© 2018 Pearson Education Ltd.

© 2018 Pearson Education Ltd.

 From where did you get your traits?

© 2018 Pearson Education Ltd.

Pre-Knowledge
▪ Match the Term with the definition on Nearpod

© 2018 Pearson Education Ltd.

Genotype versus Phenotype

1. A segment of DNA that codes for a 3. The alleles that an organism has:
particular trait is best a. Phenotype
known as a what? b. Genotype
a. Allele c. Chromosome
b. Gene d. Trait
c. Physical characteristic
d. DNA
4. The observable expression of a
2. A version of a particular trait is best known trait
as which one of the following? e. Genotype
e. Allele f. Phenotype
f. DNA g. chromosome
g. Gene h. alleles
h. trait
© 2018 Pearson Education Ltd.
© 2018 Pearson Education Ltd.
© 2018 Pearson Education Ltd.
© 2018 Pearson Education Ltd.
The Flow of Genetic Information

▪ The information content of genes is in the specific

sequences of nucleotides
▪ The DNA inherited by an organism leads to
specific traits by dictating the synthesis of proteins
▪ Proteins are the links between genotype and
phenotype
▪ Gene expression, the process by which DNA
directs protein synthesis, includes two stages:
transcription and translation

© 2018 Pearson Education Ltd.

© 2018 Pearson Education Ltd.
 An albino raccoon

© 2018 Pearson Education Ltd.

Basic Principles of Transcription and
Translation
▪ RNA is the bridge between genes and the proteins
for which they code
▪ Transcription is the synthesis of RNA using
information in DNA
▪ Transcription produces messenger RNA (mRNA)
▪ Translation is the synthesis of a polypeptide, using
information in the mRNA
▪ Ribosomes are the sites of translation

© 2018 Pearson Education Ltd.

Basic Principles of Transcription and
Translation, Continued
▪ In prokaryotes, translation of mRNA can begin
before transcription has finished
▪ In a eukaryotic cell, the nuclear envelope separates
transcription from translation
▪ Eukaryotic RNA transcripts are modified through
RNA processing to yield the finished mRNA

© 2018 Pearson Education Ltd.

 a) Bacterial cell b) Eukaryotic cell

© 2018 Pearson Education Ltd.

 a) Bacterial cell
Because of its tiny size, bacterial DNA contains coding genes across its
whole length. Unlike eukaryotes, which contain extensive chromosomal
DNA and non-coding gene segments.
© 2018 Pearson Education Ltd.
 a) Bacterial cell

© 2018 Pearson Education Ltd.

© 2018 Pearson Education Ltd.
b) Eukaryotic cell
© 2018 Pearson Education Ltd.
b) Eukaryotic cell
© 2018 Pearson Education Ltd.
b) Eukaryotic cell
Basic Principles of Transcription and
Translation, Continued-1
▪ A primary transcript is the initial RNA transcript
from any gene prior to processing
▪ The central dogma is the concept that cells are
governed by a cellular chain of command:
DNA → RNA → protein

© 2018 Pearson Education Ltd.

 https://www.labxchange.org/library/items/
lb:LabXchange:fb468b9e:lx_simulation:1?
fullscreen=true
© 2018 Pearson Education Ltd.
Reflection:

1- According to the central dogma, what is the

intermediate molecule involved in the flow of
information in a cell that should go in the blank? DNA
→ ________ → Proteins

A) mtDNA
B) rRNA
C) mRNA
D) tRNA

© 2018 Pearson Education Ltd.

The Genetic Code
Watch the video then answer the questions:
▪ How are the instructions for
assembling amino acids
into proteins encoded into
DNA?
▪ How many nucleotides
correspond to an
amino acid?
▪ There are 20 amino acids,
but there are only four
nucleotide bases in DNA

© 2018 Pearson Education Ltd.

Codons: Triplets of Nucleotides

▪ The flow of information from gene to protein is based

on a triplet code: a series of non-overlapping, three-
nucleotide words
▪ The words of a gene are transcribed into
complementary non-overlapping three-nucleotide
words of mRNA
▪ These words are then translated into a chain of
amino acids, forming a polypeptide.

© 2018 Pearson Education Ltd.

© 2018 Pearson Education Ltd.
© 2018 Pearson Education Ltd.
© 2018 Pearson Education Ltd.
Codons: Triplets of Nucleotides, Continued
One of the two DNA strands, the template strand,
provides a template for ordering the sequence of
complementary nucleotides in an RNA transcript

The template strand is always the same strand

for a given gene

The strand used as the template is determined by the

orientation of the enzyme that transcribes the gene

This in turn, depends on the DNA sequences

associated with the gene

© 2018 Pearson Education Ltd.

