Cryptography is the application of algorithms to ensure the confiden.docx
Download as docx, pdf0 likes22 views
Cryptography is the application of algorithms to ensure the confidentiality, integrity, and availability of data, while it is at rest, in motion, or in use. Cryptography systems can include local encryptions at the file or disk level or databases. Cryptography systems can also extend to an enterprise-wide public key infrastructure for whole agencies or corporations. The following are the deliverables for this project: Deliverables Enterprise Key Management Plan: An eight- to 10-page double-spaced Word document with citations in APA format. The page count does not include figures, diagrams, tables, or citations. Enterprise Key Management Policy: A two- to three-page double-spaced Word document. Lab Report: A Word document sharing your lab experience along with screenshots. There are seven steps to complete the project. Most steps of this project should take no more than two hours to complete. The entire project should take no more than one week to complete. Begin with the workplace scenario, and then continue to Step 1, “Identify Components of Key Management.” When you submit your project, your work will be evaluated using the competencies listed below. You can use the list below to self-check your work before submission. Step 1: Identify Components of Key Management Key management will be an important aspect of the new electronic protected health information (e-PHI). Key management is often considered the most difficult part of designing a cryptosystem. Choose a fictitious or an actual organization. The idea is to provide an overview of the current state of enterprise key management for Superior Health Care. Review these authentication resources to learn about authentication and the characteristics of key management. Provide a high-level, top-layer network view (diagram) of the systems in Superior Health Care. The diagram can be a bubble chart or Visio drawing of a simple network diagram with servers. Conduct independent research to identify a suitable network diagram. Read these resources on data at rest , data in use, and data in motion . Identify data at rest, data in use, and data in motion as it could apply to your organization. Start by focusing on where data are stored and how data are accessed. Review these resources on insecure handling, and identify areas where insecure handling may be a concern for your organization. Incorporate this information in your key management plan. In the next step, you will consider key management capabilities. Step 3: Identify Key Management Gaps, Risks, Solution s, and Challenges In the previous step, you identified the key components of an enterprise key management system. In this step, you will conduct independent research on key management issues in existing organizations. You will use this research to help identify gaps in key management, in each of the key management areas within Superior Health Care. Conduct independent research to identify typical gaps in key manage.
1 of 12
Download to read offline
Ad
Recommended
member is a security software architect in a cloud service provider .docx
member is a security software architect in a cloud service provider .docxwkyra78 member is a security software architect in a cloud service provider company, assigned to a project to provide the client with data integrity and confidentiality protections for data in transit that will be using applications in the cloud. Your client is an HR company that is moving HR applications and HR data into a community cloud, sharing tenancy with other clients. Your company has set up a software as a service, SAS, offering for its client base.
The data that the HR company will be pushing to and from the cloud will contain sensitive employee information, such as personally identifiable information, PII. You will have to address sensitive data and transit issues of the client data using the HR applications stored in the cloud, and provide a life cycle management report that includes solutions to the cloud computing architect of your company.
Software Development Life Cycle
Technology development and implementation usually follow a software development life cycle (SDLC) methodology. This approach ensures accuracy of information for analysis and decision making, as well as appropriate resources for effective technology management.
You and your team members will use components of the SDLC methodology to develop a
life cycle management report
for the cloud computing architect of a company. This is a group exercise, representing the kind of collaboration often required in the cybersecurity technology community.
There are 11 steps to lead you through this project. Similar steps are typically used in organizational SDLC projects. Most steps should take no more than two hours to complete, and the entire project should take no more than three weeks to complete. Begin with the workplace scenario, and then continue with Step 1: “Initiating the Project.”
Life Cycle Management Report:
A 10- to 15-page double-spaced Word document on data protection techniques for a cloud-based service with citations in APA format. The page count does not include figures or tables. There is no penalty for using additional pages if you need them. Include a minimum of six references. Include a reference list with the report.
As the cloud security architect, you must understand the security development life cycle process. Review the following resources to learn about the security development life cycle process:
security development life cycle
software development methodologies
Click the following links to learn more about critical infrastructure sectors:
Critical Infrastructure Sectors
. Read their descriptions and consider which sector you support in your role.
Process Control Systems: Cybersecurity and Defense
To be completed by a designated team member:
You will begin your Life Cycle Management Report now.
Choose a fictional or actual organization. Describe the mission of the organization and the business need to move to a cloud environment.
Identify the scope of the security architecture and include a topology. To narrow your scope, focus on is.
Term Paper Managing an IT Infrastructure AuditDue Week 10 a.docx
Term Paper Managing an IT Infrastructure AuditDue Week 10 a.docxmanningchassidy Term Paper: Managing an IT Infrastructure Audit
Due Week 10 and worth 210 points
This assignment consists of four (4) sections: an internal IT audit policy, a management plan, a project plan, and a disaster recovery plan.
You must submit all four (4) sections as separate files for the completion of this assignment.
Label each file name according to the section of the assignment it is written for. Additionally, you may create and /or assume all necessary assumptions needed for the completion of this assignment.
Imagine you are an Information Security Manager for a large national retailer. You have been hired to be directly responsible for the planning and oversight of IT audits. At the request of the Board of Directors, the CEO has tasked you with developing a plan for conducting regular audits of the IT infrastructure. The planning and management aspects of IT audit are critical to the overall success of the audit, and as a result, the overall success of the systems implemented within the organization. You must develop a policy for conducting IT audits and develop a project plan for conducting two week IT audits.
In addition to the typical networking and Internetworking infrastructure of a medium-sized organization, the organization has the following characteristics:
They have a main office and 268 stores in the U.S.
They utilize a cloud computing environment for storage and applications.
Their IT infrastructure includes Cisco workgroup and core switches, Cisco routers, Cisco firewalls and intrusion prevention systems, and servers running Microsoft Windows Server 2012.
They have over 1000 desktops and approximately 500 organization-owned laptops in the main headquarters.
They allow employees to bring their own devices into the organization; however, they are subject to being searched upon entry and exit from the building.
They enable remote access to corporate information assets for employees and limited access to extranet resources for contractors and other business partners.
They enable wireless access at the main office and the stores.
They process an average of 67.2 credit card transactions per hour every day at each location and via their corporate Website.
Section 1: Internal IT Audit Policy
Write a three to four (3-4) page paper in which you:
1. Develop an Internal IT Audit Policy, which includes at a minimum:
a. Overview
b. Scope
c. Goals and objectives
d. Compliance with applicable laws and regulations
e. Management oversight and responsibility
f. Areas covered in the IT audits
g. Frequency of the audits
h. Use at least two (2) quality resources in this assignment.
Note
: Wikipedia and similar Websites do not qualify as quality resources.
Section 2: Management Plan
Write a four to six (4-6) page paper in which you:
2. Explain the management plan for conducting IT audits, including:
a. Risk management
b. System Software and Applications
c. Wireless Networking
...
Get the entire Systems Analysis and Design 11th Edition Tilley Solutions Manu...
Get the entire Systems Analysis and Design 11th Edition Tilley Solutions Manu...vardyhanoa6w Get the entire Systems Analysis and Design 11th Edition Tilley Solutions Manual in PDF with one simple click.
erm Paper Managing an IT Infrastructure AuditDue Week 10 and wo
erm Paper Managing an IT Infrastructure AuditDue Week 10 and woeleanorabarrington erm Paper: Managing an IT Infrastructure Audit
Due Week 10 and worth 210 points
This assignment consists of four (4) sections: an internal IT audit policy, a management plan, a project plan, and a disaster recovery plan.
You must submit all four (4) sections as separate files for the completion of this assignment.
Label each file name according to the section of the assignment it is written for. Additionally, you may create and /or assume all necessary assumptions needed for the completion of this assignment.
Imagine you are an Information Security Manager for a large national retailer. You have been hired to be directly responsible for the planning and oversight of IT audits. At the request of the Board of Directors, the CEO has tasked you with developing a plan for conducting regular audits of the IT infrastructure. The planning and management aspects of IT audit are critical to the overall success of the audit, and as a result, the overall success of the systems implemented within the organization. You must develop a policy for conducting IT audits and develop a project plan for conducting two week IT audits.
In addition to the typical networking and Internetworking infrastructure of a medium-sized organization, the organization has the following characteristics:
They have a main office and 268 stores in the U.S.
They utilize a cloud computing environment for storage and applications.
Their IT infrastructure includes Cisco workgroup and core switches, Cisco routers, Cisco firewalls and intrusion prevention systems, and servers running Microsoft Windows Server 2012.
They have over 1000 desktops and approximately 500 organization-owned laptops in the main headquarters.
They allow employees to bring their own devices into the organization; however, they are subject to being searched upon entry and exit from the building.
They enable remote access to corporate information assets for employees and limited access to extranet resources for contractors and other business partners.
They enable wireless access at the main office and the stores.
They process an average of 67.2 credit card transactions per hour every day at each location and via their corporate Website.
Section 1: Internal IT Audit Policy
Write a three to four (3-4) page paper in which you:
1. Develop an Internal IT Audit Policy, which includes at a minimum:
a. Overview
b. Scope
c. Goals and objectives
d. Compliance with applicable laws and regulations
e. Management oversight and responsibility
f. Areas covered in the IT audits
g. Frequency of the audits
h. Use at least two (2) quality resources in this assignment.
Note
: Wikipedia and similar Websites do not qualify as quality resources.
Section 2: Management Plan
Write a four to six (4-6) page paper in which you:
2. Explain the management plan for conducting IT audits, including:
a. Risk management
b. System Software and Applications
c. Wireless Networking
d ...
Cyb 610 Inspiring Innovation--tutorialrank.com
Cyb 610 Inspiring Innovation--tutorialrank.comPrescottLunt386 CYB 610 Project 4 involves a collaborative team tasked with addressing cyber threats and exploitation against US financial systems. The team consists of representatives from financial services, law enforcement, intelligence, and homeland security. They will produce a Situational Analysis Report and After Action Report on a cyber attack involving distributed denial of service attacks and data exfiltration by a nation state actor. The collaboration between sectors is meant to leverage different skills and authorities to better defend critical infrastructure through information sharing and coordinated response.
Systems Analysis and Design 11th Edition Tilley Solutions Manual
Systems Analysis and Design 11th Edition Tilley Solutions Manualjestekudrna Systems Analysis and Design 11th Edition Tilley Solutions Manual
Systems Analysis and Design 11th Edition Tilley Solutions Manual
Systems Analysis and Design 11th Edition Tilley Solutions Manual
Systems Analysis and Design 11th Edition Tilley Solutions Manual
Systems Analysis and Design 11th Edition Tilley Solutions Manualutriliset Systems Analysis and Design 11th Edition Tilley Solutions Manual
Systems Analysis and Design 11th Edition Tilley Solutions Manual
Systems Analysis and Design 11th Edition Tilley Solutions Manual
Migrating to the cloud
Migrating to the cloudIdeaca This document outlines a 4-step process for organizations to determine which applications to migrate to the cloud: 1) Prepare by understanding cloud concepts and your business needs, 2) Identify applications and match them to your business, 3) Assess applications in more detail to create an architecture plan and cost analysis, 4) Plan and execute the migration by determining timelines and performing the migration. The goal is to methodically evaluate applications to find the best candidates for a successful cloud migration.
