
▶ The environment must be changed to bring
GEP below EIL e.g. Diamond back moth
(ii)Major pest :-
▶ GEP lies very close to EIL or coincides with
EIL
▶ Economic damage can be prevented by
timely and repeated sprays e.g. Cotton jassid, Rice
stem borer
(III) MINOR PEST/OCCASIONAL PEST
▶ GEP is below the EIL usually
▶ Rarely they cross EIL
▶ Can be controlled e.g. Cotton stainers, Rice
hispa, Ash weevils
(IV) SPORADIC PESTS
▶ GEP generally below EIL
▶ Sometimes it crosses EIL and cause severe
loss in some places/periods e.g. Sugarcane
pyrilla, White grub, Hairy caterpillar
(v) POTENTIAL PESTS
▶ They are not pests at present
▶ GEP always less than ETL
▶ If environment changed may cause
economic loss e.g. H. armigera is potentia
pest on alfalfa, S. litura
CAUSES OF PEST OUTBREAK-Activity of human beings which
upsets the biotic balance of ecosystem is the prime cause for
pest outbreak. The following are some human interventions –
Reason of outbreak

i. Deforestation an bringing under cultivation

- Pest feeding on forest trees are forced to feed on cropped
- Biomass/unit area more in forests than agricultural land
- Weather factors also altered - Affects insect development

ii. Destruction of natural enemies

- Due to excess use of insecticides, natural enemies are killed
- This affects the natural control mechanism and pest outbreak
occurs, e.g. Synthetic pyrethroid insecticides kill NE.
iii. Intensive and Extensive cultivation
Monoculture (Intensive) leads to multiplication of pests
Extensive cultivation of susceptible variety in large area - No
competition for food
- multiplication increases
e.g. Stem borers in rice and sugarcane

iv. Introduction of new varieties and crops.

Varieties with favourable physiological and morphological
factors cause multiplication of insects. e.g.
Succulent, dwarf rice varieties favour leaf folder
Combodia cotton favours stem weevil and spotted bollworm
Hybrid sorghum (CSH 1), cumbu (HB1) favour shoot flies and
gall midges

v. Improved agronomic practices

Increased N fertilizer - High leaf folder incidence on rice

Closer planting - BPH and leaf folder increases
Granular insecticides - Possess phytotonic effect on rice
vi. Introduction of new pest in new environment

Pest multiplies due to absence of natural enemies in new area Apple

wooly aphid Eriosoma lanigerum multiplied fast due to absence of
Aphelinus mali (Parasit)

vii. Accidental introduction of pests from foreign countries (through

air/sea ports) e.g.

a. Diamondback moth on cauliflower (Plutella xylostella)

b. Potato tuber moth Phthorimaea operculella
c. Cottony cushion scale Icerya purchasi on wattle tree
d. Wooly aphid - Eriosoma lanigerum on apple
e. Psyllid - Heteropsylla cubana on subabul
f. Spiralling whitefly - Adeyrodichus dispersus on most of horticultural
crops

viii. Large scale storage of food grains Serve as reservoir for stored
grain pests Urbanisation - changes ecological balance
Rats found in underground drainage
Resurgence
Tremendous increase in pest population brought about by
insecticides despite good initial reduction in pest population at
the time of treatment.
Deltamethrin, Quinalphos, Phorate - Resurgence of BPH in rice
Synthetic pyrethroids - Whitefly in cotton Carbofuran - Leaf
folder in rice
PEST MONITORING
Monitoring phytophagous insects and their natural enemies is a
fundamental tool in IPM - for taking management decision
Monitoring - estimation of changes in insect distribution and abundance
- information about insects, life history
- influence of biotic and abiotic factors on pest population
PEST SURVEILLANCE
Refers to the constant watch on the population dynamics of pests, its
incidence and damage on each crop at fixed intervals to forewarn the
farmers to take up timely crop protection measures.
Three basic components of pest surveillance Determination of
a. the level of incidence of the pest species
b. the loss caused by the incidence
c. the economic benefits, the control will provide
Pest Forecasting
Forecasting of pest incidence or outbreak based on information obtained
from pest surveillance.
Uses
- Predicting pest outbreak which needs control measure
- Suitable stage at which control measure gives maximum protection
Two types of pest forecasting
a. Short term forecasting - Based on 1 or 2 seasons
b. Long term forecasting - Based on affect of weather parameters on pest
Survey
Conducted to study the abundance of a pest species Two types of survey
- Roving survey and fixed plot survey

Roving survey
- Assessment of pest population/damage from randomly selected spots
representing larger area
- Large area surveyed in short period
- Provides information on pest level over large area