Codons: Triplets of Nucleotides, Continued-1

During translation, the mRNA base triplets, called codons,

are read in the 5′ → 3′ direction

The nontemplate strand is called the coding strand because

the nucleotides of this strand are identical to the codons,
except that T is present in the DNA in place of U in the RNA

Each codon specifies the amino acid (one of 20)

to be placed at the corresponding position along
a polypeptide
Cracking the Code

▪ All 64 codons were deciphered in the early 1960s

▪ Of the 64 triplets, 61 code for amino acids; 3 triplets
are “stop” signals to end translation
▪ The genetic code is redundant (more than one
codon may specify a particular amino acid) but
not ambiguous; no codon specifies more than
one amino acid
▪ Codons must be read in the correct reading frame
(correct groupings) in order for the specified
polypeptide to be produced

© 2018 Pearson Education Ltd.

Reflection
1. Which of the following is not a feature of the genetic code?
a) Triplet
b) Degenerate
c) Non – overlapping
d) Ambiguous

2. The genetic code is essentially the same for all organisms. From this, one can logically
assume which of the following statements to be true?
a) A gene from an organism can theoretically be expressed by any other organism.
b) DNA was the first genetic material.
c) The same codons in different organisms translate into different amino acids.
d) Different organisms have different types of amino acids.

3. The genetic code is redundant. What is meant by this statement?

a) A single codon can specify the addition of more than one amino acid.
b) The genetic code is different for different domains of organisms.
c) The genetic code is universal (the same for all organisms).
d) More than one codon can specify the addition of the same amino acid.

© 2018 Pearson Education Ltd.

© 2018 Pearson Education Ltd.
 Given a sequence of the template strand DNA below, transcribe it to RNA then
translate it into a sequence of amino acids. ( refer to the genetic code table on
slide 28).

3’ TACGCGGTGAAATATGTCATT 5’

mRNA:

a.a:

© 2018 Pearson Education Ltd.

© 2018 Pearson Education Ltd.
Evolution of the Genetic Code

The genetic code is nearly universal,

shared by the simplest bacteria and
the most complex animals

Genes can be transcribed and

translated after being transplanted
from one species to another
 a) Tobacco plant expressing b) Pig expressing a jellyfish
a firefly gene gene

© 2018 Pearson Education Ltd.

While DNA always exists as a double helix, RNA molecules are more variable in
form (mRNA, tRNA, rRNA)
1- Messenger RNA (mRNA) carries the message that will
be translated to form a protein.

2- Ribosomal RNA (rRNA) molecule in cells that forms part of the protein-
synthesizing organelle known as a ribosome and that is exported to the cytoplasm
to help translate the information in messenger RNA (mRNA) into protein.

3- Transfer RNA (tRNA) brings amino acids from the

cytoplasm to a ribosome.

mRNA is the ONLY coding RNA, tRNA and rRNA are noncoding
Concept 17.2: Transcription is the DNA-directed
synthesis of RNA: a closer look
Gene expression : Step 1: Transcription:

Molecular Components of Transcription

▪ RNA synthesis is catalyzed by RNA polymerase,
which pries the DNA strands apart and joins together
the RNA nucleotides
▪ The RNA is complementary to the DNA template
strand
▪ RNA polymerase does not need any primer
▪ RNA synthesis follows the same base-pairing rules
as DNA, except that uracil substitutes for thymine
© 2018 Pearson Education Ltd.
Animation: Transcription
What are the three steps of transcription?

© 2018 Pearson Education Ltd.

Molecular Components of Transcription,
Continued
▪ The DNA sequence where RNA polymerase
attaches is called the promoter.
▪ In bacteria, the sequence signaling the end of
transcription is called the terminator
▪ The stretch of DNA that is transcribed is called a
transcription unit.

© 2018 Pearson Education Ltd.

Synthesis of an RNA Transcript

▪ The three stages of transcription:

▪ Initiation
▪ Elongation
▪ Termination

© 2018 Pearson Education Ltd.

 1) Initiation

© 2018 Pearson Education Ltd.

 1) Initiation

2) Elongation

© 2018 Pearson Education Ltd.

 1) Initiation

2) Elongation

3) Termination

© 2018 Pearson Education Ltd.

RNA Polymerase Binding and Initiation of
Transcription
▪ Promoters signal the transcription start point and
usually extend several dozen nucleotide pairs
upstream of the start point
▪ Transcription factors mediate the binding of RNA
polymerase and the initiation of transcription
▪ The completed assembly of transcription factors and
RNA polymerase II bound to a promoter is called a
transcription initiation complex
▪ A promoter called a TATA box is crucial in forming
the initiation complex in eukaryotes

© 2018 Pearson Education Ltd.

 1) A eukaryotic
promoter

2) Several
transcription
factors bind
to DNA.