CST 610 RANK Remember Education--cst610rank.com
CST 610 RANK Remember Education--cst610rank.comchrysanthemu49 FOR MORE CLASSES VISIT
www.cst610rank.com
CST 610 Project 1 Information Systems and Identity Management
CST 610 Project 2 Operating Systems Vulnerabilities (Windows and Linux)
CST 610 Project 3 Assessing Information System Vulnerabilities and Risk
CST 610 Project 4 Threat Analysis and Exploitation
CST 610 Project 5 Cryptography
Systems Analysis and Design 11th Edition Tilley Solutions Manual
Systems Analysis and Design 11th Edition Tilley Solutions Manualbekkiealtork Systems Analysis and Design 11th Edition Tilley Solutions Manual
Systems Analysis and Design 11th Edition Tilley Solutions Manual
Systems Analysis and Design 11th Edition Tilley Solutions Manual
Term Paper The Rookie Chief Information Security OfficerThis assi.docx
Term Paper The Rookie Chief Information Security OfficerThis assi.docxjacqueliner9 Term Paper: The Rookie Chief Information Security Officer
This assignment consists of five (5) parts:
Part 1: Organization Chart
Part 2: Request for Proposal (RFP) Plan
Part 3: Physical Security Plan
Part 4: Enterprise Information Security Compliance Program
Part 5: Risk Management Plan
Imagine that you have been recently promoted to serve as Chief Information Security Officer (CISO) for a Fortune 500 organization. This organization has known brand products across the world and expects top-secret methods for safeguarding proprietary information on its recipes and product lines. The Board of Directors request that their information security strategy be upgraded to allow greater opportunities of secure cloud collaboration between suppliers and resellers of their products. Another concern they have is the recent number of hacktivist attacks that have caused the network to fail across the enterprise. Their concern extends to making sure that they have controlled methods for accessing secured physical areas within their various regional facilities.
For your new position, you will be responsible for developing standards, methods, roles, and recommendations that will set the new IT security path for the organization. The existing organization has limited experience in supporting an enhanced level of IT security; therefore, you may need to outsource certain security services.
Additionally, you may create and / or assume all necessary assumptions needed for the completion of this assignment.
Write an eight to twelve (8-12) page paper in which you provide the following deliverables:
Part 1: Organization Chart
1. Use Visio or an Open Source alternative, such as Dia, to:
a. Create an organization chart in which you:
i. Illustrate the roles that will be required to ensure design, evaluation, implementation, and management of security programs
for the organization.
ii. Within your organizational chart, clearly identify the reporting structure for roles such as IT Security Compliance Officer,
Security Manager, CIO, CISO, IT Security Engineer, Privacy Security Professional, and IT Procurement Specialist.
iii. List the types of resources required to fulfill the each forensic duty of the organization below each of the roles you identified.
iv. Align your organization chart to reflect the Department of Homeland Security (DHS) Essential Body of Knowledge’s three (3)
areas of information security: physical security professional, privacy professional, and procurement professional. Provide
comments and comparisons on how your organizational chart fosters these three (3) values.
Part 2: Request for Proposal (RFP) Plan
2. Develop a Request for Proposal (RFP) plan to solicit qualified vendors that could partner with your internal team to deliver optimum
IT service delivery. The RFP Plan should contain qualifying criteria of potential v.
Accounting Information Systems 2nd Edition Hurt Solutions Manual
Accounting Information Systems 2nd Edition Hurt Solutions Manualbudskanadjm Accounting Information Systems 2nd Edition Hurt Solutions Manual
Accounting Information Systems 2nd Edition Hurt Solutions Manual
Accounting Information Systems 2nd Edition Hurt Solutions Manual
Solution Manual for Systems Analysis and Design, 7th Edition, Alan Dennis
Solution Manual for Systems Analysis and Design, 7th Edition, Alan Dennissipetodavan Solution Manual for Systems Analysis and Design, 7th Edition, Alan Dennis
Solution Manual for Systems Analysis and Design, 7th Edition, Alan Dennis
Solution Manual for Systems Analysis and Design, 7th Edition, Alan Dennis
CST 610 RANK Inspiring Innovation--cst610rank.com
CST 610 RANK Inspiring Innovation--cst610rank.comKeatonJennings104 This document provides instructions for 6 projects in CST 610 related to information security. Project 1 involves assessing the security of a hospital's information systems and implementing identity management solutions. It includes steps to define the infrastructure, identify threats, test password cracking tools, create a non-technical presentation, and write a technical report. Project 2 tasks the reader as a cybersecurity engineer assessing operating system vulnerabilities in a company in the oil and gas sector.
CST 610 RANK Educational Specialist--cst610rank.com
CST 610 RANK Educational Specialist--cst610rank.comVSNaipaul15 FOR MORE CLASSES VISIT
www.cst610rank.com
CST 610 Project 1 Information Systems and Identity Management CST 610 Project 2 Operating Systems Vulnerabilities (Windows and Linux) CST 610 Project 3 Assessing Information System Vulnerabilities and Risk CST 610 Project 4 Threat Analysis and Exploitation CST 610 Project 5 Cryptography CST 610 Project 6 Digital Forensics Analysis
CST 610 RANK Become Exceptional--cst610rank.com
CST 610 RANK Become Exceptional--cst610rank.comagathachristie112 This document provides instructions for 6 projects in CST 610 related to information security. Project 1 involves assessing the security of a hospital's information systems and implementing identity management solutions. It includes steps to define the infrastructure, identify threats, test password cracking tools, create a non-technical presentation, and write a technical report. Project 2 tasks the reader as a cybersecurity engineer assessing vulnerabilities in a company's Windows and Linux operating systems.
Flow-ABriefExplanation
Flow-ABriefExplanationAnthony Parziale Flow is a data science platform that allows companies to overcome obstacles to extracting insight from big data. It can scale to large datasets through its distributed architecture. Flow accepts both structured and unstructured data from various sources. It also abstracts away complex data science concepts to make the platform intuitive and easy to use. This allows companies to leverage data science without deep technical knowledge.
Securing Citizen Facing Applications Presentation Notes
Securing Citizen Facing Applications Presentation Notesedwinlorenzana As requested by folks these are the presentation notes for Securing Citizen Facing Applications. Hope these help with your IDM planning and implementation
CST 610 RANK Achievement Education--cst610rank.com
CST 610 RANK Achievement Education--cst610rank.comkopiko146 FOR MORE CLASSES VISIT
www.cst610rank.com
CST 610 Project 1 Information Systems and Identity Management CST 610 Project 2 Operating Systems Vulnerabilities (Windows and Linux) CST 610 Project 3 Assessing Information System Vulnerabilities and Risk CST 610 Project 4 Threat Analysis and Exploitation CST 610 Project
Businesses involved in mergers and acquisitions must exercise due di.docx
Businesses involved in mergers and acquisitions must exercise due di.docxdewhirstichabod Businesses involved in mergers and acquisitions must exercise due diligence in ensuring that the technology environment of the future organization is robust and adequately protects their information assets and intellectual property.. Such an effort requires time and open sharing to understand the physical locations, computing environment, and any gaps to address. Lack of information sharing can lead to a problematic systems integration and hamper the building of a cohesive enterprise security posture for the merged organization.
Often the urgency of companies undergoing a merger and acquisition (M&A) impedes comprehensive due diligence, especially in cybersecurity. This creates greater challenges for the cybersecurity engineering architect, who typically leads the cybersecurity assessment effort and creates the roadmap for the new enterprise security solution for the future organization. However, the business interest and urgency in completing the merger can also represent an opportunity for CISOs to leverage additional resources and executive attention on strategic security matters.
In this project, you will create a report on system security issues during an M&A. The details of your report, which will also include an executive briefing and summary, can be found in the final step of the project.
There are nine steps to the project. The project as a whole should take two weeks to complete. Begin with the workplace scenario and then continue to Step 1.
Deliverable
Cybersecurity for a Successful Acquisition, Slides to Support Executive Briefing
Step 1: Conduct a Policy Gap Analysis
As you begin Step 1 of your system security report on cybersecurity for mergers and acquisitions, keep in mind that the networks of companies going through an M&A can be subject to cyberattack. As you work through this step and the others, keep these questions in mind:
Are companies going through an M&A prone to more attacks or more focused attacks?
If so, what is the appropriate course of action?
Should the M&A activities be kept confidential?
Now, look at the existing security policies in regard to the acquisition of the media streaming company. You have to explain to the executives that before any systems are integrated, their security policies will need to be reviewed.
Conduct a policy gap analysis to ensure the target company's security policies follow relevant industry standards as well as local, state, and national laws and regulations. In other words, you need to make sure the new company will not inherit any statutory or regulatory noncompliance from either of the two original companies. This step would also identify what, if any, laws and regulations the target company is subject to. If those are different from the laws and regulations the acquiring company is subject to, then this document should answer the following questions:
How would you identify the differences?
How would you learn about the relevant laws and regulations?
How would .
CST 610 RANK Introduction Education--cst610rank.com
CST 610 RANK Introduction Education--cst610rank.comagathachristie265 This document outlines the requirements for 6 projects in CST 610. Project 1 involves assessing the identity management and information security of a hospital system. It includes defining the system infrastructure, threats, password cracking tools, and delivering a technical report and non-technical presentation. Project 2 involves assessing operating system vulnerabilities in a oil/gas company, including unauthorized access and configuration changes. The document provides background for several other projects involving vulnerabilities, threat analysis, cryptography, and digital forensics.
Accounting Information Systems 2nd Edition Hurt Solutions Manual
Accounting Information Systems 2nd Edition Hurt Solutions Manualjaednasamare Accounting Information Systems 2nd Edition Hurt Solutions Manual
Accounting Information Systems 2nd Edition Hurt Solutions Manual
Accounting Information Systems 2nd Edition Hurt Solutions Manual
CSEC 610 Effective Communication - snaptutorial.com
CSEC 610 Effective Communication - snaptutorial.comdonaldzs7 For more classes visit
www.snaptutorial.com
CSEC 610 Project 1 Information Systems and Identity Management
CSEC 610 Project 2 Operating Systems Vulnerabilities (Windows and Linux)
Csec 610 Education Organization-snaptutorial.com
Csec 610 Education Organization-snaptutorial.comrobertlesew5 The document discusses a cybersecurity project involving assessing vulnerabilities in a healthcare organization's information systems. Key points:
1. The student is asked to examine security of a hospital's information infrastructure and make recommendations. Assessments will include a technical report and non-technical presentation.
2. Research on the hospital's systems found password compromises, requiring analysis of identity management and access controls. The student tested password cracking tools to evaluate security.