Fixed plot survey

Assessment of pest population/damage from a fixed plot selected in a
field.
The data on pest population/damage recorded periodic from sowing till
harvest. e.g.
1 sq.m. plots randomly selected from 5 spots in one acre of crop area in
case of rice.
From each plot 10 plant selected at random. Total tillers and tillers
affected by stem borer in these 10 plants counted. Total leaves and
number affected by leaf folder
observed. Damage expressed as per cent damaged tillers or leaves.
Population of BPH from all tillers in 10 plants observed and expressed as
number/tiller.
Qualitative survey - Useful for detection of pest
Quantitative survey - Useful for enumeration of pest
Sampling Techniques
https://youtu.be/WKMpwgnd7mg
Absolute sampling - To count all the pests occurring in a plot
Relative sampling - To measure pest in terms of some values
which can be compared
over time and space e.g. Light trap catch, Pheromone trap
Methods of sampling
a. In situ counts - Visual observation on number of insects on plant
canopy
(either entire plot or randomly selected plot)
b. Knock down - Collecting insects from an area by removing from
crop and
(Sudden trap) counting (Jarring)
c. Netting - Use of sweep net for hoppers, odonates, grasshopper
d. Norcotised collection - Quick moving insects anaesthesised and
counter
e. Trapping - Light trap - Phototropic insects
Pheromone trap - Species specific
Sticky trap - Sucking insects
Bait trap - Sorghum shootfly - Fishmeal trap
Emergence trap - For soil insects
f. Crop samples
Plant parts removed and pest counted e.g. Bollworms
Stage of Sampling
- Usually most injurious stage counted
- Sometimes egg masses counted - Practical
considerations
- Hoppers - Nymphs and adult counted
Sample Size
- Differs with nature of pest and crop
- Parger sample size gives accurate results
Decision Making
- Population or damage assessed from the crop
- Compared with ETL and EIL
- When pest level crosses ETL, control measure has to be
taken to prevent pest from reducing EIL.
Economic Injury Level
- Defined as the lowest population density that will cause
economic damage
(Stern et al., 1959)
- Also defined as a critical density where the loss caused
by the pest equals the cost of control measure
Integrated pest management (IPM ), also known as integrated
pest control (IPC)
IPM is a broad-based approach of pest control which utilize –

ECOFRINDLY CHEMICAL MEASURE OF PEST CONTROL - The use

of chemical pesticides is then restricted to applications only after
strict monitoring that is based on established guidelines indicates
that stronger measures are required for pest management. In the
event that chemical agents are required, they are applied in a
targeted manner intended to minimize risks to the environment,
other organisms (especially beneficial and non-target organisms)
and to human health.
B. NON-CHEMICAL MEASURE OF PEST CONTROL –includes
• Biological control
• Habitat manipulation
• Modification of cultural practices
• The use of resistant cultivars
IPM is a long-term pest prevention program that focuses on
ecosystem-based strategies for the control of pest-related issues.
AIM: suppress pest populations below the economic injury level
(EIL).
History of Integrated Pest Management
- Michelbacher and Bacon (1952) coined the term “integrated
control”
- Stern et al. (1959) defined integrated control as “applied pest
control which combines and integrates biological and chemical
control”
- Geier (1966) coined the term “pest management”
- Council on Environmental Quality (CEQ, 1972) gave the term
“Integrated Pest Management”
- Food and Agricultural Organization (FAO, 1967) defined IPM as “a
pest management system, that, in the context of associated
environment and population dynamics of the pest species, utilizes
all suitable techniques and methods in as compatible a manner as
possible and maintains pest populations at levels below
those causing economic injury”
- In 1989, IPM Task Force was established and in 1990. IPM Working
Group (IPMWG) was constituted to strengthen implementation of
IPM at international level.
- In 1997, Smith and Adkisson were awarded the World Food Prize for
pioneering work on implementation of IPM
 PRINCIPLES OF IPM

1. Intelligent production practices shall be used. These can

include CROP ROTATION, SUSTAINABLE CULTIVATION
techniques, RESISTANT/TOLERANT CULTIVARS and CERTIFIED
SEED production systems, BALANCED FERTILIZATION,
IRRIGATION AND DRAINAGE TECHNIQUES, proper hygiene
measures and the protection and proliferation of the beneficial
organism
2. The use of biological, physical and non-chemical control
methods must be preferred to chemical options as long as the non-
chemical options provide acceptable pest control

3. In the event that pesticides must be applied, they shall be

target-specific and strategically applied in an effort to reduce
negative health outcomes
4. Pesticides shall be used only on an as-needed basis and
the frequency and intensity of use should be minimized in
order to reduce the risk of resistance populations

5. In cases where pest resistance has been established and

repeat pesticide application is necessary, anti-resistance
strategies should be integrated into control efforts

6. Record keeping is essential and should be based on

detailed records in order to determine the efficacy of pest
control programs – especially in the case of chemical inputs
7. Monitoring efforts are essential in order to track pest
presence. This can be accomplished via observations,
forecasting and early diagnosis systems and information, as well
as information from professionally qualified

8. The information garnered by monitoring efforts shall be used

to determine when and which plant protection measures will be
taken. There should be scientifically supported threshold values
upon which to base decision making. Said values should be
adapted to local conditions including climate, crop type, and
topographical qualities
PEST
A pest is any animal or plant harmful to humans or human
concerns

???????????
 Mosquitoes
 Ticks
 Pigeons
 Jellyfish
 Potato root nematodes
 Meloidogyne
 RAT
 Tribulus terrestris
 Tribulus terrestris …………..
Definition IPM definition by FAO (1967)

Integrated Pest Management (IPM) is a system that, in the context

of associated environment and population dynamics of the pest
species, utilizes all suitable techniques and methods in as
compatible a manner as possible and maintains pest populations at
levels below those causing economic injury.