3) Transcription
initiation
complex
forms.
© 2018 Pearson Education Ltd.
Elongation of the RNA Strand

▪ As RNA polymerase moves along the DNA, it

untwists the double helix, 10 to 20 bases at a time
▪ Transcription progresses at a rate of 40 nucleotides
per second in eukaryotes
▪ A gene can be transcribed simultaneously by several
RNA polymerases
▪ Nucleotides are added to the 3′ end of the
growing RNA molecule

© 2018 Pearson Education Ltd.

© 2018 Pearson Education Ltd.
Termination of Transcription

▪ The mechanisms of termination are different in

bacteria and eukaryotes
▪ In bacteria, the polymerase stops transcription at the
end of the terminator and the mRNA can be
translated without further modification
▪ In eukaryotes, RNA polymerase II transcribes the
polyadenylation signal sequence; the RNA transcript
is released 10-35 nucleotides past this
polyadenylation sequence

© 2018 Pearson Education Ltd.

Concept 17.3: Eukaryotic cells modify RNA after
transcription
▪ Enzymes in the eukaryotic nucleus modify pre-
mRNA (RNA processing) before the genetic
messages are dispatched to the cytoplasm
▪ During RNA processing, both ends of the primary
transcript are altered
▪ Also, in most cases, certain interior sections of the
molecule are cut out and the remaining parts spliced
together

© 2018 Pearson Education Ltd.

Alteration of mRNA Ends

▪ Each end of a pre-mRNA molecule is modified in a

particular way
▪ The 5′ end receives a modified Guanine nucleotide 5′
cap
▪ The 3′ end gets a poly-A tail (An enzyme adds 50-
250 adenine nucleotides)
▪ These modifications share several functions
▪ They seem to facilitate the export of mRNA to the cytoplasm
▪ They protect mRNA from degeneration by hydrolytic enzymes
▪ They help ribosomes attach to the 5′ end once it reaches the
cytoplasm.

© 2018 Pearson Education Ltd.

 UTRs are parts of the mRNA that will not be translated
into protein, but they have other functions as ribosome
binding.

© 2018 Pearson Education Ltd.

Split Genes and RNA Splicing

▪ Most eukaryotic genes and their RNA transcripts

have long noncoding stretches of nucleotides that lie
between coding regions
▪ These noncoding regions are called intervening
sequences, or introns
▪ The other regions are called exons because they
are eventually expressed, usually translated into
amino acid sequences
▪ RNA splicing removes introns and joins exons,
creating an mRNA molecule with a continuous
coding sequence.
© 2018 Pearson Education Ltd.
© 2018 Pearson Education Ltd.
 1. Which of the following processes occurs in eukaryotic gene expression?
a) mRNA, tRNA, and rRNA are translated.
b)RNA polymerase binds to the terminator sequence.
c)A cap is added to the 5′ end of the mRNA.
d)RNA polymerase requires tRNA to elongate the molecule.

2. In the structural organization of many eukaryotic genes, individual exons may be

related to which of the following?
a) the sequence of the intron that immediately precedes each exon
b) the number of polypeptides making up the functional protein
c) the various domains of the polypeptide product
d) the number of start sites for transcription

3. In an experimental situation, a student researcher inserts an mRNA molecule into a

eukaryotic cell after she has removed its 5′ cap and poly-A tail. Which of the following
processes would you expect her to find to have occurred?
a) The mRNA is quickly converted into a ribosomal subunit.
b) The cell adds a new poly-A tail to the mRNA.
c) The mRNA attaches to a ribosome and is translated, but more slowly.
d) The molecule is digested by enzymes because it is not protected at the 5′ end
© 2018 Pearson Education Ltd.
Split Genes and RNA Splicing, Continued

▪ In some cases, RNA splicing is carried out by

spliceosomes
▪ Spliceosomes consist of a variety of proteins and
several small RNAs that recognize the splice sites.
▪ The RNAs of the spliceosome also catalyze the
splicing reaction, and they participate in spliceosome
assembly.

© 2018 Pearson Education Ltd.

 Exons: Eventually
expressed.
Introns: intervening
sequences.(After splicing
introns will be released for
rapid degradation)

Identify the complex molecule

responsible for splicing of introns.
© 2018 Pearson Education Ltd.
Ribozymes

▪ Ribozymes are catalytic RNA molecules that

function as enzymes and can splice RNA.
▪ The discovery of ribozymes rendered obsolete the
belief that all biological catalysts were proteins.
▪ In some organisms : The intron RNA functions as
ribozyme and catalyzes its own removal.
▪ For example: in the ciliate protist Tetrahymena, self-
splicing occurs in the production of ribosomal RNA.

© 2018 Pearson Education Ltd.