3. Deliverables include an 8-10 slide presentation for executives, a 6-7 page technical report, and 2-3 page executive summary. Recommendations will address vulnerabilities and risks identified through the assessments.
Discussion 1 post responses.Please respond to the following.docx
Discussion 1 post responses.Please respond to the following.docxcuddietheresa Discussion 1 post responses.
Please respond to the following:
LG’s post states the following:Top of Form
"When Problem Decomposition is not Easy"
Consider the development of a simple mobile application that displays personal financial management video clips selected from a central repository. Discuss how you would systematically analyze the requirements of this application and identify its problem components.
Using a spiral process of stakeholder engagement which includes understanding the business objectives or needs the application is to provide. Next, looking at the requirements gathering process, whereby sitting with the stakeholders and customers to define those needs, understanding the assumptions and constraints, expectations, and coming up with a conceptual model both from a business and system design. Using the model as a base, the requirements will be developed into a high-level requirement set, where they are broken into the logical grouping, such as business, user, functional, non-functional, and transitional segments. Next, the requirements will be viewed with the stakeholders and customers, to address priority, need vs. want, and addressing any ambiguous requirements to gain clarity for completeness.
Explain how software engineering would help you identify the components and their interconnections.
Software engineering helps identify the components and their interconnections because the approach requires identification of components such as hardware, software, users, tasks, and databases, amongst other pieces to be determined and understand how each will interact with the others. Some boundaries must be known that similar to the scope of a project to help provide a context on what is in or out. It includes things like the activities that will be performed and the entities associated with the activities. Understanding these provide the developers in the design and development process. For example, the above mention contextual design or model can be used or provide a reference to things like architectural design, displaying these components and interconnections on paper (or visual drawing) to help articulate the boundaries, activities, and entities for the system.
Phleeger, S. L., Atlee, J. M. (2009-02-01). Software Engineering: Theory and Practice, 4th Edition [VitalSource Bookshelf version]. Retrieved from vbk://9781323089309
Pochimcherla, A., Pochimcherlahttp, A., & Pochimcherla, A. (2018, January 26). Computer science basics - Decomposition - break a problem into smaller. Retrieved from http://steamism.com/compsci-decomposition/.
SP’s post states the following:Top of Form
"When Problem Decomposition is not Easy" Please respond to the following: Consider the development of a simple mobile application that displays personal financial management video clips selected from a central repository. Discuss how you would systematically analyze the requirements of this application and identify its problem component ...
CST 610 Effective Communication - snaptutorial.com
CST 610 Effective Communication - snaptutorial.comdonaldzs7 For more classes visit
www.snaptutorial.com
CST 610 Project 1 Information Systems and Identity Management
CST 610 Project 2 Operating Systems Vulnerabilities (Windows and Linux)
CST 610 Project 3 Assessing Information System Vulnerabilities and Risk
CST 610 Exceptional Education - snaptutorial.com
CST 610 Exceptional Education - snaptutorial.comDavisMurphyA97 For more classes visit
www.snaptutorial.com
CST 610 Project 1 Information Systems and Identity Management
CST 610 Project 2 Operating Systems Vulnerabilities (Windows and Linux)
CST 610 Project 3 Assessing Information System Vulnerabilities and Risk
CST 610 Project 4 Threat Analysis and Exploitation
The Rookie Chief Information Security OfficerDue Week 10 and w.docx
The Rookie Chief Information Security OfficerDue Week 10 and w.docxteresehearn The Rookie Chief Information Security Officer
Due Week 10 and worth 200 points
This assignment consists of five (5) parts:
Part 1: Organization Chart
Part 2: Request for Proposal (RFP) Plan
Part 3: Physical Security Plan
Part 4: Enterprise Information Security Compliance Program
Part 5: Risk Management Plan
Imagine that you have been recently promoted to serve as Chief Information Security Officer (CISO) for a Fortune 500 organization. This organization has known brand products across the world and expects top-secret methods for safeguarding proprietary information on its recipes and product lines. The Board of Directors request that their information security strategy be upgraded to allow greater opportunities of secure cloud collaboration between suppliers and resellers of their products. Another concern they have is the recent number of hacktivist attacks that have caused the network to fail across the enterprise. Their concern extends to making sure that they have controlled methods for accessing secured physical areas within their various regional facilities.
For your new position, you will be responsible for developing standards, methods, roles, and recommendations that will set the new IT security path for the organization. The existing organization has limited experience in supporting an enhanced level of IT security; therefore, you may need to outsource certain security services.
Additionally, you may create and / or assume all necessary assumptions needed for the completion of this assignment.
Write an eight to twelve (8-12) page paper in which you provide the following deliverables:
Part 1: Organization Chart
1. Use Visio or an Open Source alternative, such as Dia, to:
a. Create an organization chart in which you:
i. Illustrate the roles that will be required to ensure design, evaluation, implementation, and management of security programs for the organization.
ii. Within your organizational chart, clearly identify the reporting structure for roles such as IT Security Compliance Officer, Security Manager, CIO, CISO, IT Security Engineer, Privacy Security Professional, and IT Procurement Specialist.
iii. List the types of resources required to fulfill the each forensic duty of the organization below each of the roles you identified.
iv. Align your organization chart to reflect the Department of Homeland Security (DHS) Essential Body of Knowledge’s three (3) areas of information security: physical security professional, privacy professional, and procurement professional. Provide comments and comparisons on how your organizational chart fosters these three (3) values.
Part 2: Request for Proposal (RFP) Plan
2. Develop a Request for Proposal (RFP) plan to solicit qualified vendors that could partner with your internal team to deliver optimum IT service delivery. The RFP Plan should ...
CSIA 413 Cybersecurity Policy, Plans, and Programs.docx
CSIA 413 Cybersecurity Policy, Plans, and Programs.docxmydrynan CSIA 413: Cybersecurity Policy, Plans, and Programs
June 2, 2019
Executive Summary
The Red Clay Renovations Employee Handbook is to give general rules about its strategies. The Employee Handbook will fill in as a guide for workers to get comfortable with Red Clay Renovations strategies for "Acceptable Use Policy for Information Technology", "Bring Your Own Device Policy " and "Digital Media Sanitization, Reuse, and Destruction Policy". Red Clay Renovations maintains whatever authority is needed to adjust the Employee Handbook to best suit the organization whenever with no earlier warning to its representatives.
Red Clay Renovations "Acceptable Use Policy for Information Technology" will characterize in subtleties what Acceptable Use is and what it's most certainly not. Every Employee will get his/her duty of the framework accounts, processing resources, organize utilization and will sign and consent to the approach before access is conceded to the system.
Red Clay Renovations "Bring Your Own Device Policy or BYOD" will name every one of the gadgets that are satisfactory as BYOD and the administration of the use of such gadgets. Every worker's gadgets must satisfy the arrangement guideline before actualizing the gadgets into Red Clay Renovation Company.
Red Clay Renovations "Digital Media Sanitization, Reuse, and Destruction Policy" will ensure that any worker of Red Clay Renovation who marked for the BYOD approach has/should sign this arrangement also. Workers need to comprehend the techniques the organization will use to clean off the BYOD.
Acceptable Use Policy
Introduction
This Acceptable Use Policy is for all Red Clay Renovation workers and supplants every single past version. All workers are liable to the terms and states of the Policy. The approach will build up satisfactory and inadmissible utilization of defending the security of information, secure and ensure PC and PCs, the use of system condition and servers, the utilization of electronic correspondences. Additionally Red Clay Renovation gathers, keeps up, and stores individual data to incorporate Mastercard’s, credit checks, building plans and illustrations, customers restorative and wellbeing information.
Red Clay Renovation must be in consistence with the accompanying: HIPPA Privacy and Security Rule, Freedom of Information Act (FOIA), PCI DSS, Privacy Act of 1977, Building Codes and Regulations. It is to the greatest advantage of the organization for all workers to comprehend the Acceptable Use Policy to settle on trustworthy choices before participating in inadmissible utilization of the approach. Any offense with the Acceptable Use Policy could conceivably cause Red Clay Renovation considerable loss of its business and its notorieties. On the off chance that any worker needs more data with this arrangement, they can reach out to the IT department directly.
Policy Content
Utilization of IT Systems
Red Clay Renovation possesses the property rights to all informati.
CSIS 100CSIS 100 - Discussion Board Topic #1One of the object.docx
CSIS 100CSIS 100 - Discussion Board Topic #1One of the object.docxmydrynan CSIS 100
CSIS 100 - Discussion Board Topic #1:
One of the objectives of this course is to enable students to differentiate between the disciplines of Information Systems, Information Technology, and Computer Science. Oftentimes, these areas overlap and are difficult to distinguish – even among professionals within the industries.
There are some distinctions that become evident, but all too frequently, people do not understand these distinctions until they are already deep within their programs of study. Consequently, many decide that it is too late to pursue a different avenue in the computing world without losing valuable time and money spent on courses that may or may not apply to a different major.
Given the importance of achieving effective planning from the beginning, your first assignment in this course is to delve into the broad areas of Information Systems, Information Technology, and Computer Science and write about your career choice in a discussion board post. This should be your thought process:
· First, define each field (i.e. IS, IT, CS). Understand the similarities and differences.
· Second, determine what jobs are available in each area.
· Third, look at the degree completion plans for each of these programs.
· Fourth, assess your own skills (e.g. Are you good in math? Do you like business? Do you like algorithms? Are you gifted at problem-solving? Do you like learning about new technology? Do you enjoy working hands-on with equipment/hardware/wires?)
· Fifth, (and most importantly) ask God what He wants you to pursue based on your talents, interests, and abilities.
· Sixth, based on your analysis above, what career do you hope to obtain after graduation, and what degree will you pursue to achieve this goal?
To facilitate your research, there are four videos in your Reading & Study folder that will help you understand the differences between the computing fields and become familiar with the job opportunities in each area. Be sure to view these videos first.
The LU Registrar’s home page has information on degree completion plans. Here is a link to all of the currently available ones in the university:
http://www.liberty.edu/academics/registrar/index.cfm?PID=2981
Be sure to look at all of the ones listed for Information Systems and Information Technology. At the time of this writing, Computer Science is only listed under residential degree plans. That does not mean that you should rule out Computer Science as a potential major. You must consider all options and listen to God’s calling upon your life. With God, all things are possible.