IPM definition by Luckmann and Metcalf (1994)

IPM is defined as the intelligent selection and use of pest control

tactics that will ensure favourable economical, ecological and
sociological consequences.
Need for Pest Management (or) Why Pest Management
1. Development of resistance in insects against insecticides e.g.
OP and synthetic pyrethroid resistance in Helicoverpa armigera.
2. Out break of secondary pests e.g. Whiteflies emerged as major
pest when spraying insecticide against H. armigera.
3. Resurgence of target pests e.g. BPH of rice increased when
some OP chemicals are applied.
4. When number of application increases, profit decreases.
5. Environmental contamination and reduction in its quality.
6. Killing of non-target animals and natural enemies.
7. Human and animal health hazards.
Stages in crop protection leading to IPM
1. Subsistence phase : Only natural control, no insecticide use
2. Exploitation phase : Applying more pesticides, growing HY
varieties and get more yield and returns
3. Crisis phase : Due over use pesticides, problem of
resurgence, resistance, secondary pest out break, increase in
production cost
4. Disaster phase : Due to increased pesticide use - No profit,
high residue in soil - Collapse of control system
5. Integrated Management Phase
: IPM integrates ecofriendly methods to optimize
control rather than maximise it.
Objectives of pest management
1. To reduce pest status below economic injury level. Complete
elimination of pest is not the objective.
2. To manage insects by not only killing them but by preventing
feeding, multiplication and dispersal.
3. To use ecofriendly methods, which will maintain quality of
environment (air, water, wild life and plant life)
4. To make maximum use of natural mortality factors, apply control
measures only when needed.
5. To use component in sustainable crop production.
Requirements for successful pest management programme
1. Correct identification of insect pests
2. Life history and behaviour of the pest
3. Natural enemies and weather factors affecting pest
population
4. Pest surveillance will provide above data
5. Pest forecasting and predicting pest outbreak
6. Finding out ETL for each pest in a crop
7. Need and timing of control measure - Decision
8. Selection of suitable methods of control
9. Analysis of cost/benefit and benefit/risk of each control
measure
10.Farmer’s awareness and participation
11.Government support
12.Consumer awareness on use of pesticides free products
TOOLS OR COMPONENTS OF INTEGRATED PEST MANAGEMENT
i. Cultural method or use of agronomic practices
 Crop rotation
 Pruning or thinning
 Crop refuse destruction
 Fertilizer management
 Tillage of soil
 Water management
 Variation in time of
 Intercropping
 planting or harvesting
 Trap crop

ii. Host plant resistance - Antixenosis, antibiosis, tolerance

iii. Mechanical methods of pest control

1. Hand destruction
2. Exclusion by screens, barriers
3. Trapping, suction devices, collecting machine
4. Crushing and grinding
iv. Physical methods
1. Heat
2. Cold
3. Energy - light trap, irradiation, light regulation
4. Sound
v. Biological methods
1. Protection and encouragement of NE
2. Introduction, artificial increase and colonizing specific parasitoids and
3.predators
Pathogens on insects like virus, bacteria, fungi and protozoa
4. Use of botanicals like neem, pongam, etc.
vi. Chemical methods
1. Attractants
2. Repellents
3. Insecticides - OC, OP, carbamates, pyrethroids, etc.
4. Insect growth inhibitors
5. Chemosterilants
vii.Behavioural methods
1. Pheromones
2. Allelochemics
viii. Genetic/biotechnology method
- Release of genetically incompatible/sterile pests
- Transgenic plant
ix. Regulatory/legal method
- Plant/animal quarantine
- Eradication and suppression programme
The following are some examples of successful IPM programmes worldwide
1. In Philippines, in 1993, IPM farmers obtained 4.7 to 62% higher rice yield
and reduced pesticide use by 15% compared to non-IPM.
2. In India in 1995, IPM farmers obtained 6.2 to 42.1% increased rice yield,
and reduced pesticide use by 50% compared to non-IPM farmers.
3. In India on cotton crop, adoption of IPM technology resulted in 73.7 and
12.4% reduction in the number of insecticide sprays against sucking pests
and bollworms. In spite of reduction in pesticide sprays 21-27% increase in
seed cotton yield was obtained in IPM areas compared to non-IPM. Natural
enemy population also increased 3 folds.
4. In Thailand in 1993 adoption of IPM technology resulted in 145% increase
in net profit in IPM fields over non-IPM fields in cruciferous vegetables.
5. IPM is useful and economical in high value, plantation crops like Coconut,
Coffee, Tea, Cashewnut and Arecanut.
Institutional support for IPM
International: IPMWG, FAO, CABI, ICIPE
Global IPM facility (1992) - Sponsored by FAO, UNDP, UNEP and
World Bank
National : NCIPM: National Centre for Integrated Pest Management
at Faridabad (Near Delhi) (1988) - Supports IPM in India
https://youtu.be/GUiatqnNttU
https://youtu.be/Sp6HLYq8Qqs
https://youtu.be/Y0RD3spac90
https://youtu.be/i9U8c4slDEo
IPM, concepts and ecological components; Recent direct and
indirect Biotechnological Approaches in IPM
Categories and types of pests, Harmful insects, Agricultural
pests, Veterinary insects and other pests, Introduction to
Natural Enemies: Parasitoids, Predators, and Pollinators
Tritrophic interaction mechanism of pest-host plant-natural
enemies in an ecosystem, Impact of climate change on pest
population and crop productivity, Role of semiochemicals,
especially VOCs in changing climate, Impact of biofertilizers and
biopesticides on pest population and soil health

NEXT session …..