Ribozymes, Continued

▪ Three properties of RNA enable it to function as an

enzyme
▪ It can form a three-dimensional structure because of
its ability to base-pair with itself
▪ Some bases in RNA contain functional groups that
may participate in catalysis
▪ RNA may form hydrogen-bond with other nucleic acid
molecules

© 2018 Pearson Education Ltd.

The Functional and Evolutionary Importance
of Introns
▪ Some introns contain sequences that may regulate
gene expression, and many can affect gene
products.
▪ Some genes can encode more than one kind of
polypeptide, depending on which segments are
treated as exons during splicing
▪ This is called alternative RNA splicing
▪ Consequently, the number of different proteins an
organism can produce is much greater than its
number of genes

© 2018 Pearson Education Ltd.

Alternative Splicing

• How does alternative splicing contribute to diversity?

© 2018 Pearson Education Ltd.

The Functional and Evolutionary Importance
of Introns, Continued
▪ Proteins often have a modular architecture
consisting of discrete regions called domains
▪ In many cases, different exons code for the different
domains in a protein.(for example an enzyme might
have one domain includes the active site and
another might allow the enzyme to bind to a cellular
membrane)
▪ Introns increase the probability of crossing over
between exon, shuffling may result in new
combination of exons which leads to the evolution of
new proteins.
© 2018 Pearson Education Ltd.
Exon Shuffling ( Read and Understand)

Crossing over is a cellular

process that happens
during meiosis when
chromosomes of the same
type are lined up. When two
chromosomes — one from
the mother and one from the
father — line up, parts of the
chromosome can be
switched. The two
chromosomes contain the
same genes, but may have
different forms of the genes

© 2018 Pearson Education Ltd.

© 2018 Pearson Education Ltd.
© 2018 Pearson Education Ltd.
Concept 17.4: Translation is the RNA-directed
synthesis of a polypeptide: a closer look
▪ Genetic information flows from mRNA to protein
through the process of translation

© 2018 Pearson Education Ltd.

Molecular Components of Translation

▪ A cell translates an mRNA message into protein with

the help of transfer RNA (tRNA)
▪ tRNAs transfer amino acids to the growing
polypeptide in a ribosome
▪ Translation is a complex process in terms of its
biochemistry and mechanics

© 2018 Pearson Education Ltd.

 List the molecular
components of
translation.

© 2018 Pearson Education Ltd.

The Structure and Function of Transfer RNA

▪ Each tRNA molecule enables translation of a given

mRNA codon into a certain amino acid
▪ Each has a unique anticodon on one end; the
anticodon base-pairs with a complementary codon on
mRNA
▪ Each carries a specific corresponding amino acid on
the other end

© 2018 Pearson Education Ltd.

 A tRNA adds its
amino acid to a
growing polypeptide
chain when the anti-
codon hydrogen-
bonds to the
complementary
codons on the
mRNA.

© 2018 Pearson Education Ltd.

The Structure and Function of Transfer RNA,
Continued-1
▪ Because of hydrogen bonds, tRNA actually twists
and folds into a three-dimensional molecule
▪ tRNA is roughly L-shaped with the 5' and 3' ends
both located near one end of the structure
▪ The protruding 3' end acts as an attachment site for
an amino acid,

© 2018 Pearson Education Ltd.

Video: Stick and Ribbon Rendering of a tRNA

© 2018 Pearson Education Ltd.

The Structure and Function of Transfer RNA,
Continued-2
▪ Accurate translation requires two steps
▪ First: a correct match between a tRNA and an amino
acid, done by the enzyme aminoacyl-tRNA
synthetase
▪ Second: a correct match between the tRNA anticodon
and an mRNA codon
▪ Flexible pairing at the third base of a codon is called
wobble and allows some tRNAs to bind to more
than one codon.
▪ (Wobble explains why the synonymous codons for a
given amino acid most often differ in 3 rd nucleotide)
© 2018 Pearson Education Ltd.
© 2018 Pearson Education Ltd.
© 2018 Pearson Education Ltd.
© 2018 Pearson Education Ltd.
Figure 17.17_3 Aminoacyl-tRNA Synthetases Provide
Specificity in Joining Amino Acids to their tRNAs (Step 3)

© 2018 Pearson Education Ltd.

Figure 17.17a Aminoacyl-tRNA Synthetases Provide Specificity in
Joining Amino Acids to their tRNAs (Part 1: Computer Model)

© 2018 Pearson Education Ltd.

