Scribd
Upload
10 views

STR

Short Tandem Repeats (STRs) are highly polymorphic microsatellites found in eukaryotic genomes, consisting of repeated DNA sequences that vary in length and are dispersed throughout the genome. They are utilized in forensic testing, paternity disputes, and cancer research, providing high discriminating power and sensitivity for DNA analysis, even from degraded samples. STRs can also assist in determining twin zygosity and detecting sample contamination in various biological analyses.

Uploaded by

DrVinay Dagar
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PPTX, PDF, TXT or read online on Scribd
10 views

STR

Short Tandem Repeats (STRs) are highly polymorphic microsatellites found in eukaryotic genomes, consisting of repeated DNA sequences that vary in length and are dispersed throughout the genome. They are utilized in forensic testing, paternity disputes, and cancer research, providing high discriminating power and sensitivity for DNA analysis, even from degraded samples. STRs can also assist in determining twin zygosity and detecting sample contamination in various biological analyses.

Uploaded by

DrVinay Dagar
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PPTX, PDF, TXT or read online on Scribd
You are on page 1/ 16

Short Tandem Repeats

(STR)
http://www.ncbi.nlm.nih.gov/genome/guide/

1 2 3 4 5 6 7 8 9 10 11 12

13 14 15 16 17 18 19 20 21 22 X Y
Short Tandem Repeats
• Genomes of eukaryotes are full of repeated DNA sequences.
• These sequences are present in various sizes. They are usually named according to the length of the core
repeat unit and the number of adjacent repeat units or complete length of the repeat region.
• There might be several hundred to thousand bases in core repeats of long repeat units.
• Those regions of DNA which have short repeats (2-6 bps in length) are known as Short Tandem
Repeats (STRs).
• These are highly polymorphic microsatellites.
• The center of the chromosome is surrounded by STRs.
• Thousands of polymorphic microsatellites have been discovered in human DNA.
• Only 3% of human genome comprises of Short Tandem Repeats. These are dispersed throughout the
genome and are present after every 1000 nucleotides on the average.
Short Tandem Repeat (STR) Markers
An accordion-like DNA sequence that occurs between genes

TCCCAAGCTCTTCCTCTTCCCTAGATCAATACAGACAGAAGACAGGTGGATAGATA
GATAGATAGATAGATAGATAGATAGATAGATAGATAGATATCATTGAAAGACAAA
ACAGAGATGGATGATAGATACATGCTTACAGATGCACAC

= 12 GATA repeats (“12” is all that is reported)


7 repeats The number of consecutive repeat units
8 repeats can vary between people
9 repeats
10 repeats
11 repeats
12 repeats
13 repeats

Target region
(short tandem repeat)
Types of STR Repeat Units on the basis of
LENGTH
Requires size based DNA separation to
resolve different alleles from one another

• Dinucleotide (CA)(CA)(CA)(CA) They have two nucleotides which are repeated next to
each other again and again
• Trinucleotide (GCC)(GCC)(GCC)
• Tetranucleotide (AATG)(AATG)(AATG) *Most
Common Type
• Pentanucleotide (AGAAA)(AGAAA)
• Hexanucleotide (AGTACA)(AGTACA)

Short tandem repeat (STR) = microsatellite =


simple sequence repeat (SSR)
Categories for STR Markers
Category Example Repeat 13 CODIS Loci
Structure
Simple repeats – contain (GATA)(GATA)(GATA) TPOX, CSF1PO,
units of identical length and D5S818, D13S317,
sequence D16S539
Simple repeats with (GATA)(GAT-)(GATA) TH01, D18S51, D7S820
non-consensus alleles
(e.g., TH01 9.3)
Compound repeats – (GATA)(GATA)(GACA) VWA, FGA, D3S1358,
comprise two or more D8S1179
adjacent simple repeats
Complex repeats – (GATA)(GACA)(CA)(CATA) D21S11
contain several repeat
blocks of variable unit length

Complex repeats are not commonly used in forensic DNA typing because of the
difficulties with measurement variability between laboratories and allele nomenclature.