CROP ROTATION
SUSTAINABLE CULTIVATION techniques
BIOTECHNOLOGICAL Biotechnological Approaches in IPM-
Physiological, Molecular and Phytotoxicity Assessment in
Crops…………
 KEY TOMATO PESTS

A. Pests that feed on the upper plant

Pests that mine leaves or bore into fruits and / or buds
Tomato fruitworm , Tobacco budworm - Helicoverpa
Tomato pinworm – Keiferia lycopersicella
Vegetable leafminer – Liriomyza sativae
Chewing pests that make holes in leaves
Blister beetles
Cabbage looper
Colorado potato beetle
Flea beetles
Hornworms
Sap-sucking pests which cause leaf discoloration, leaf or fruit
deformation, or defoliation
Aphids
Green peach aphid
Potato aphid
Greenhouse whitefly –
Stink bug
Silverleaf whitefly
Western flower thrips
B. Pests that feed on roots or lower stems
Cutworm ,Southern potato wireworm , nematodes
Kingdom: Animalia
Phylum: Arthropoda
Class: Insecta
Order: Lepidoptera
Superfamily: Noctuoidea
Family:Noctuidae
Genus: Helicoverpa
Species:H. armigera

https://youtu.be/MIvans9EhLY

(Hübner, [1808])
HOST: The cotton bollworm is a highly polyphagous species. The
most important crop hosts are tomato, cotton, pigeon pea,
chickpea, rice, sorghum, and cowpea. Other hosts include
groundnut, okra, peas, field beans, soybeans etc.
ADULT:The cotton bollworm is very variable in both size and colour.
The body length varies between 12 and 20 millimetres (1⁄2 and 3⁄4 in)
with a wingspan of 30–40 millimetres (1+1⁄4–1+1⁄2 in).
The fore wings are yellowish to orange in females and greenish-gray
in males, with a slightly darker transversal band in the distal third.

The external transversal and submarginal lines and the reniform

spot are diffused.
The hind wings are a pale yellow with a narrow brown band at the
external edge and a dark round spot in the middle
Eggs: The female cotton bollworm can lay several hundred eggs,
distributed on various parts of the plant. Under favourable
conditions, the eggs can hatch into larvae within three days and
the whole lifecycle can be completed in just over a month .
The eggs are spherical and 0.4 to 0.6 millimetres (1⁄64 to 3⁄128 in)
in diameter, and have a ribbed surface. They are white, later
becoming greenish.

Larvae : The larvae take 13 to 22 days to develop, reaching up

to 40 millimetres (1+1⁄2 in) long in the sixth instar. Their colouring
is variable, but mostly greenish and yellow to red-brown. The
head is yellow with several spots. Three dark stripes extend
along the dorsal side and one yellow light stripe is situated under
the spiracles on the lateral side. The ventral parts of the larvae
are pale. They are rather aggressive,
occasionally carnivorous and may even cannibalise each other. If
disturbed, they fall from the plant and curl up on the ground.
Pupae : The pupae develop inside a silken cocoon over 10 to 15
days in soil at a depth of 4–10 centimetres (1+1⁄2–4 in), or in
cotton bolls or maize ears
Recognize the problem
The American bollworm is a major insect pest of cotton which
can cause losses to farmers. The young insect looks like a grub
and is about the size of a match stick. It attacks and feeds on the
inside of buds, flowers and bolls. The grub has two lines on its
back running from its head to its tail. As it feeds, it changes from
yellowish white to greenish yellow and becomes older and larger.
The grub puts its head into the boll, while keeping the rear of its
body outside the boll. Its droppings are tiny black beads which
are mostly found on lower leaves.
Symptoms of damage:
Bolls showing regular, circular bore holes
Larvae seen feeding on the boll by thrusting their heads
alone inside and leaving the rest of the body outside
Presence of granular faecal pellets outside the bore
hole.
A single larva can damage 30-40 bolls.
Identification of the pest:
Eggs - Spherical in shape and creamy white in colour, present
singly
Larva - Shows colour variation from greenish to brown.
It has dark brown grey lines on the body with lateral white lines
and also has dark and pale bands.
Pupa - Brown in colour, occurs in soil, leaf, pod and crop debris
Adult
Light pale brownish yellow stout moth.
Forewings are olive green to pale brown in colour with a dark
brown circular spot in the centre.
Hind wings are pale smoky white with a broad blackish outer
margin
Management
ETL: One egg or one larva /plant
Monitoring :
Pest monitoring through light traps, pheromone traps and in
situ assessments by roving and fixed plot surveys has to be
intensified at farm, village, block, regional and State levels. For
management, an action threshold of one egg per plant or 1 larva/
plant may be adopted.
Cultural practices :
Synchronised sowing of cotton preferably with short duration
varieties in each cotton ecosystem.
Avoid continuous cropping of cotton both during winter and
summer seasons in the same area as well as ratooning.
Avoid monocropping. Growing of less preferred crops like
greengram, blackgram, soyabean, castor, sorghum etc., along with
the cotton as intercrop or border crop or alternate crop to reduce
the pest infestation.
Removal and destruction of crop residues to avoid carry over of
the pest to the next season, and avoiding extended period of crop
growth by continuous irrigation.
Optimising the use of nitrogenous fertilizers which will not favour
mthe multiplication of the pest.
Judicious water management for the crop to prevent excessive
vegetative growth and larval harbourage.
Biological control :
Application of Nuclear Polyhedrosis Virus (NPV) at 3 x 10 12
POB /ha in evening hours at 7th and
12th week after sowing.
Conservation and augmentation of natural predators and
parasitoids for effective control of the pest.
Inundative release of egg parasitoid, Trichogramma spp., at 6.25
cc/ha at 15 days interval 3 times from 45 DAS
Egg-larval parasitoid, Chelonus blackburnii and
Predator Chrysoperla carnea at 1,00,000/ha at 6th, 13th and 14th
week after sowing.
ULV spray of NPV at 3 x 10 12 POB /ha with 10% cotton seed
kernel extract, 10% crude sugar, 0.1% each of Tinopal and Teepol
for effective control of Helicoverpa.
Note: Dicofol, methyl demeton, monocrotophos and phosalone are
comparatively safer to Chrysoperla larva recording low egg
mortality
Chemical control :
Discourage the indiscriminate use of insecticides,
particularly synthetic pyrethroids.
Use of proper insecticides which are comparatively safer to
natural enemies such as endosulfan, phosalone, etc., at the
correct dosage and alternating different groups of
insecticides for each round of spray.
Avoid combination of insecticides as tank mix.
Adopt proper delivery system using spraying equipments like
hand compression sprayer, knapsack sprayer and mist
blower to ensure proper coverage with required quantity of
spray fluid and avoid ULV applications or Akela spray
applications.
Proper mixing and preparation of spray fluid for each filling
of spray fluid tank
At early stages of square formation apply one of the following insecticides
Acephate 75%SP 780 g/ha
Azadirachtin 0.03% EC 500 ml/ha Carbaryl
10%DP 25 kg/ha Chlorantraniliprole 18.5%
SC 150 ml/ha Chlorpyriphos 20% EC 1250
ml/ha Diflubenzuron 25%WP 300 g/ha
Emamectin benzoate 5% SG 190-220 g/ha
Fipronil 5%SC 2000 ml/ha
Flubendiamide 20%WG 250 g/ha
Flubendiamide 39.35%SC 100-125 ml/ha
Indoxacarb 14.5%SC 500 ml/ha
Lufenuron 5.4%EC 600 ml/ha
Novaluron 10%EC 1000 ml/ha
NPV of H. armigera 0.43% AS 400-600 ml/ha
Profenofos 50% EC 1750-2500 ml/ha
Pyridalyl10%EC 1500-2000 ml/ha
Spinosad 45.0%SC 165-220 ml/ha
Thiodicarb 75%WP 1000 g/ha
During bolling and maturation stage, apply any one of the following
insecticides (1000 l of spray fluid/ha):
Quinalphos 25 EC 2.0 l/ha
Carbaryl 50 WP 2.5 kg/ha
Pyraclofos 50 EC 1.5 l/ha
Biological control:
Bacillus thuringiensis-k 750-1000 g/ha
Bacillus thuringiensis serovar kurstaki (3a,3b,3c) 5%WP 500-1000 g/ha
Beauveria bassiana 1.15% WP 400 g/ha
 H. armigera populations already had
widespread resistance to the Bt toxins
Cry1Ab, Cry1Ac, Cry2Ab, and Vip3A before
the multiple recent invasions of South
America.
 PESTS OF WHEAT