The Structure and Function of Ribosomes

▪ Ribosomes facilitate specific coupling of tRNA

anticodons with mRNA codons in protein synthesis
▪ The two ribosomal subunits (large and small) are
made of proteins and ribosomal RNA (rRNA), in
eukaryotic it is made in nucleolus.
▪ Bacterial and eukaryotic ribosomes are somewhat
similar but have significant differences in their
molecular composition.
▪ Some antibiotic drugs specifically target bacterial
ribosomes and inactivate it without affecting the
ability of eukaryotic ribosomes to make protein.
© 2018 Pearson Education Ltd.
The Structure and Function of Ribosomes,
Continued
▪ A ribosome has three binding sites for tRNA
▪ The P site holds the tRNA that carries the growing
polypeptide chain
▪ The A site holds the tRNA that carries the next amino
acid to be added to the chain
▪ The E site is the exit site, where discharged tRNAs
leave the ribosome

https://www.youtube.com/watch?v=5bLEDd-PSTQ

© 2018 Pearson Education Ltd.

 a) Computer model of functioning ribosome

b) Schematic model showing binding sites c) Schematic model with mRNA and tRNA
© 2018 Pearson Education Ltd.
 a) Computer model of functioning ribosome
© 2018 Pearson Education Ltd.
 b) Schematic model showing binding sites

© 2018 Pearson Education Ltd.

 c) Schematic model with mRNA and tRNA
© 2018 Pearson Education Ltd.
Building a Polypeptide

▪ The three stages of translation:

▪ Initiation
▪ Elongation
▪ Termination
▪ All three stages require protein “factors” that aid in
the translation process
▪ Energy is required for some steps, too
https://www.youtube.com/watch?v=5bLEDd-PSTQ

© 2018 Pearson Education Ltd.

Ribosome Association and Initiation of
Translation
▪ The start codon (AUG) signals the start of translation
▪ First, a small ribosomal subunit binds with mRNA
and a special initiator tRNA that carries methionine.
▪ Then the small subunit moves along the mRNA until
it reaches the start codon
▪ Proteins called initiation factors is responsible for the
union of mRNA, the small ribosomal subunit, and the
large subunit that completes the translation initiation
complex using energy obtained by hydrolysis of a
GTP molecule.

© 2018 Pearson Education Ltd.

© 2018 Pearson Education Ltd.
© 2018 Pearson Education Ltd.
Elongation of the Polypeptide Chain

▪ During elongation, amino acids are added one

by one to the C-terminus (final amino acid end) of
the growing chain
▪ Each addition involves proteins called elongation
factors
▪ Elongation occurs in three steps: codon recognition,
peptide bond formation, and translocation
▪ Energy expenditure occurs in the first and third steps

© 2018 Pearson Education Ltd.

Elongation of the Polypeptide Chain, Continued

▪ Translation proceeds along the mRNA in a

5′ → 3′ direction
▪ The ribosome and mRNA move relative to each
other, codon by codon
▪ The elongation cycles takes less than a tenth of a
second in bacteria

© 2018 Pearson Education Ltd.

© 2018 Pearson Education Ltd.
© 2018 Pearson Education Ltd.
© 2018 Pearson Education Ltd.
© 2018 Pearson Education Ltd.
Termination of Translation

▪ Elongation continues until a stop codon in the mRNA

reaches the A site of the ribosome
▪ The A site accepts a protein called a release factor
▪ The release factor causes the addition of a water
molecule instead of an amino acid
▪ This reaction releases the polypeptide, and the
translation assembly comes apart

© 2018 Pearson Education Ltd.

© 2018 Pearson Education Ltd.
© 2018 Pearson Education Ltd.
© 2018 Pearson Education Ltd.
© 2018 Pearson Education Ltd.
Completing and Targeting the Functional
Protein
▪ Often translation is not sufficient to make a functional
protein
▪ Polypeptide chains are modified after translation or
targeted to specific sites in the cell

© 2018 Pearson Education Ltd.

Protein Folding and Post-Translational
Modifications
▪ During its synthesis, a polypeptide chain begins to
coil and fold spontaneously into a specific shape—a
three-dimensional molecule with secondary and
tertiary structure
▪ A gene determines primary structure, and primary
structure in turn determines shape
▪ Post-translational modifications may be required
before the protein can begin doing its particular job
in the cell
▪ https://www.youtube.com/watch?v=XCLfdGbySAA

© 2018 Pearson Education Ltd.

Targeting Polypeptides to Specific Locations

▪ Two populations of ribosomes are evident in cells:

free ribosomes (in the cytosol) and bound ribosomes
(attached to the ER)
▪ Free ribosomes mostly synthesize proteins that
function in the cytosol.
▪ Bound ribosomes make proteins of the
endomembrane system and proteins that are
secreted from the cell.
▪ Ribosomes are identical and can switch from free to
bound

© 2018 Pearson Education Ltd.

Targeting Polypeptides to Specific Locations,
Continued
▪ Polypeptide synthesis always begins in the cytosol
▪ Synthesis finishes in the cytosol unless the
polypeptide signals the ribosome to attach to the ER.
▪ Polypeptides destined for the ER or for secretion are
marked by a signal peptide.
▪ Protein folding occurs in a cellular compartment
called the endoplasmic reticulum. This is a vital
cellular process because proteins must be
correctly folded into specific, three-dimensional
shapes in order to function correctly.