Discussion Board Deliverables
Main Post:
In a minimum of 300 words, create a thread in Module 1’s discussion board forum that describes the following:
1. Your desired career upon graduation
2. Why you chose this career
3. Your intended major
4. Your strengths, weaknesses, and interests
5. How the major supports your chosen career
6. How God has led you to reach your decision
7. A Bib.
Ad
More Related Content
Similar to Cryptography is the application of algorithms to ensure the confiden.docx (20)
CST 610 RANK Remember Education--cst610rank.com
CST 610 RANK Remember Education--cst610rank.comchrysanthemu49 FOR MORE CLASSES VISIT
www.cst610rank.com
CST 610 Project 1 Information Systems and Identity Management
CST 610 Project 2 Operating Systems Vulnerabilities (Windows and Linux)
CST 610 Project 3 Assessing Information System Vulnerabilities and Risk
CST 610 Project 4 Threat Analysis and Exploitation
CST 610 Project 5 Cryptography
Systems Analysis and Design 11th Edition Tilley Solutions Manual
Systems Analysis and Design 11th Edition Tilley Solutions Manualbekkiealtork Systems Analysis and Design 11th Edition Tilley Solutions Manual
Systems Analysis and Design 11th Edition Tilley Solutions Manual
Systems Analysis and Design 11th Edition Tilley Solutions Manual
Term Paper The Rookie Chief Information Security OfficerThis assi.docx
Term Paper The Rookie Chief Information Security OfficerThis assi.docxjacqueliner9 Term Paper: The Rookie Chief Information Security Officer
This assignment consists of five (5) parts:
Part 1: Organization Chart
Part 2: Request for Proposal (RFP) Plan
Part 3: Physical Security Plan
Part 4: Enterprise Information Security Compliance Program
Part 5: Risk Management Plan
Imagine that you have been recently promoted to serve as Chief Information Security Officer (CISO) for a Fortune 500 organization. This organization has known brand products across the world and expects top-secret methods for safeguarding proprietary information on its recipes and product lines. The Board of Directors request that their information security strategy be upgraded to allow greater opportunities of secure cloud collaboration between suppliers and resellers of their products. Another concern they have is the recent number of hacktivist attacks that have caused the network to fail across the enterprise. Their concern extends to making sure that they have controlled methods for accessing secured physical areas within their various regional facilities.
For your new position, you will be responsible for developing standards, methods, roles, and recommendations that will set the new IT security path for the organization. The existing organization has limited experience in supporting an enhanced level of IT security; therefore, you may need to outsource certain security services.
Additionally, you may create and / or assume all necessary assumptions needed for the completion of this assignment.
Write an eight to twelve (8-12) page paper in which you provide the following deliverables:
Part 1: Organization Chart
1. Use Visio or an Open Source alternative, such as Dia, to:
a. Create an organization chart in which you:
i. Illustrate the roles that will be required to ensure design, evaluation, implementation, and management of security programs
for the organization.
ii. Within your organizational chart, clearly identify the reporting structure for roles such as IT Security Compliance Officer,
Security Manager, CIO, CISO, IT Security Engineer, Privacy Security Professional, and IT Procurement Specialist.
iii. List the types of resources required to fulfill the each forensic duty of the organization below each of the roles you identified.
iv. Align your organization chart to reflect the Department of Homeland Security (DHS) Essential Body of Knowledge’s three (3)
areas of information security: physical security professional, privacy professional, and procurement professional. Provide
comments and comparisons on how your organizational chart fosters these three (3) values.
Part 2: Request for Proposal (RFP) Plan
2. Develop a Request for Proposal (RFP) plan to solicit qualified vendors that could partner with your internal team to deliver optimum
IT service delivery. The RFP Plan should contain qualifying criteria of potential v.
Accounting Information Systems 2nd Edition Hurt Solutions Manual
Accounting Information Systems 2nd Edition Hurt Solutions Manualbudskanadjm Accounting Information Systems 2nd Edition Hurt Solutions Manual
Accounting Information Systems 2nd Edition Hurt Solutions Manual
Accounting Information Systems 2nd Edition Hurt Solutions Manual
Solution Manual for Systems Analysis and Design, 7th Edition, Alan Dennis
Solution Manual for Systems Analysis and Design, 7th Edition, Alan Dennissipetodavan Solution Manual for Systems Analysis and Design, 7th Edition, Alan Dennis
Solution Manual for Systems Analysis and Design, 7th Edition, Alan Dennis
Solution Manual for Systems Analysis and Design, 7th Edition, Alan Dennis
CST 610 RANK Inspiring Innovation--cst610rank.com
CST 610 RANK Inspiring Innovation--cst610rank.comKeatonJennings104 This document provides instructions for 6 projects in CST 610 related to information security. Project 1 involves assessing the security of a hospital's information systems and implementing identity management solutions. It includes steps to define the infrastructure, identify threats, test password cracking tools, create a non-technical presentation, and write a technical report. Project 2 tasks the reader as a cybersecurity engineer assessing operating system vulnerabilities in a company in the oil and gas sector.
CST 610 RANK Educational Specialist--cst610rank.com
CST 610 RANK Educational Specialist--cst610rank.comVSNaipaul15 FOR MORE CLASSES VISIT
www.cst610rank.com
CST 610 Project 1 Information Systems and Identity Management CST 610 Project 2 Operating Systems Vulnerabilities (Windows and Linux) CST 610 Project 3 Assessing Information System Vulnerabilities and Risk CST 610 Project 4 Threat Analysis and Exploitation CST 610 Project 5 Cryptography CST 610 Project 6 Digital Forensics Analysis
CST 610 RANK Become Exceptional--cst610rank.com
CST 610 RANK Become Exceptional--cst610rank.comagathachristie112 This document provides instructions for 6 projects in CST 610 related to information security. Project 1 involves assessing the security of a hospital's information systems and implementing identity management solutions. It includes steps to define the infrastructure, identify threats, test password cracking tools, create a non-technical presentation, and write a technical report. Project 2 tasks the reader as a cybersecurity engineer assessing vulnerabilities in a company's Windows and Linux operating systems.
Flow-ABriefExplanation
Flow-ABriefExplanationAnthony Parziale Flow is a data science platform that allows companies to overcome obstacles to extracting insight from big data. It can scale to large datasets through its distributed architecture. Flow accepts both structured and unstructured data from various sources. It also abstracts away complex data science concepts to make the platform intuitive and easy to use. This allows companies to leverage data science without deep technical knowledge.
Securing Citizen Facing Applications Presentation Notes
Securing Citizen Facing Applications Presentation Notesedwinlorenzana As requested by folks these are the presentation notes for Securing Citizen Facing Applications. Hope these help with your IDM planning and implementation
CST 610 RANK Achievement Education--cst610rank.com
CST 610 RANK Achievement Education--cst610rank.comkopiko146 FOR MORE CLASSES VISIT
www.cst610rank.com
CST 610 Project 1 Information Systems and Identity Management CST 610 Project 2 Operating Systems Vulnerabilities (Windows and Linux) CST 610 Project 3 Assessing Information System Vulnerabilities and Risk CST 610 Project 4 Threat Analysis and Exploitation CST 610 Project
Businesses involved in mergers and acquisitions must exercise due di.docx
Businesses involved in mergers and acquisitions must exercise due di.docxdewhirstichabod Businesses involved in mergers and acquisitions must exercise due diligence in ensuring that the technology environment of the future organization is robust and adequately protects their information assets and intellectual property.. Such an effort requires time and open sharing to understand the physical locations, computing environment, and any gaps to address. Lack of information sharing can lead to a problematic systems integration and hamper the building of a cohesive enterprise security posture for the merged organization.
Often the urgency of companies undergoing a merger and acquisition (M&A) impedes comprehensive due diligence, especially in cybersecurity. This creates greater challenges for the cybersecurity engineering architect, who typically leads the cybersecurity assessment effort and creates the roadmap for the new enterprise security solution for the future organization. However, the business interest and urgency in completing the merger can also represent an opportunity for CISOs to leverage additional resources and executive attention on strategic security matters.
In this project, you will create a report on system security issues during an M&A. The details of your report, which will also include an executive briefing and summary, can be found in the final step of the project.
There are nine steps to the project. The project as a whole should take two weeks to complete. Begin with the workplace scenario and then continue to Step 1.
Deliverable
Cybersecurity for a Successful Acquisition, Slides to Support Executive Briefing
Step 1: Conduct a Policy Gap Analysis
As you begin Step 1 of your system security report on cybersecurity for mergers and acquisitions, keep in mind that the networks of companies going through an M&A can be subject to cyberattack. As you work through this step and the others, keep these questions in mind:
Are companies going through an M&A prone to more attacks or more focused attacks?
If so, what is the appropriate course of action?
Should the M&A activities be kept confidential?
Now, look at the existing security policies in regard to the acquisition of the media streaming company. You have to explain to the executives that before any systems are integrated, their security policies will need to be reviewed.
Conduct a policy gap analysis to ensure the target company's security policies follow relevant industry standards as well as local, state, and national laws and regulations. In other words, you need to make sure the new company will not inherit any statutory or regulatory noncompliance from either of the two original companies. This step would also identify what, if any, laws and regulations the target company is subject to. If those are different from the laws and regulations the acquiring company is subject to, then this document should answer the following questions:
How would you identify the differences?
How would you learn about the relevant laws and regulations?
How would .
CST 610 RANK Introduction Education--cst610rank.com
CST 610 RANK Introduction Education--cst610rank.comagathachristie265 This document outlines the requirements for 6 projects in CST 610. Project 1 involves assessing the identity management and information security of a hospital system. It includes defining the system infrastructure, threats, password cracking tools, and delivering a technical report and non-technical presentation. Project 2 involves assessing operating system vulnerabilities in a oil/gas company, including unauthorized access and configuration changes. The document provides background for several other projects involving vulnerabilities, threat analysis, cryptography, and digital forensics.
Accounting Information Systems 2nd Edition Hurt Solutions Manual
Accounting Information Systems 2nd Edition Hurt Solutions Manualjaednasamare Accounting Information Systems 2nd Edition Hurt Solutions Manual
Accounting Information Systems 2nd Edition Hurt Solutions Manual
Accounting Information Systems 2nd Edition Hurt Solutions Manual
CSEC 610 Effective Communication - snaptutorial.com
CSEC 610 Effective Communication - snaptutorial.comdonaldzs7 For more classes visit
www.snaptutorial.com
CSEC 610 Project 1 Information Systems and Identity Management
CSEC 610 Project 2 Operating Systems Vulnerabilities (Windows and Linux)
Csec 610 Education Organization-snaptutorial.com
Csec 610 Education Organization-snaptutorial.comrobertlesew5 The document discusses a cybersecurity project involving assessing vulnerabilities in a healthcare organization's information systems. Key points:
1. The student is asked to examine security of a hospital's information infrastructure and make recommendations. Assessments will include a technical report and non-technical presentation.
2. Research on the hospital's systems found password compromises, requiring analysis of identity management and access controls. The student tested password cracking tools to evaluate security.
3. Deliverables include an 8-10 slide presentation for executives, a 6-7 page technical report, and 2-3 page executive summary. Recommendations will address vulnerabilities and risks identified through the assessments.
Discussion 1 post responses.Please respond to the following.docx
Discussion 1 post responses.Please respond to the following.docxcuddietheresa Discussion 1 post responses.
Please respond to the following:
LG’s post states the following:Top of Form
"When Problem Decomposition is not Easy"
Consider the development of a simple mobile application that displays personal financial management video clips selected from a central repository. Discuss how you would systematically analyze the requirements of this application and identify its problem components.