Major pests
1Wheat Aphid Macrosiphum miscanthi
.
2Climbing cutworm/armyworm Mythimna separata
.

3Ghujhia Weevil Tanymecus indicus

.
4Gram Pod Borer Helicoverpa armigera
.
5Termites Odontotermes
.
obesus and Microtermes obesi
6Molya Nematode/cyst nematode Heterodera avenae
.

7Wheat-gall Nematode Anguina tritici

.
 Minor pests
8. Aphid Schizaphis graminum and Rhopalosiphum maidis

9. Hopper Laodelphax striatella

Pyrilla perpusilla
10. Jassids Amrasca spp
11. Wheat bug Eurygaster maura
12. Wheat thrips Anaphothrips favicinctus
13. Cut worms Agrotis spp.
Marasmia trapezalis
14. Pink borer Sesamia inferens
15. Shootfly Atherigona naqvii and A. orzae
16. Whorl maggot Hydrellia griseola
17. Flea beetle Chaetocnema basalis
CROP ROTATION
 Introduction to Crop
rotation
 Crop rotation is “system of
growing
different kinds of crops in
recurrent succession on the
same land”
 It may include 2-6 different
crops with each crops having
a particular benefit either
financial or environment
 Crops my be rotated every
year or at different times in
the
growing season
 Many crop rotations will
include a legume
 Example of Crop rotation:
Rotate Soybeans
(legume)– Corn- wheat
 Why Rotate Crops ?
According to “Cereal-Legume Cropping
Systems:

 Enhance soil and water

conservation, build soil organic
matter

 Provide weed, disease and insect

control

 Enhance biological diversity

 Ensure economic profitability for the

farming system
Relation of soil quality to Soil fertility complex in relation
the types of crops that to external factors
predominate in the rotation
 Quality production as a
function of crop rotation
 Crop selection in rotation
 Follow a legume crop with a high nitrogen demanding
crops

 Grow less nitrogen demanding crops in the initial

phase of rotation

 Try to grow a deep- rooted crops as a part of rotation

 Grow the same annual crop for only one year

 Use crop sequence that promote healthier crops

 Use crop sequence that aid in controlling weeds

 Grow some crops that will leave significance amount

of residue
 Condition for Successful Crop
rotations
 Include the use of cover crops to provide fertility, control
weeds and provide habitat for beneficial insects;

 Have a diversity of plant species to encourage natural

predators, discourage pest and disease build-up, and
minimize economic and environmental risk;

 Provide a balance between soil conservation and crop

production by adding organic matter to the soil to both
supply nutrients and improve soil quality properties
such as water infiltration and water holding capacity
and

 Provide weed control by alternating between warm and

cool weather plants and including weed inhibiting plants
(such as rye and sorghum).
 Common Goals for Crop Rotation
• Maintain healthy soil by adding Maintain biotic diversity
nitrogen and other nutrients in a
Unlock the living potential of the
way that is environmentally safe
soil.
and conforms with regulations

• Produce nutritious food.