© 2018 Pearson Education Ltd.

Targeting Polypeptides to Specific Locations,
Continued-1
▪ A signal-recognition particle (SRP) binds to the
signal peptide
▪ The SRP escorts the ribosome to a receptor protein
built into the ER membrane

© 2018 Pearson Education Ltd.

© 2018 Pearson Education Ltd.
 Making Multiple Polypeptides in Bacteria and Eukaryotes

▪ Multiple ribosomes can

translate a single mRNA
simultaneously, forming
a polyribosome (or
polysome)
▪ Polyribosomes enable a
cell to make many
copies of a polypeptide
very quickly

© 2018 Pearson Education Ltd.

 a) Several ribosomes simultaneously translating
one mRNA molecule

b) A large polyribosome in a bacterial cell (TEM)

© 2018 Pearson Education Ltd.
Making Multiple Polypeptides in Bacteria and
Eukaryotes, Continued-1
▪ A bacterial cell ensures a streamlined process by
coupling transcription and translation
▪ In this case the newly made protein can quickly
diffuse to its site of function

A one room workshop.

© 2018 Pearson Education Ltd.

Figure 17.24 Coupled Transcription and
Translation in Bacteria

© 2018 Pearson Education Ltd.

Making Multiple Polypeptides in Bacteria and
Eukaryotes, Continued-2
▪ In eukaryotes, the nuclear envelope separates the
processes of transcription and translation
▪ RNA undergoes processing before leaving the
nucleus

© 2018 Pearson Education Ltd.

Figure 17.25 A Summary of Transcription and
Translation in a Eukaryotic Cell

© 2018 Pearson Education Ltd.

BioFlix Animation: Protein Synthesis

© 2018 Pearson Education Ltd.

Animation: Translation

© 2018 Pearson Education Ltd.

Concept 17.5: Mutations of one or a few
nucleotides can affect protein structure and
function
▪ Mutations are changes in the genetic information of
a cell
▪ Point mutations are changes in just one nucleotide
pair of a gene
▪ The change of a single nucleotide in a DNA template
strand can lead to the production of an abnormal
protein
▪ If a mutation has an adverse effect on the phenotype
of the organism, the condition is referred to as a
genetic disorder or hereditary disease
© 2018 Pearson Education Ltd.
Figure 17.26 The Molecular Basis of Sickle-cell
Disease: A Point Mutation

© 2018 Pearson Education Ltd.

Types of Small-Scale Mutations

▪ Point mutations within a gene can be divided into

two general categories:
▪ Single nucleotide-pair substitutions
▪ Nucleotide-pair insertions or deletions

© 2018 Pearson Education Ltd.

Substitutions

▪ A nucleotide-pair substitution replaces one

nucleotide and its partner with another pair of
nucleotides
▪ Silent mutations have no effect on the amino acid
produced by a codon because of redundancy in the
genetic code.
▪ Missense mutations still code for an amino acid,
but not the correct amino acid.
▪ Nonsense mutations change an amino acid codon
into a stop codon; most lead to a nonfunctional
protein.
© 2018 Pearson Education Ltd.
 Wild type

Nucleotide-pair substitution: silent

© 2018 Pearson Education Ltd.

Insertions and Deletions

▪ Insertions and deletions are additions or losses of

nucleotide pairs in a gene
▪ These mutations have a disastrous effect on the
resulting protein more often than substitutions do
▪ Insertion or deletion of nucleotides may alter the
reading frame, producing a frameshift mutation

© 2018 Pearson Education Ltd.

 Wild type

Nucleotide-pair substitution: missense

© 2018 Pearson Education Ltd.

New Mutations and Mutagens

▪ Spontaneous mutations can occur during errors in

DNA replication, recombination, or repair.
▪ Mutagens are physical or chemical agents that can
cause mutations
▪ Chemical mutagens fall into a variety of categories
▪ Most carcinogens (cancer-causing chemicals) are
mutagens, and most mutagens are carcinogenic

© 2018 Pearson Education Ltd.

© 2018 Pearson Education Ltd.
© 2018 Pearson Education Ltd.
© 2018 Pearson Education Ltd.
© 2018 Pearson Education Ltd.
Alteration of Chromosome Structure ( large-scale mutations)

▪ Breakage of a chromosome can lead to four

types of changes in chromosome structure:
▪ Deletion removes a chromosomal segment
▪ Duplication repeats a segment
▪ Inversion reverses a segment within a chromosome
▪ Translocation moves a segment from one
chromosome to another

© 2018 Pearson Education Ltd.