Using a spiral process of stakeholder engagement which includes understanding the business objectives or needs the application is to provide. Next, looking at the requirements gathering process, whereby sitting with the stakeholders and customers to define those needs, understanding the assumptions and constraints, expectations, and coming up with a conceptual model both from a business and system design. Using the model as a base, the requirements will be developed into a high-level requirement set, where they are broken into the logical grouping, such as business, user, functional, non-functional, and transitional segments. Next, the requirements will be viewed with the stakeholders and customers, to address priority, need vs. want, and addressing any ambiguous requirements to gain clarity for completeness.
Explain how software engineering would help you identify the components and their interconnections.
Software engineering helps identify the components and their interconnections because the approach requires identification of components such as hardware, software, users, tasks, and databases, amongst other pieces to be determined and understand how each will interact with the others. Some boundaries must be known that similar to the scope of a project to help provide a context on what is in or out. It includes things like the activities that will be performed and the entities associated with the activities. Understanding these provide the developers in the design and development process. For example, the above mention contextual design or model can be used or provide a reference to things like architectural design, displaying these components and interconnections on paper (or visual drawing) to help articulate the boundaries, activities, and entities for the system.
Phleeger, S. L., Atlee, J. M. (2009-02-01). Software Engineering: Theory and Practice, 4th Edition [VitalSource Bookshelf version]. Retrieved from vbk://9781323089309
Pochimcherla, A., Pochimcherlahttp, A., & Pochimcherla, A. (2018, January 26). Computer science basics - Decomposition - break a problem into smaller. Retrieved from http://steamism.com/compsci-decomposition/.
SP’s post states the following:Top of Form
"When Problem Decomposition is not Easy" Please respond to the following: Consider the development of a simple mobile application that displays personal financial management video clips selected from a central repository. Discuss how you would systematically analyze the requirements of this application and identify its problem component ...
CST 610 Effective Communication - snaptutorial.com
CST 610 Effective Communication - snaptutorial.comdonaldzs7 For more classes visit
www.snaptutorial.com
CST 610 Project 1 Information Systems and Identity Management
CST 610 Project 2 Operating Systems Vulnerabilities (Windows and Linux)
CST 610 Project 3 Assessing Information System Vulnerabilities and Risk
CST 610 Exceptional Education - snaptutorial.com
CST 610 Exceptional Education - snaptutorial.comDavisMurphyA97 For more classes visit
www.snaptutorial.com
CST 610 Project 1 Information Systems and Identity Management
CST 610 Project 2 Operating Systems Vulnerabilities (Windows and Linux)
CST 610 Project 3 Assessing Information System Vulnerabilities and Risk
CST 610 Project 4 Threat Analysis and Exploitation
The Rookie Chief Information Security OfficerDue Week 10 and w.docx
The Rookie Chief Information Security OfficerDue Week 10 and w.docxteresehearn The Rookie Chief Information Security Officer
Due Week 10 and worth 200 points
This assignment consists of five (5) parts:
Part 1: Organization Chart
Part 2: Request for Proposal (RFP) Plan
Part 3: Physical Security Plan
Part 4: Enterprise Information Security Compliance Program
Part 5: Risk Management Plan
Imagine that you have been recently promoted to serve as Chief Information Security Officer (CISO) for a Fortune 500 organization. This organization has known brand products across the world and expects top-secret methods for safeguarding proprietary information on its recipes and product lines. The Board of Directors request that their information security strategy be upgraded to allow greater opportunities of secure cloud collaboration between suppliers and resellers of their products. Another concern they have is the recent number of hacktivist attacks that have caused the network to fail across the enterprise. Their concern extends to making sure that they have controlled methods for accessing secured physical areas within their various regional facilities.
For your new position, you will be responsible for developing standards, methods, roles, and recommendations that will set the new IT security path for the organization. The existing organization has limited experience in supporting an enhanced level of IT security; therefore, you may need to outsource certain security services.
Additionally, you may create and / or assume all necessary assumptions needed for the completion of this assignment.
Write an eight to twelve (8-12) page paper in which you provide the following deliverables:
Part 1: Organization Chart
1. Use Visio or an Open Source alternative, such as Dia, to:
a. Create an organization chart in which you:
i. Illustrate the roles that will be required to ensure design, evaluation, implementation, and management of security programs for the organization.
ii. Within your organizational chart, clearly identify the reporting structure for roles such as IT Security Compliance Officer, Security Manager, CIO, CISO, IT Security Engineer, Privacy Security Professional, and IT Procurement Specialist.
iii. List the types of resources required to fulfill the each forensic duty of the organization below each of the roles you identified.
iv. Align your organization chart to reflect the Department of Homeland Security (DHS) Essential Body of Knowledge’s three (3) areas of information security: physical security professional, privacy professional, and procurement professional. Provide comments and comparisons on how your organizational chart fosters these three (3) values.
Part 2: Request for Proposal (RFP) Plan
2. Develop a Request for Proposal (RFP) plan to solicit qualified vendors that could partner with your internal team to deliver optimum IT service delivery. The RFP Plan should ...
More from mydrynan (20)
CSIA 413 Cybersecurity Policy, Plans, and Programs.docx
CSIA 413 Cybersecurity Policy, Plans, and Programs.docxmydrynan CSIA 413: Cybersecurity Policy, Plans, and Programs
June 2, 2019
Executive Summary
The Red Clay Renovations Employee Handbook is to give general rules about its strategies. The Employee Handbook will fill in as a guide for workers to get comfortable with Red Clay Renovations strategies for "Acceptable Use Policy for Information Technology", "Bring Your Own Device Policy " and "Digital Media Sanitization, Reuse, and Destruction Policy". Red Clay Renovations maintains whatever authority is needed to adjust the Employee Handbook to best suit the organization whenever with no earlier warning to its representatives.
Red Clay Renovations "Acceptable Use Policy for Information Technology" will characterize in subtleties what Acceptable Use is and what it's most certainly not. Every Employee will get his/her duty of the framework accounts, processing resources, organize utilization and will sign and consent to the approach before access is conceded to the system.
Red Clay Renovations "Bring Your Own Device Policy or BYOD" will name every one of the gadgets that are satisfactory as BYOD and the administration of the use of such gadgets. Every worker's gadgets must satisfy the arrangement guideline before actualizing the gadgets into Red Clay Renovation Company.
Red Clay Renovations "Digital Media Sanitization, Reuse, and Destruction Policy" will ensure that any worker of Red Clay Renovation who marked for the BYOD approach has/should sign this arrangement also. Workers need to comprehend the techniques the organization will use to clean off the BYOD.
Acceptable Use Policy
Introduction
This Acceptable Use Policy is for all Red Clay Renovation workers and supplants every single past version. All workers are liable to the terms and states of the Policy. The approach will build up satisfactory and inadmissible utilization of defending the security of information, secure and ensure PC and PCs, the use of system condition and servers, the utilization of electronic correspondences. Additionally Red Clay Renovation gathers, keeps up, and stores individual data to incorporate Mastercard’s, credit checks, building plans and illustrations, customers restorative and wellbeing information.
Red Clay Renovation must be in consistence with the accompanying: HIPPA Privacy and Security Rule, Freedom of Information Act (FOIA), PCI DSS, Privacy Act of 1977, Building Codes and Regulations. It is to the greatest advantage of the organization for all workers to comprehend the Acceptable Use Policy to settle on trustworthy choices before participating in inadmissible utilization of the approach. Any offense with the Acceptable Use Policy could conceivably cause Red Clay Renovation considerable loss of its business and its notorieties. On the off chance that any worker needs more data with this arrangement, they can reach out to the IT department directly.
Policy Content
Utilization of IT Systems
Red Clay Renovation possesses the property rights to all informati.
CSIS 100CSIS 100 - Discussion Board Topic #1One of the object.docx
CSIS 100CSIS 100 - Discussion Board Topic #1One of the object.docxmydrynan CSIS 100
CSIS 100 - Discussion Board Topic #1:
One of the objectives of this course is to enable students to differentiate between the disciplines of Information Systems, Information Technology, and Computer Science. Oftentimes, these areas overlap and are difficult to distinguish – even among professionals within the industries.
There are some distinctions that become evident, but all too frequently, people do not understand these distinctions until they are already deep within their programs of study. Consequently, many decide that it is too late to pursue a different avenue in the computing world without losing valuable time and money spent on courses that may or may not apply to a different major.
Given the importance of achieving effective planning from the beginning, your first assignment in this course is to delve into the broad areas of Information Systems, Information Technology, and Computer Science and write about your career choice in a discussion board post. This should be your thought process:
· First, define each field (i.e. IS, IT, CS). Understand the similarities and differences.
· Second, determine what jobs are available in each area.
· Third, look at the degree completion plans for each of these programs.
· Fourth, assess your own skills (e.g. Are you good in math? Do you like business? Do you like algorithms? Are you gifted at problem-solving? Do you like learning about new technology? Do you enjoy working hands-on with equipment/hardware/wires?)
· Fifth, (and most importantly) ask God what He wants you to pursue based on your talents, interests, and abilities.
· Sixth, based on your analysis above, what career do you hope to obtain after graduation, and what degree will you pursue to achieve this goal?
To facilitate your research, there are four videos in your Reading & Study folder that will help you understand the differences between the computing fields and become familiar with the job opportunities in each area. Be sure to view these videos first.
The LU Registrar’s home page has information on degree completion plans. Here is a link to all of the currently available ones in the university:
http://www.liberty.edu/academics/registrar/index.cfm?PID=2981
Be sure to look at all of the ones listed for Information Systems and Information Technology. At the time of this writing, Computer Science is only listed under residential degree plans. That does not mean that you should rule out Computer Science as a potential major. You must consider all options and listen to God’s calling upon your life. With God, all things are possible.
Discussion Board Deliverables
Main Post:
In a minimum of 300 words, create a thread in Module 1’s discussion board forum that describes the following:
1. Your desired career upon graduation
2. Why you chose this career
3. Your intended major
4. Your strengths, weaknesses, and interests
5. How the major supports your chosen career
6. How God has led you to reach your decision
7. A Bib.
CSI Paper Grading Rubric- (worth a possible 100 points) .docx
CSI Paper Grading Rubric- (worth a possible 100 points) .docxmydrynan CSI Paper Grading Rubric- (worth a possible 100 points)
1. INTRODUCTION (10%): Identifies/summarizes the paper’s topic and states an informed
judgment about the topic.
1 2.5 5 7.5 10
DEVELOPING……………………………………................................................................DEVELOPED
Lacks an introduction that takes an overview and that states the
objectives of the paper. A brief statement of the crime and the
criminological theories that can help explain it is absent,
unfocused or very weak.
Begins with a strong introduction that lays out the crime and
its context, as well as theories that can help understand the
circumstances surrounding the crime. Also provides the
sequence of what follows clearly and concisely.
2. RESOURCES (10%): Evidence from scholarly sources and textual sources (minimum of 5 total
sources).