These categories were first described by Urquhart et al. (1994) Int. J. Legal Med. 107:13-20
Markers required for Position of Forensic STR Markers

Core STR Loci for the United States


STR genotyping of
human cell lines on Human Chromosomes
TPOX 13 CODIS Core STR Loci
• Minimum of 8 STR
loci D3S1358
• D5S818
TH01
• D13S317 D8S1179
D5S818 VWA
• D7S820
FGA D7S820
• D16S539
CSF1PO
• vWA
• TH01
• TPOX
• CSF1PO AMEL
Sex-typing
• Gender D13S317
D16S539 D18S51 D21S11 AMEL
determination marker
• Amelogenin (AMEL)
Y-STR
• These are Short Tandem Repeats present on male specific Y chromosome.
• Short arm of Y chromosome comprises of coding genes which are responsible for spermatogenesis and
other male related functions and in determination of male sex.
• Among unrelated males, these Short Tandem Repeats are polymorphic.
• They are inherited from father (paternal line) and show little change through generations.
• They are mainly used to examine sexual assault evidence in forensic laboratories. In such cases female as
well as male DNA will be present in vaginal swabs. To separate female components from male
components differential extraction is used.
However, sometimes separation of male and female components of DNA is not complete as a result male
component also contains female component. In such cases during amplification of male DNA, female
DNA also undergoes amplification and can even mask the male DNA which in turn makes the autosomal
STR analysis difficult.
This masking does not occur while examining Y-STRs. Due to absence of Y STR in female sample and
presence of Y-STR in male sample, the culprit in case of sexual assault can be linked to the crime.

• Y-STRs are also useful in non-sexual assault cases where the evidence materials contain mixed samples of
several males. Identification of all males can be done through Y-STR testing.
Mini-STR
• Short tandem repeat testing is not successful in case of highly
degraded DNA samples or which are limited in quality or
quantity.
• In such situations only partial STR profile may be obtained due to
drop out of STR alleles. Such partial DNA profiles do not provide
enough information in forensic cases.
• Use of mini-STRs is an alternative approach to such cases.
• For mini STR analysis, specially designed primers are used which
target the mini - STR for amplification.
• Mini-STR typing helps in obtaining DNA profile even from highly
degraded samples.
• Following characteristics have been considered for selection of short tandem
repeat loci which have been validated for identification:
1. High discriminating power, usually >0.9, with observed heterozygosity >70%.
2. The chromosomal locations chosen should be separate to make sure that closely
linked loci are not chosen.
3. The results should be reproducible and robust when multiplexed with other
markers.
4. Formation of stutter products (small peaks formed that are several bases smaller
than STR peaks resulting from PCR process when short tandem repeat loci are
copied by a DNA polymerase) should be low.
5. Mutation rate should be low.
6. For analysis of degraded samples alleles with length in range of 90-500 bps
should be preferred.
7. The short tandem repeat markers should be chosen from separate chromosome
for forensic DNA typing to avoid any problem with linkage between markers.
Advantages of STRs over conventional VNTRs

There are several advantages of PCR- based STRs over conventional


RFLP technique of VNTRs (Variable Number of Tandem Repeats):

i. Multiplexing is possible with a narrow allele size range.


ii. Allelic dropouts from preferential amplification of smaller alleles
are reduced due to narrow allele size.
iii. STR can generate small PCR products which help in recovering the
information from degraded DNA samples.
iv. The stutter product formation is reduced as compared to
dinucleotide repeats which help in interpretation of sample
mixtures.
Applications of STRs

Short tandem repeats (STRs) are small regions in DNA which are analyzed for various
purposes. These are used in forensic testing in crime cases, in missing person cases and
paternity disputes. Besides, STRs are used for following purposes also:

a) Detection of contamination of tissue samples


To understand various normal or abnormal physiological or cellular functions, tissues are
dissected and analyzed. In cases where sample’s identity is disputed, comparison of STR
profile of tissues can be done with reference sample to determine sample’s identity. This
analysis is used to detect sample contamination.

The profile of contaminated sample appears as mixed STR profile. Due to sensitivity of STR
analysis, it can create full profiles from less than 100 pg of DNA. This sensitivity allows
detection of very little quantities of contaminating cells or tissues.
b) Detecting Maternal Cell Contamination and Fetal Aneuploidy

Prenatal samples are contaminated with maternal cells. Before assaying prenatal fetal
sample short tandem repeat analysis is performed to make sure prenatal fetal sample is
not contaminated with maternal cells. This is an important consideration where maternal
DNA can interfere with results.

• This analysis is also used to detect fetal blood in maternal blood.


• STR analysis is used to detect fetal chromosomal abnormalities like trisomy or
aneuploidies.
• Fetal gender can be determined using dimorphic Amelogenin locus which
distinguishes XX (female) and XY (male) individuals.
c) Cancer Research
Genetic mutations result in unregulated growth of abnormal cells. This
unregulated growth of cells is known as cancer. Genetic mutations
generally occur in tumor suppressor genes or other proto-oncogenes. To
understand all the details of development and progression of cancer it is
necessary to study the associated genetic changes. The genetic changes
can be determined using short tandem repeat loci.

d) Determining Twin Zygosity


To analyze whether the twins are monozygotic or dizygotic, short
tandem repeat analysis is used. STRs are also used for examining the
rate of monozygotic twin or triple births as a result of artificial
techniques.

You might also like