 Fig. 15-15
A B C D E F G H A B C E F G H
(a) Deletion

A B C D E F G H A B C B C D E F G H
(b) Duplication

A B C D E F G H A D C B E F G H
(c) Inversion

A B C D E F G H M N O C D E F G H
(d)
Reciprocal
translocation
M N O P Q R A B P Q R

© 2018 Pearson Education Ltd.

Abnormal Chromosome Number

▪ In nondisjunction, pairs of homologous

chromosomes do not separate normally during
meiosis
▪ As a result, one gamete receives two of the same
type of chromosome, and another gamete receives
no copy

© 2018 Pearson Education Ltd.

 Fig. 15-13-3

Nondisjunction
Meiosis I

Nondisjunction
Meiosis II
Gametes

n+1 n+1 n–1 n–1 n+1 n–1 n n

Number of chromosomes

(a) Nondisjunction of homologous (b) Nondisjunction of sister

chromosomes in meiosis I chromatids in meiosis II
© 2018 Pearson Education Ltd.
Reflection
1-How might a single base substitution in the sequence of a gene affect the amino acid
sequence of a protein encoded by the gene?
A) Only a single amino acid could change, because the reading frame would be unaffected.
B) The amino acid sequence would be substantially altered, because the reading frame
would change with a single base substitution.
C) All amino acids following the substitution would be affected, because the reading frame
would be shifted.
D) It is not possible for a single base substitution to affect protein structure, because each
codon is three bases long.
2-An original section of DNA has the base sequence AGCGTTACCGT. A mutation in
this DNA strand results in the base sequence AGGCGTTACCGT. What type of
mutation does this change represent?
A) a missense mutation
B) a point mutation
C) a silent mutation
D) frameshift mutation

© 2018 Pearson Education Ltd.

 © 2018 Pearson Education Ltd.
d. Because nondisjunction occurred in anaphase IIII, all gametes will have an abnormal
chromosome number and the individual will likely exhibit phenotypic evidence of the
nondisjunction event.
c. Because nondisjunction occurred in anaphase IIII, all gametes will be normal and the resulting
individual will be phenotypically normal.
b. Because nondisjunction occurred in anaphase II, all gametes will have an abnormal
chromosome number and the individual will likely exhibit phenotypic evidence of the
nondisjunction event.
a. Because nondisjunction occurred in anaphase II, all gametes will be normal and the resulting
individual will be phenotypically normal. gamete?
the daughter cells shown and a normal
produced from fertilization between one of
most likely impact on an individual
Which of the following best describes the
formation is shown in Figure 1.
model showing a possible nondisjunction event and its impact on gamete
3- Nondisjunction during meiosis can negatively affect gamete formation. A
What Is a Gene? Revisiting the Question

▪ The idea of the gene has evolved through the history

of genetics
▪ We have considered a gene as
▪ a discrete unit of inheritance
▪ a region of specific nucleotide sequence in
a chromosome
▪ a DNA sequence that codes for a specific polypeptide
chain

© 2018 Pearson Education Ltd.

What Is a Gene? Revisiting the Question,
Continued
▪ A gene can be defined as a region of DNA that can
be expressed to produce a final functional product
that is either a polypeptide or an RNA molecule

© 2018 Pearson Education Ltd.

 Wild type

(a) Nucleotide-pair substitution (b) Nucleotide-pair insertion or deletion

© 2018 Pearson Education Ltd.

 Wild type

Nucleotide-pair substitution: nonsense

© 2018 Pearson Education Ltd.

 Wild type

Nucleotide-pair insertion: frameshift causing immediate nonsense

© 2018 Pearson Education Ltd.

 Wild type

Nucleotide-pair deletion: frameshift causing extensive missense

© 2018 Pearson Education Ltd.

 Wild type

3 nucleotide-pair deletion: no frameshift, but one amino acid missing

© 2018 Pearson Education Ltd.

Independent assortment
▪ Independent assortment is the process where the
chromosomes move randomly to separate poles
during meiosis. A gamete will end up with 23
chromosomes after meiosis, but independent
assortment means that each gamete will have 1 of
many different combinations of chromosomes; in
other words: different genes and their alleles are
inherited independently within sexually
reproducing organisms.
▪ If independent assortment doesn't happen that
means that the genes are not being randomly
mixed, and their traits would be the exact same as
the mother or father.
© 2018 Pearson Education Ltd.
 Independent Assortment

© 2018 Pearson Education Ltd.

Crossing Over
▪ Crossing over is a cellular process that happens during
meiosis when chromosomes of the same type are lined
up. When two chromosomes — one from the mother and
one from the father — line up, parts of the chromosome
can be switched. The two chromosomes contain the same
genes but may have different forms of the genes. The
mother's form of a gene, let's say, could be moved to the
father's chromosome, and vice versa.

▪ This is a very interesting and important biological activity;

different combinations of different gene forms are then
potentially passed down to offspring.