1 2.5 5 7.5 10
DEVELOPING……………………………………………………………………………….DEVELOPED
Lists evidence but doesn’t explain how it does or doesn’t support a
point. Lacks organization or transitions. Does not completely or
correctly identify sources of information through in-text citations
and a works cited reference page.
Provides appropriate and sufficient evidence, smoothly
synthesizes evidence from sources and clearly ties it to the
point being made. Logically organizes ideas. Uses
transitions to connect one idea to the next. Correctly
identifies all sources of information through in-text
citations and a works cited reference page.
3. BODY (50%): Formulates a coherent, logical, and thoughtful sociological analysis of the crime
being investiaged. Addressed all parts of the paper assignment.
10 20 30 40 50
DEVELOPING…………………….………………………………………………………...DEVELOPED
Shows little understanding of sociological concepts and theories
used to explain the crime being investigated. No discussion at all
of any complexities or nuances related to the topic. No integration
of source information.
Identifies the circumstances of the crime with necessary
detail to perform a rigorous sociological analysis of the
crime. Shows strong understanding of the sociological
concepts and theories discussed in the paper (for example,
other perspectives and confounding factors), and discusses
how the source information is relevant.
4. CONCLUSION (10%): Identifies and assesses conclusions and implications of the sociological
analysis of your crime of the semester; sums up the importance/sociological relevance of your paper.
1 2.5 5 7.5 10
DEVELOPING……………………………………………………………………………...DEVELOPED
Only restates verbatim what has already been said. Conclusion is
not related to the support in the paper or new information is
presented. Feels abrupt, unconnected, or changes the focus. Is not
persuasive.
Goes beyond summarizing your main points. Reader feels a
sense of closure in the paper and is persuaded by the
examination of your crime and use of sociological theories
to explain it. No new informati.
CSIA 413 Cybersecurity Policy, Plans, and ProgramsProject #4 IT .docx
CSIA 413 Cybersecurity Policy, Plans, and ProgramsProject #4 IT .docxmydrynan CSIA 413: Cybersecurity Policy, Plans, and ProgramsProject #4: IT Audit Policy and Plans Company Background & Operating Environment
Red Clay Renovations is an internationally recognized, awarding winning firm that specializes in the renovation and rehabilitation of residential buildings and dwellings. The company specializes in updating homes using “smart home” and “Internet of Things” technologies while maintaining period correct architectural characteristics. Please refer to the company profile (file posted in Week 1 > Content > CSIA 413 Red Clay Renovations Company Profile.docx) for additional background information and information about the company’s operating environment.Policy Issue & Plan of Action
The corporate board was recently briefed by the Chief Information Officer concerning the company’s IT Security Program and how this program contributes to the company’s risk management strategy. During the briefing, the CIO presented assessment reports and audit findings from IT security audits. These audits focused upon the technical infrastructure and the effectiveness and efficiency of the company’s implementation of security controls. During the discussion period, members of the corporate board asked about audits of policy compliance and assessments as to the degree that employees were (a) aware of IT security policies and (b) complying with these policies. The Chief Information Officer was tasked with providing the following items to the board before its next quarterly meeting:
(a) Issue Specific Policy requiring an annual compliance audit for IT security policies as documented in the company’s Policy System
(b) Audit Plan for assessing employee awareness of and compliance with IT security policies
a. Are employees aware of the IT security policies in the Employee Handbook?
b. Do employees know their responsibilities under those policies?
(c) Audit Plan for assessing the IT security policy system
a. Do required policies exist?
b. Have they been updated within the past year?
c. Are the policies being reviewed and approved by the appropriate oversight authorities (managers, IT governance board, etc.)?
Your Task Assignment
As a staff member supporting the CISO, you have been asked to research this issue (auditing IT security policy compliance) and then prepare an “approval draft” for a compliance policy. You must also research and draft two separate audit plans (a) employee compliance and (b) policy system audit. The audit policy should not exceed two typed pages in length so you will need to be concise in your writing and only include the most important elements for the policy. Make sure that you include a requirement for an assessment report to be provided to company management and the corporate board of directors.
· For the employee compliance assessment, you must use an interview strategy which includes 10 or more multiple choice questions that can be used to construct a web-based survey of all employees. The questions should be split.
CSI 170 Week 3 AssingmentAssignment 1 Cyber Computer CrimeAss.docx
CSI 170 Week 3 AssingmentAssignment 1 Cyber Computer CrimeAss.docxmydrynan CSI 170 Week 3 Assingment
Assignment 1: Cyber Computer Crime
Assignment 1: Cyber Computer Crime
Create a 15-slide presentation in which you:
1. Describe the responsibilities of the National Security Administration (NSA).
2. Identify the four critical needs at the state or local level of law enforcement in order to fight computer crime more effectively.
3. Explain how the U.S. Postal Service assists in the investigation and prosecution of cases involving child pornography.
4. Discuss how and why the Department of Homeland Security (DHS) consolidated so many federal offices.
5. Go to https://research.strayer.edu to locate at least three (3) quality references for this assignment. One of these must have been published within the last year.
4/15/2019 Auden, Musée des Beaux Arts
english.emory.edu/classes/paintings&poems/auden.html 1/1
Musee des Beaux Arts
W. H. Auden
About suffering they were never wrong,
The old Masters: how well they understood
Its human position: how it takes place
While someone else is eating or opening a window or just walking
dully along;
How, when the aged are reverently, passionately waiting
For the miraculous birth, there always must be
Children who did not specially want it to happen, skating
On a pond at the edge of the wood:
They never forgot
That even the dreadful martyrdom must run its course
Anyhow in a corner, some untidy spot
Where the dogs go on with their doggy life and the torturer's horse
Scratches its innocent behind on a tree.
In Breughel's Icarus, for instance: how everything turns away
Quite leisurely from the disaster; the ploughman may
Have heard the splash, the forsaken cry,
But for him it was not an important failure; the sun shone
As it had to on the white legs disappearing into the green
Water, and the expensive delicate ship that must have seen
Something amazing, a boy falling out of the sky,
Had somewhere to get to and sailed calmly on.
Pieter Brueghel, The Fall of Icarus
Oil-tempera, 29 inches x 44 inches.
Museum of Fine Arts, Brussels.
See also:
William Carlos Williams' "Landscape with the Fall of Icarus "
Return to the Poem Index
javascript:openwin('Icarus.jpg',530,330)
http://english.emory.edu/classes/paintings&poems/Williams.html
http://english.emory.edu/classes/paintings&poems/titlepage.html
1. Biographical information on Ibsen—Concluding sentence: Sub-thesis, his play and Nora.
2. Nora’s treatment by her father and Nora’s treatment by her husband Torvald.
3. Nora’s treatment by Krogstad.
4. Nora’s contrast with Christine
INTRO: Females in Conflict
Yet another voice to champion the cause of inequality of the sexes is Henrik Ibsen.
Writing at the end of the nineteenth century in Victorian Norway, his play A Doll House utilizes
the format of a playwright to convey through the use of evolving characters different political and
social messages. When analyzing A Doll House’s protagonist, Nora, her interactions with the
other characters.
CSE422 Section 002 – Computer Networking Fall 2018 Ho.docx
CSE422 Section 002 – Computer Networking Fall 2018 Ho.docxmydrynan CSE422 Section 002 – Computer Networking
Fall 2018
Homework 2 – 50 points
Sockets (10 points)
1. For a client-server application over TCP, why must the server program be executed before the
client program?
2. For a client-server application over UDP, why may the client program be executed before the
server program?
3. The UDP server shown in the course slides needed only one socket, whereas the TCP server
needed two sockets. Why?
4. If the TCP server were to support N simultaneous connections, each from a different client host,
how may sockets would the TCP server need?
5. You are creating an event logging service that will be handling event messages from multiple
remote clients. This service can suffer delays in message delivery and even the loss of some
event messages. Would you implement this using TCP or UDP? Why?
The HTTP GET message (10 Points)
Consider the figure below, where a client is sending an HTTP GET message to a web server,
gaia.cs.umass.edu.
Suppose the client-to-server HTTP GET message is the following:
GET /kurose_ross/interactive/quotation1.htm HTTP/1.1
Host: gaia.cs.umass.edu
Accept: text/plain, text/html, image/gif, image/jpeg, audio/basic,
audio/vnf.wave, video/mp4, video/wmv, application/*, */*
Accept-Language: en-us, en-gb;q=0.5, en;q=0.1, fr, fr-ch, zh, cs
If-Modified-Since: Wed, 10 Jan 2018 13:13:03 -0800
User Agent: Mozilla/5.0 (Windows NT 6.1; WOW64) AppleWebKit/535.11 (KHTML,
like Gecko) Chrome/17.0.963.56 Safari/535.11
Answer the following questions:
1. What is the name of the file that is being retrieved in this GET message?
2. What version of HTTP is the client running?
CSE422 Section 002 – Computer Networking
Fall 2018
3. What formats of text, images, audio, and video does the client browser prefer to receive?
[Note: for this and the following questions on browser media and language preferences, you
will need to do a bit of additional reading on the Web. Here is a good place to start.]
4. What do the strings "application/*" and "*/*" signify in the Accept: header?
5. What languages is the browser indicating that it is willing to accept? [Note: you can look at
your own browser preferences to get a listing of language codes.]
6. What is the meaning of the "relative quality factor," q, associated with the various version of
English? [Note: Here is a good place to start. See also [RFC 2616].]
7. What is the client's preferred version of English? What is the browser's least preferred
version of English?
8. Does the browser sending the HTTP message prefer Swiss French over traditional French?
Explain.
9. Does the client already have a (possibly out-of-date) copy of the requested file? Explain. If
so, approximately how long ago did the client receive the file, assuming the GET request has
just been issued?
10. What is the type of client browser and the client's operating system? [Note: To answer this,
you'll need to understan.
CSCI 132 Practical Unix and Programming .docx
CSCI 132 Practical Unix and Programming .docxmydrynan CSCI
132:
Practical
Unix
and
Programming
Adjunct:
Trami
Dang
Assignment
4
Fall
2018
Assignment 41
This set of exercises will strengthen your ability to write relatively simple shell scripts
using various filters. As always, your goals should be clarity, efficiency, and simplicity. It
has two parts.
1. The background context that was provided in the previous assignment is repeated here
for your convenience. A DNA string is a sequence of the letters a, c, g, and t in any
order, whose length is a multiple of three2. For example, aacgtttgtaaccagaactgt
is a DNA string of length 21. Each sequence of three consecutive letters is called a codon.
For example, in the preceding string, the codons are aac, gtt, tgt, aac, cag, aac,
and tgt.
Your task is to write a script named codonhistogram that expects a file name on the
command line. This file is supposed to be a dna textfile, which means that it contains
only a DNA string with no newline characters or white space characters of any kind; it is
a sequence of the letters a, c, g, and t of length 3n for some n. The script must count the
number of occurrences of every codon in the file, assuming the first codon starts at
position 13, and it must output the number of times each codon occurs in the file, sorted
in order of decreasing frequency. For example, if dnafile is a file containing the dna
string aacgtttgtaaccagaactgt, then the command
codonhistogram dnafile
should produce the following output:
3 aac
2 tgt
1 cag
1 gtt
because there are 3 aac codons, 2 tgt, 1 cag, and 1 gtt. Notice that frequency comes
first, then the codon name.