 Diversify tasks to keep labor
• Capture solar energy wherever happy and productive all
possible season.

• Control insects and diseases,

 Balance the needs of the farm
especially soilborne diseases; for
with the needs of the farmer
example, “Break the wilt cycle
and develop a spiritual
among crops in the tomato family.”
relationship with the land.

 Refine the aesthetic quality of

• Reduce weed pressure; for
example, “Manage the rotation to fields and farm
confuse the weeds.”
Increase profitability having
a diverse line of products to
• Minimize off-farm inputs
market.
• Provide economic stability.
 Farm Size, Cover Crops, and Crop
Rotations
 Farm size affects cover cropping and the
management of the crop rotation. Organic
farmers plant cover crops to protect the soil,
increase soil organic matter, improve soil
physical properties, and accumulate
nutrients.
 Cover crops may also provide habitat for
beneficial insects or help crowd out weeds.
 Most expert farmers integrate cover crops
into their fields at every opportunity.
 Many expert farmers use a full year of cover
crops to restore the soil after intensive use.
 Farmers with limited acreage (<5 acres) find
that including cover crops and providing
adequate rotation of crop families on a given
field is challenging. Many smaller farms rely
on mulch, compost, and short-term winter
cover crops in place of multi-season cover
 Ranking of annual vegetables

based on relative nutrient

Low requirements
Medium High
Beans Cucumber Broccoli
Beet Brinjal Cabbage
Carrots Pumpkin Cauliflower
Peas Spinach Lettuce
Radish Sweet Potato
potato
Water Tomato
melon
Brassica Sweet Corn
Source: A.A. Hansongreens
Practical Handbook of Agricultural science (Boca Raton FL: Taylor &
francis group LLC 1990)
 Rooting depth for
several crops
Shallow Moderatel Deep Very deep
rooted y deep rooted rooted
(60 cm) rooted (120 (180 cm)
(90 cm) cm)
Rice Groundnut Cotton Safflower
Onion Tobacco Maize Citrus
Cabbage Wheat Sorghum Grapevine
Cauliflower Chilli Pearlmillet Coffee
Potato French bean Soybean lucern
Lettuce Carrot Sugarcane
Arhar
Schematic Summary of Crop rotation Planning

 Many expert farmers do extensive planning

and record keeping on paper. Most have
some form of field maps. Some use
computers. A few keep all details in their
heads. Most of the panel farmers agreed
that farmers should write down their field
records and plans.
 Many of the key responsibilities and
tasks require
reflection and observation as well as
information.
 The chart illustrates the central role of
rotation in the overall farming operation.
The chart does not cover all aspects of
farm management—only those that the
farmers thought were most important in
determining the rotation and that are
linked to rotation management.
Examples of Crop
rotation in India
 Key responsibilities and tasks involved in
“managing a crop rotation system”
Ten Most Important Tasks Ten Most Difficult Tasks
1. Assess profitability on a whole-
1. Maintain crops. farm and crop-by- crop basis.
2. Implement production plan. 2. Maintain crops.
3. Prepare soils as soon as 3. Assess pest, disease, and weed
pressures.
weather permits.
4. Investigate new market
4. Plant crops timely opportunities.
5. Walk fields regularly to 5. Review overall farm operation.
observe crops and fields. 6. Review regulations.
6. Review overall farm 7. Analyze weather probabilities.
operation. 8. Determine if successes or
7. Draft annual [rotation] plans. failures were due to on- farm or
8. Monitor soil and crop regional factors.
9. Develop collaborations to
conditions.
verify successes and solve
9. Adjust actions problems.
according to field and 10. Tweak the crop mix.
crop conditions.
10.Identify problems that can
be addressed through
rotation.
 Effects of Rotation
Studies have shown that organic
Crops
matter losses from intensively
tilled row crops can be regained
when the field is rotated into a
perennial sod crop.
Two processes :

First, the rapid rate of organic matter

decomposition from tillage is
stopped under the sod crop. This
benefit, of course, is also gained
when a no-tillage cropping system is
employed.

Second, grass and legume sods

develop extensive root systems that
continually grow and die off. The dead
roots supply a source of fresh, active
organic matter to the soil, which
feeds soil organisms that are involved
in building soil aggregation.
Designing crop rotation experiments
The design of crop rotation experiments depends strongly on the specific
objectives of these experiments.

•Flexibility: There is often a need to change management and include new

aspects or investigations over the course of the experiment. Changes
should be kept at an absolute minimum within a rotation course, and only
introduced for each new course of the rotation.

•Reference: A static part (treatment) as a reference is desirable for

documentation. However, even the static part should be changed/adjusted
when it gets too academic.

• Scale: Plots/fields should be as large as possible.