▪ This genetic variation helps to increase the diversity of a

species. And diversity strengthens a species' ability to
respond to changing environments over time, and
therefore
© 2018 Pearson Education Ltd. evolve.
Crossing Over

© 2018 Pearson Education Ltd.

Reflection Qs
1- What happens when one nucleotide pair is lost from
the middle of the coding sequence of a gene?

2- The template strand of a gene includes this

sequence:
3’ TACTTGTCCGATATC 5’
3’ TACTTGTCCAATATC 5’
For both wild-type and mutant sequences , draw the
double stranded DNA, the resulting mRNA, and the
amino acid sequence each encodes. What is the effect
of the mutation on the amino acid sequence?

© 2018 Pearson Education Ltd.

Solution:
▪ 1. In the mRNA the reading frame would be shifted
downstream from the deletion , leading to an
incorrect amino acids in the polypeptide.

▪ 2. Normal DNA sequence Mutated

3’ TACTTGTCCGATATC 5’ 3’ TACTTGTCCAATATC 5’
5’ ATGAACAGGCTATAG 3’ 5’ATGAACAGGTTATAG 3’
mRNA: 5’ AUGAACAGGCUAUAG 3’ 5’ AUGAACAGGUUAUAG 3’

a.a Met-Asn-Arg-Leu-stop Met-Asn-Arg-Leu-stop

No effect, because of the redundancy of the
genetic code; : both mRNA codons 5’CUA 3’ and 5’
UUA 3’ code for Leu.

© 2018 Pearson Education Ltd.

Figure 17.UN02 In-text Figure, Transcription, p. 393

© 2018 Pearson Education Ltd.

Figure 17.UN03 In-text Figure, RNA Processing, p. 395

© 2018 Pearson Education Ltd.

Figure 17.UN04 In-text Figure, Translation, p. 397

© 2018 Pearson Education Ltd.

 Sequence alignment
Further Reading T. D. Schneider and R. M. Stephens, Sequence logos: A new way to
display consensus sequences, Nucleic Acids Research 18:6097–6100 (1990).
© 2018 Pearson Education Ltd.
 Sequence logo
Further Reading T. D. Schneider and R. M. Stephens, Sequence logos: A new way
to display consensus sequences, Nucleic Acids Research 18:6097–6100 (1990).
© 2018 Pearson Education Ltd.
 Further Reading T. D. Schneider and R. M. Stephens, Sequence logos: A new way to
display consensus sequences, Nucleic Acids Research 18:6097–6100 (1990).
© 2018 Pearson Education Ltd.
Figure 17.UN05d Skills Exercise: Interpreting a
Sequence Logo (Part 4)

© 2018 Pearson Education Ltd.

Figure 17.UN06a Problem Solving: Are Insulin
Mutations the Cause of Three Infants’ Neonatal
Diabetes? (Part 1)

Wild-type cDNA 5′-CTG GTG GAA GCT CTC TAC CTA GTG TGC GGG GAA CGA GGC TTC TTC TAC ACA CCC AAG ACC-3′

Patient 1 cDNA 5′-CTG GTG GAA GCT CTC TAC CTA GTG TGC GGG GAA CGA GGC TGC TTC TAC ACA CCC AAG ACC-3′

Patient 2 cDNA 5′-CTG GTG GAA GCT CTC TAC CTA GTG TGC GGG GAA CGA GGC TCC TTC TAC ACA CCC AAG ACC-3′

Patient 3 cDNA 5′-CTG GTG GAA GCT CTC TAC CTA GTG TGC GGG GAA CGA GGC TTC TTG TAC ACA CCC AAG ACC-3′

Data from N. Nishi and K. Nanjo, Insulin gene mutations and diabetes, Journal of Diabetes Investigation 2:92-100 (2011).

© 2018 Pearson Education Ltd.

Figure 17.UN06b Problem Solving: Are Insulin
Mutations the Cause of Three Infants’ Neonatal
Diabetes? (Part 2)

© 2018 Pearson Education Ltd.

Figure 17.UN07 Summary of Key Concepts:
Transcription

© 2018 Pearson Education Ltd.

Figure 17.UN08 Summary of Key Concepts:
RNA Processing

© 2018 Pearson Education Ltd.

Figure 17.UN09 Summary of Key Concepts:
Translation

© 2018 Pearson Education Ltd.

Test Your Understanding, Question 9 (Types of
RNA)

Type of RNA Functions

Messenger RNA (mRNA)

Transfer RNA (tRNA)

Plays catalytic (ribozyme) roles and

structural roles in ribosomes

Primary Transcript

Small RNAs in the spliceosome

© 2018 Pearson Education Ltd.

Figure 17.UN11 Test Your Understanding,
Question 13 (Siamese Cat)

© 2018 Pearson Education Ltd.