1
This is licensed under the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International
License. To view a copy of this license, visit http://creativecommons.org/licenses/by-nc-sa/4.0/.
2
This is really just a simplification to make the assignment easier. In reality, it is not necessarily a
multiple of 3.
3
Tho.
CSCI 714 Software Project Planning and EstimationLec.docx
CSCI 714 Software Project Planning and EstimationLec.docxmydrynan This document provides an overview of work breakdown structures (WBS) and their role in project planning and management. It discusses approaches to developing WBS, basic principles for creating effective WBS, and the purpose of WBS for cost estimating, budgeting, resource planning, and other project functions. Specific topics covered include defining the scope of work, developing a hierarchy of deliverables and tasks, and using a WBS to improve scheduling, tracking, and managing changes to a project.
CSCI 561Research Paper Topic Proposal and Outline Instructions.docx
CSCI 561Research Paper Topic Proposal and Outline Instructions.docxmydrynan CSCI 561
Research Paper: Topic Proposal and Outline Instructions
The easiest approach for selecting a topic for your paper might be to review the various subject areas covered in the course readings (i.e., search the bibliographies of the textbooks). Although the chosen topic must relate directly to the general subject area of this course, you are not limited to the concepts, techniques, and technologies specifically covered in this course.
Each Topic Outline must include the following 3 items:
1. A brief (at least 3–4 bullets with 1–2 sentences per bullet) overview of the research topics of your paper – you will need to address these in the actual paper. This will be titled “Research Objectives”.
2. A list of at least 3 questions (in a numbered list) you intend your research to ask and hopefully answer. These must be questions that will require you to draw conclusions from your research. These must not be questions to answer your research objectives. This section will be titled “Questions”
3. At least 3 initial research sources, 1 of which is an academic journal or other peer reviewed source. These should match APA formatting of sources.
Example formats for Topic Outlines (an example, not a template):
Research Objectives
· Briefly describe the overall concept of system integration.
· Discuss the traditional approach of big-bang integration including the major advantages and disadvantages of this approach.
· Discuss the traditional approaches of top-down and bottom-up integration and their major advantages and disadvantages.
· Discuss the traditional approach of mixed integration, combining the desirable advantages from the top-down and bottom-up integration approaches.
Questions
1. Why is system integration an important step in the software development process?
2. Why has big-bang integration not survived as a useful testing method?
3. Why have top-down and bottom-up integration not been replaced by more modern methods?
4. Why would you use mixed integration all the time rather than sometimes using top-down and bottom-up integration exclusively?
References
1. Herath, T. , & Rao, H. (2012). Encouraging information security behaviors in the best organizations: Role of penalties, pressures, and potential effectiveness. Descision Support Systems, 47(2), 154-165.
2. Testing Computer Software, 2nd Edition, by Cem Kaner
3. Anderson, R. (2008). Security Engineering: A Guide to Building Dependable Distributed Systems (2nd ed.). Cambridge, MA: Wiley.
During your research, if any substantial changes to your objective(s) are necessary, or a topic change is required, communicate with your instructor via email.
The Policy Research Paper: Topic Proposal and Outline is due by 11:59 p.m. (ET) on Sunday of Module/Week 2.
The Technology Research Paper: Topic Proposal and Outline is due by 11:59 p.m. (ET) on Sunday of Module/Week 5.
Quantitative Reasoning 2 Project
Shawn Cyr
MTH/216
01/16/2019
Mr. Kim
Running head: QUANTITATIVE REASONING 2 PROJEC.
CSCI 561 DB Standardized Rubric50 PointsCriteriaLevels of .docx
CSCI 561 DB Standardized Rubric50 PointsCriteriaLevels of .docxmydrynan This document outlines a rubric for grading student discussion posts and replies in an online course. It evaluates students on content, structure, and integration of biblical worldview. For the original post, students can earn up to 19 points for content and 5 points for structure. For each of two required replies, students can earn up to 8 points for content and 5 points for structure. Higher scores are given for more thorough engagement with course materials, critical analysis, and APA formatting.
CryptographyLesson 10© Copyright 2012-2013 (ISC)², Inc. Al.docx
CryptographyLesson 10© Copyright 2012-2013 (ISC)², Inc. Al.docxmydrynan Cryptography
Lesson 10
© Copyright 2012-2013 (ISC)², Inc. All Rights Reserved.
For Personal Use of (ISC)2 Seminar Attendee Only.
Contents May Not Be Copied or Otherwise Distributed Under Any Circumstances
© (ISC)2 ® 2010, All Rights Reserved
For Personal Use of (ISC)2 Seminar Attendee Only
Contents May Not Be Copied or Otherwise Distributed Under Any Circumstances
CISSP-ISSEP® Bootcamp Seminar v10
Technical Management
Public Key Infrastructure
Chapter 7
© Copyright 2012-2013 (ISC)², Inc. All Rights Reserved.
For Personal Use of (ISC)2 Seminar Attendee Only.
Contents May Not Be Copied or Otherwise Distributed Under Any Circumstances
2
Key Management
© Copyright 2012-2013 (ISC)², Inc. All Rights Reserved.
For Personal Use of (ISC)2 Seminar Attendee Only.
Contents May Not Be Copied or Otherwise Distributed Under Any Circumstances
3
2
Usage Control
5
6
7
Storage
Recovery
Escrow
8
Zeroization
1
3
Creation
Change and Expiry
4
Distribution
Creation
Automated key generation
Truly random
Suitable length
Key encrypting keys
© Copyright 2012-2013 (ISC)², Inc. All Rights Reserved.
For Personal Use of (ISC)2 Seminar Attendee Only.
Contents May Not Be Copied or Otherwise Distributed Under Any Circumstances
4
Key Usage Control
Management has a vested interest in what activities or content may be hidden in cryptographically protected communications or files
They may create a policy that allows management to audit or decrypt encrypted data at their discretion
© Copyright 2012-2013 (ISC)², Inc. All Rights Reserved.
For Personal Use of (ISC)2 Seminar Attendee Only.
Contents May Not Be Copied or Otherwise Distributed Under Any Circumstances
5
Key Change and Expiry
In any environment, plans should be made to update keys periodically
Generating symmetric keys is easy, but delivering them is expensive since you will be delivering [N*(N-1)]/2 keys to N users
Expiry
Expiry ensures that a key is never overused
Expiry based upon:
Amount of traffic
Amount of traffic over time
Time-in-use
© Copyright 2012-2013 (ISC)², Inc. All Rights Reserved.
For Personal Use of (ISC)2 Seminar Attendee Only.
Contents May Not Be Copied or Otherwise Distributed Under Any Circumstances
6
Distribution
Out of band
Public key encryption
Secret key construction
Secret key delivery
Key Distribution Centers (KDC)
Certificates
© Copyright 2012-2013 (ISC)², Inc. All Rights Reserved.
For Personal Use of (ISC)2 Seminar Attendee Only.
Contents May Not Be Copied or Otherwise Distributed Under Any Circumstances
7
Storage
Trusted hardware
Smartcards
© Copyright 2012-2013 (ISC)², Inc. All Rights Reserved.
For Personal Use of (ISC)2 Seminar Attendee Only.
Contents May Not Be Copied or Otherwise Distributed Under Any Circumstances
8
Recovery
Split knowledge
Multi-party key recovery (MPR)
© Copyright 2012-2013 (ISC)², Inc. All Rights Reserved.
For Personal Use of (ISC)2 Seminar Attendee Only.
Contents May Not Be Copied or Otherwise.
CSCI 352 - Digital Forensics Assignment #1 Spring 2020 .docx
CSCI 352 - Digital Forensics Assignment #1 Spring 2020 .docxmydrynan CSCI 352 - Digital Forensics
Assignment #1
Spring 2020
Due Date: Tuesday, February 25, 2020
Total Points: 100
You are going to write a Python program that represents a command line version of a hexadecimal editor.
This program will be similar to the Linux built-in command line hexadecimal editors such as xxd and
hexdump.
The program will first ask the user to enter the name of any file you want to read. Your program will then
print the binary contents of the file into the standard output (screen). The output will be divided into three
main sections: the offset values in decimal, sixteen space-separated hexadecimal bytes, followed by the
same sixteen bytes but in ASCII value. The figure below shows an example of the first 48 bytes of an
output, and the three different sections:
Notice that in the 2nd section there a space between the 8th and 9th byte. Each output line represents 16 bytes.
The first column shows the decimal offset, where the first byte from the first line represents the 0th byte;
the second line starts with byte 16th and so on. The final section only shows the printable ASCII characters.
These are the ASCII characters can be printed on the screen (usually they are the characters with ASCII
values between 0x20 and 0x7EThe rest of the unprintable bytes are replaced by a period ('.'). The following
built-in Python functions will be useful in this situation: chr, hex, ord. More information about these
functions can be found here: https://docs.python.org/3/library/functions.html
What to hand in
Submit your program electronically through D2L. Please hand in the Python program (.py file or.ipynb)
offset
Hexadecimal Values
ASCII Values
https://docs.python.org/3/library/functions.html
© 2016 by Pearson Education, Inc.
*
THINK CRITICALLY, FACIONE & GITTENS
Chapter 12
Comparative Reasoning
© 2016 by Pearson Education, Inc.
© 2016 by Pearson Education, Inc.
THINK CRITICALLY, FACIONE & GITTENS
Learning OutcomesExplain comparative reasoning and how it impacts our understanding of novel situationsApply correctly the five criteria for the evaluation of comparative reasoningDescribe the uses, benefits, and risks of comparative reasoning
Learning OutcomesChapter first explains comparative reasoning and how it impacts our understanding of novel situations.It then applies correctly the five criteria for the evaluation of comparative reasoning.The chapter finally describes the uses, benefits, and risks of comparative reasoning.
*
© 2016 by Pearson Education, Inc.
THINK CRITICALLY, FACIONE & GITTENS
Chapter Opening Video
Chapter Opening VideoThe video talks about comparative reasoning.It shows the importance of identifying and evaluating the comparative reasoning and the analogies.
*
© 2016 by Pearson Education, Inc.
THINK CRITICALLY, FACIONE & GITTENS
This is Like That—Recognizing Comparative ReasoningOur minds crave patternsComparative, ideological, and emp.
CSCE 1040 Homework 2 For this assignment we are going to .docx
CSCE 1040 Homework 2 For this assignment we are going to .docxmydrynan CSCE 1040 Homework 2
For this assignment we are going to design a system to schedule drivers and
passengers for rides in the Mean Green EagleLift system
For this we will need the following entities, plus collections for each of the
entities: Driver, Passenger and Ride.