•Time: Often long time periods from time of conversion are required for
interpretation even in low budget years.
 Designing crop rotation experiments

•Design: A factorial design should be used, but kept simple (from

the beginning, at least). An example of the effect of such a
factorial design on statistical tests is given by Olesen et al.
(1999).

•Management: Detailed guidelines on the practical management of the

crops and plots should be formulated in order to minimise effects of
change in management over time. Management staff often a needs to
learn the functions of the rotation, before proper experimentation can
start.

•Minimum dataset: A protocol for a minimum dataset should be

set up based on existing standards. This has to be absolutely
minimal in order to achieve funding
 Differences in Crop Nutrient Uptake

Crop nutrient uptake varies due to many factors,

 including rooting depth and breadth;

 variety;

 and environmental factors,

 including soil tilth.

Generally, crops may be characterized as having low,

medium, or high nutrient demands based on their nutrient
uptake efficiency
Different varieties within any crop may be more or less
efficient at taking up nutrients. Those crops with a high
nutrient demand (predominately N) require higher levels of
those nutrients to be present in the soil solution.
 Organic Transition Economics

• Step 1: develop a transition production plan…

Example – You inherited a 240-acre farm. It is currently in a corn-
soybean rotation. You want to transition into organics.
You decide to transition field-by-field.

For simplicity,
Assume you can divide the 240 acres into 4, 60-acre fields. And
you will be producing conventional and transitioning crops
on the same farm.
Step 2: To determine profitability, let’s shift to a budget-driven
decision tool…

Step 3: Evaluate - Is it profitable to transition to organics from

conventional agriculture?
 Field
Yr 1 Yr 2
Plan
Yr 3 Yr 4 Yr 5 Yr6

Field 1

Field 2

Field 3

Field 4
 Recent direct and indirect
Biotechnological Approaches in IPM

Chemical Ecology
file:///C:/
Users/AAYUSHI/Downloads/Chemical_ecology_and_conservation_biol
ogical_contr.pdf
https://slideplayer.com/slide/5259356/

Molecular Biology
ENUMERATION OF BACTERIAL MICROBIOTA:

For the enumeration of bacterial isolates collected from each

targeted sample maintain five replicates .

Calculate Colony Forming Unit (CFU) in 1 ml of sample.

After CFU count, purified isolated bacterial colonies by streaking

it on respective agar plates.
Incubated for overnight at 37°C and purified bacterial isolates .
Streaking process should be repeated five to six times and purity
of each bacterial isolate should be determined by microscopy.

Selected strains should be stored at -80°C in glycerol stock.

(METHOD : For preparation of the glycerol stock, take 50%

glycerol solution . Take 300 µl of 50% glycerol solution in a tube
and add 700 µl liquid bacterial culture and stored.
For further experiments, the bacteria may be revived in growth
medium. )
EXTRACTION OF DNA FROM BACTERIAL SAMPLE :
Select Representative colonies of bacteria for DNA extraction.
A single colony of the selected young viable bacterial isolate will be
inoculated in 1.5 ml nutrient broth media and kept for 24 hours
at37°C in an incubator shaker .
After incubation, inoculated broth was centrifuged at 13,000 rpm
for 10 minutes.
Discarde Supernatant .
The obtained pellet will be used for DNA extraction using modified
Cetyl Trimethyl Ammonium Bromide (CTAB) method as detailed
below:-
1. Dissolved the pellet in 500 μl of Lysis buffer with gentle vortexing
for 30 seconds and incubated at 37°C overnight.
2. Lysis buffer consist of the following components:

Components Total volume (10ml)

Proteinase K - 80 μl
Lysozyme(breaks down the bacterial cell wall by cleaving peptidoglycan ) - 100 μl
SDS 10% -500 μl
Tris-EDTA (TE) buffer (pH8) -9.32 ml
2. After completion of overnight incubation, the lysed samples were
again incubated at 55°C for 20 minutes.

3. Further completion of 20 minute incubation period, 80 μl of

cetyltrimethylammonium bromide (CTAB) (10%) to disrupt
membranes buffer and 100 μl of 5M NaCl solution (helps to remove
proteins that are bound to the DNA ) should be added. Mixed the Mixture
properly and then again incubated at 65°C for 20 minutes.

4. In obtained mixture, add 700 µl of Chloroform: Isoamyl alcohol

(24:1) . It promote the partitioning of lipids and cellular debris
into the organic phase, leaving isolated DNA in the aqueous phase.
Then mixed the Mixture with vigorous shaking for 2 minutes and
then centrifuged it at 13,000 rpm for 10 minutes at room
temperature.
5. After centrifugation of the sample tubes, two layers will formed.
Collected the top phase in a clean new Eppendorf collection tube
and precipitated it with 360 µl of Isopropanol . Mix the mixture of
collection tubes for 5 seconds.
6. Incubate the tubes at-20°C for 30 minutes. After cold incubation,
again centrifuge the sample at13,000 rpm for10 minutes.
Pellet will be obtained. Discard the supernatant .
7. Add 70% ethanol for washing the pellet. For this after immediate
addition of ethanol samples should be centrifuged at 13,000 rpm for
10 minutes. Discarded the Supernatant from the tubes carefully and
dried the pellet at 37°C for 30 minutes.
8. After drying, the pellet resuspended it in 100 µl of 10 mM TE
buffer.
9. Stored The DNA samples at -20°C for further experimental
processes. The quality and quantity of DNA may be checked and by
using NanoDrop Spectrophotometer and Agrose gel
Electrophoresis.
PCR AMPLIfiCATION OF 16S RRNA GENE:

The extracted DNA of each isolate was subjected to

amplification of 16S rRNA gene sequence by Polymerase
Chain Reaction (PCR) using PCR Master Mix (a thermostable
DNA polymerase, dNTPs, MgCl2, and buffer for PCR) and
primers

Components Total amount (50 μl)

Master mix 25 μl
27F -‘AGAGTTTGATCCTGGCTCAG’ (10 μM) 03 μl
1492R-‘AAGGAGGTGATCCAGCCGCA’(10 μM) 03 μl
Bacterial DNA as a template 05 μl
Nuclease-free water 14 μl
 The Polymerase Chain Reactions -

Cycle step 3-step protocol Cycles

Temperature in °C Time in minutes

Denaturation 94 05 01

Denaturation 94 01

Annealing 58 01 30

Extension 7 02

Final extension 72 10 01

Storage 04 Hold 2 hrs

https://youtu.be/JmveVAYKylk
ELECTROPHORESIS
The amplified products can be recognized by agarose gel
electrophoresis. Electrophoresis may carried out by preparing
0.8% agarose gel For this 0.8 g of agarose was mixed in 100 ml
of 1X TAE buffer (40 mM Tris-acetate, 1 mM
ethylenediaminetetraacetic acid (EDTA) pH 7.4) was boiled till it
become transparent. The boiling liquid agarose was cooled down
and then 4 µl of Ethidium Bromide (EtBr) was added.
After mixing it properly, the mixture was poured into gel casting
tray.
After the solidification of gel the combs were removed and the
gel was placed into an electrophoresis unit containing 1X TAE
buffer.
mixed 2 µl of DNA sample with 2 µl of 6X loading dye . Load the
Mixture into agarose gel.
Load 3 µl of 1kb DNA ladder (Invitrogen) in first well of the
agarose gel tray .
Run the gel at 100 V for 1 hour. Observed it under UV light
Sequencing
Phylogenic relationships
Diversity analysis- . Shannon–Wiener
Simpson diversity
Shannon–Wiener index (H’):
H’= -Σ Pi (lnPi)
“Pi” - n/N
“n” - No. of individuals
“N” - Total no. of individuals
“ln” - Natural logarithm
The index value varies from 0 to 4.5 for samples containing
more than five species. Domination of a single species in a
sample is represented by a value near zero. Value near 4.5
indicates the even distribution of individuals present in a
sample.
Simpson index (D):

DS=N(N -1)/ Σ ni(ni-1)

“Ds” - Simpson diversity index
“ni - No. of individuals
“N” - Total no. of individuals
Higher value of D indicate the
greater diversity.
Identification of bacteria through culture-independent
approach
Library preparations and metagenomic analysis
The samples of A, B,C….may sequenced at Scigenome
using an Illumina MiSeq platform. Abbreviated names were
used for targeted sample .
select the Gene and region (e. g. 16S rRNA gene with main
focus on V3 region which is a highly variable region).
 Module III : Physiological, Molecular and

Phytotoxicity Assessment in Crops

Tritrophic interaction mechanism of pest-host plant-natural

enemies in an ecosystem, Impact of climate change on pest

population and crop productivity, Role of semiochemicals,

especially VOCs in changing climate, Impact of biofertilizers and

biopesticides on pest population and soil health

Tritrophic interaction mechanism
of pest-host plant-natural enemies
in an ecosystem
The IPM system comprises of six basic components
1.Acceptable pest levels: IPM mainly focused on minimizing the pest
population, instead of its complete eradication. In IPM application,
first acceptable pest level is determined which is known as action
thresholds, and then apply pest control strategy.
2. Preventive cultural practices: Varietal selection suitable for local
growing conditions and maintenance of healthy crops is referred as
the first line of defense in IPM. The application of various cultural
techniques served as a second line in IPM.
3. Monitoring: Monitoring is an important aspect of IPM which
includes regular observation, visual inspection, identification of pests
and trapping of pest population.
4.Mechanical controls: It includes hand-picking, application of traps,
breeding disruption through vacuuming etc.
5.Biological Controls: This is the most important component of IPM. In
this, main approach is based on promoting natural enemies of
targeted pests.
6.Responsible use: In this, safe synthetic pesticides may be applied.
Among these approaches, Biological Control is an essential
component of this strategy . It is an eco-friendly and effective
means of mitigating pests/ Pest effects. It relies on parasitism
or other natural phenomenas to regulate pest population size.
There are four components of biological pest control, i.e.,

Introduction/Importation: It consists introduction of a natural

enemy/ enemies of targeted pest/pests to a new area where
they were not present naturally .

Inoculative release: It includes the supplementary release of

natural enemies to enhance the natural population .
Inundative release: It is described as releasing huge number of
biocontrol agents for immediate supression of pests .

Conservation: The conservation of previously present natural

enemies is fourth method of biological pest control .
Impact of climate change on pest
population and crop productivity

https://
journal.hep.com.cn/fase/EN/10.15302/J-FASE-
2021432
https://www.mdpi.com/2075-4450/12/5/440
Role of semiochemicals, especially VOCs in changing climate

https://www.intechopen.com/chapters/53055
Impact of biofertilizers and biopesticides on pest population and
soil health

file:///C:/
Users/AAYUSHI/Downloads/A_REVIEW_ON_TH
E_EFFECTS_OF_BIOFERTILIZER.pdf