The data for a Driver will contain at least the following:
Driver Id (6 digits)
Driver Name (20 characters each for first and last name)
Vehicle Capacity ( integer value for number of passengers)
Handicapped Capable (Boolean)
Vehicle Type (compact 2 dr, sedan 4dr, SUV, Van, other)
Driver Rating (floating point value 0-5)
Available (Boolean)
Pets allowed (Boolean)
Notes (String – could include days and hours of operation, coverage area, etc)
You may add other data needed for your implementation as well as
you will need accessor and mutator functions for the data.
The data for a Passenger will contain at least:
Name (e.g. Fred Smith)
ID number (6 digits e.g. 123456)
Payment preference (cash, credit, debit)
Handicapped (Boolean)
Default rating required (floating point)
Has pets (Boolean)
You may add other data needed for your implementation as well as
you will need accessor and mutator functions for the data.
The data for a Ride (The transaction entity) will contain at least
the following:
Ride ID (8 digit value auto assigned)
Pickup location (string)
Pickup Time (Time value)
Drop-off location (string)
Size of party (whole number)
Includes pets (Boolean)
Drop-off time (Time value – entered at completion)
Status (Active, Completed, Cancelled)
Rating by customer (floating point value)
You may add other data needed for your implementation as well as
you will need accessor and mutator functions for the data.
For the collections of each of the 3 Entity Classes identified above you
will need to include the ability to:
Add
Edit
Delete
Search/Find based on appropriate criteria
Print a list of all entries in the specific collection
Print the details for a single entity (do a find first)
Print a list of all Rides for a particular Passenger
Print a list of all Rides for a Particular Driver
Print a list of all Active (future and current) Rides, all completed rides and all
cancelled rides
for the Rides collection when you add a Ride you will need to verify that
a. the Driver selected is available during the defined time period
b. the Driver selected has number of seats sufficient for the passengers
c. The Driver has the appropriate pet policy
d. The Driver has required Handicapped capability
e. the driver has at least the minimum rating preferred by the Passenger
Note that a particular Driver could have multiple assignments
as long as they do not conflict with dates or times. For this assignment
you do not need to worry about verifying availability based on starting and
ending locations.
You will also need to provide in the Rides collection the ability to
print an assignment schedule for a particular .
CSCE509–Spring2019Assignment3updated01May19DU.docx
CSCE509–Spring2019Assignment3updated01May19DU.docxmydrynan CSCE 509 – Spring 2019
Assignment 3 // updated 01May19
DUE: May 11, 2019 at 5 p.m.
• Two data sets available on Moodle
o {concaveData.npy, concaveTarget.npy}
o {testData.npy, testTarget.npy}
• Write TensorFlow code to perform DNN classification with three (3) classes
• Use concave*.npy for training
• Use test*.npy for test
• Data is the data matrix; Target is the labeled targets from {0, 1, 2}
• Do each of the following steps. For each step: Note the accuracy of the classification using
the test data set. Discuss the results.
1. Write TensorFlow code to perform DNN classification using default settings. Define your
own architecture with two hidden layers. Calculate the number of parameters in your
network. Do not let the number of parameters exceed the number of input samples in
concave*.npy
2. Use one or two additional layers compared to (1) but be sure that the number of
parameters do not exceed the number of input samples. Which has better accuracy
performance? Or are they about the same?
3. Write Python code to read in the data sets. Add a large constant (such as “509” or “5090”)
to each input feature. Write the data sets as files, to be read in as input sets. Repeat the
classification using the new input files with the architecture that has better performance
in (1) or (2). What is the accuracy performance for the same number of epochs? If the
accuracy performance is about the same, does it converge faster or slower or about the
same?
4. Use the given data sets as used in (1) and (2). Use either of the two architectures. Change
the tf.layers.dense() function initlialization to He initialization by using the
variance_scaling_initializer() function:
he_init = tf.contrib.layers.variance_scaling_initializer(factor=2.0)
hidden1 = tf.layers.dense(X, n_hidden1, activation=tf.nn.relu,
kernel_initializer=he_init, name=”hidden1”)
# do the same for other hidden layers
What is the accuracy performance? Compare to either (1) or (2).
5. Take the architecture from either (1) or (2). Replace the relu activation function by the
exponential linear unit (ELU). In the tf.layers.dense function, use
activation=tf.nn.elu
What is the accuracy performance? Compare to either (1) or (2) and to (4).
6. Perform batch normalization on either (1) or (2) as follows. We want to zero-center and
normalize the inputs to the activation function of each layer by learning the mean and
scales of the inputs for each layer. Modify the Python code as follows:
X = tf.placeholder(tf.float32, shape=(None, n_inputs), name=”X”)
training = tf.placeholder_with_default(False, shape=(), name=”training”)
Then in defining the hidden layers:
hidden1 = tf.layers.dense(X, n_hidden1, name=”hidden1”)
batchnorm1 = tf.layers.batch_normalization(hidden1, training=training,
momentum=0.9)
bn1_act = tf.nn.elu(batchnorm1)
hidden2 = tf.layers.dense(bn1_act, n_hidden2, name=”hidden2”)
batchnorm2 = tf.layers.batch_normalization.
CSCI 2033 Elementary Computational Linear Algebra(Spring 20.docx
CSCI 2033 Elementary Computational Linear Algebra(Spring 20.docxmydrynan CSCI 2033: Elementary Computational Linear Algebra
(Spring 2020)
Assignment 1 (100 points)
Due date: February 21st, 2019 11:59pm
In this assignment, you will implement Matlab functions to perform row
operations, compute the RREF of a matrix, and use it to solve a real-world
problem that involves linear algebra, namely GPS localization.
For each function that you are asked to implement, you will need to complete
the corresponding .m file with the same name that is already provided to you in
the zip file. In the end, you will zip up all your complete .m files and upload the
zip file to the assignment submission page on Gradescope.
In this and future assignments, you may not use any of Matlab’s built-in
linear algebra functionality like rref, inv, or the linear solve function A\b,
except where explicitly permitted. However, you may use the high-level array
manipulation syntax like A(i,:) and [A,B]. See “Accessing Multiple Elements”
and “Concatenating Matrices” in the Matlab documentation for more informa-
tion. However, you are allowed to call a function you have implemented in this
assignment to use in the implementation of other functions for this assignment.
Note on plagiarism A submission with any indication of plagiarism will be
directly reported to University. Copying others’ solutions or letting another
person copy your solutions will be penalized equally. Protect your code!
1 Submission Guidelines
You will submit a zip file that contains the following .m files to Gradescope.
Your filename must be in this format: Firstname Lastname ID hw1 sol.zip
(please replace the name and ID accordingly). Failing to do so may result in
points lost.
• interchange.m
• scaling.m
• replacement.m
• my_rref.m
• gps2d.m
• gps3d.m
• solve.m
1
Ricardo
Ricardo
Ricardo
Ricardo
�
The code should be stand-alone. No credit will be given if the function does not
comply with the expected input and output.
Late submission policy: 25% o↵ up to 24 hours late; 50% o↵ up to 48 hours late;
No point for more than 48 hours late.
2 Elementary row operations (30 points)
As this may be your first experience with serious programming in Matlab,
we will ease into it by first writing some simple functions that perform the
elementary row operations on a matrix: interchange, scaling, and replacement.
In this exercise, complete the following files:
function B = interchange(A, i, j)
Input: a rectangular matrix A and two integers i and j.
Output: the matrix resulting from swapping rows i and j, i.e. performing the
row operation Ri $ Rj .
function B = scaling(A, i, s)
Input: a rectangular matrix A, an integer i, and a scalar s.
Output: the matrix resulting from multiplying all entries in row i by s, i.e. per-
forming the row operation Ri sRi.
function B = replacement(A, i, j, s)
Input: a rectangular matrix A, two integers i and j, and a scalar s.
Output: the matrix resulting from adding s times row j to row i, i.e. performing
the row operatio.
CSCE 3110 Data Structures & Algorithms Summer 2019 1 of .docx
CSCE 3110 Data Structures & Algorithms Summer 2019 1 of .docxmydrynan CSCE 3110 Data Structures & Algorithms Summer 2019
1 of 12
Project 3 – Hopscotch Hash Table
Due: 11:59 PM on Friday, June 21, 2019
PROGRAM DESCRIPTION
In this C++ program, you will implement an efficient hopscotch hash table that improves
on the classic linear probing algorithm. Specifically, you will use a TABLE_SIZE = 17
and use the single hash function ℎ(𝑥) = 𝑥 mod 𝑇𝐴𝐵𝐿𝐸_𝑆𝐼𝑍𝐸. You shall resolve
collisions using linear probing where the maximal length of the probe sequence (i.e.,
distance away from the original hash location) is bound by the hopscotch hash
algorithm where MAX_DIST = 4.
You shall support the following five operations that are menu driven:
1. Insert Value
2. Delete Value
3. Search Value
4. Output Table
5. Exit Program
All data shall be entered through the console and consist of integers. You may assume
valid data, though data may be out of range (i.e., zero, negative integers or possibly out
of range of menu options). Your algorithm to find the next available slot is bound by the
end of the table so that the linear probe sequence need not be circular. In other words,
you do not need to wrap around beyond the last element of the array to the first for
either the linear probe or the bound for the hopscotch algorithm. For example, if the
user attempts to insert 33 which hashes to index position 16 (i.e., 33 % TABLE_SIZE) in
the array, but an element already exists at that location, the insert will fail as there are
no more array locations beyond this to attempt to insert the element.
You must keep an item array containing the elements as well as an associated hop
array that indicates positions in the item array that are occupied with items that hash to
the same value. You should also provide specific feedback to the user on successful
operations or when an operation failed. The search should utilize the hash value and
then perhaps a linear probe of MAX_DIST – 1 index locations, but you should not
simply search the entire array to accomplish this operation. Be sure to handle the case
that requires multiple hops (i.e., using recursion) to get the value within the correct
range.
REQUIREMENTS
• Your code should be well documented in terms of comments. For example, good
comments in general consist of a header (with your name, course section, date,
and brief description), comments for each variable, and commented blocks of
code.
• Your program will be graded based largely on whether it works correctly on the
CSE machines (e.g., cse01, cse02, …, cse06), so you should make sure that
your program compiles and runs on a CSE machine.
aemalki
aemalki
aemalki
aemalki
aemalki
aemalki
aemalki
aemalki
CSCE 3110 Data Structures & Algorithms Summer 2019
2 of 12
• You should contact your instructor if there is any question about what is being
asked for.
• This is an individual programming assignment that must be the sole work of the
individual student. Any in
CSCI 340 Final Group ProjectNatalie Warden, Arturo Gonzalez, R.docx
CSCI 340 Final Group ProjectNatalie Warden, Arturo Gonzalez, R.docxmydrynan CSCI 340 Final Group Project
Natalie Warden, Arturo Gonzalez, Ricky Gaji
Introduction
As our world continues to rely on technology to store our information, issues concerning data storage and organization will arise
Association of Computing Machinery (ACM) has asked us to prepare a database through which they can easily and effectively access this information
In this project we have created a tier system of entities, established the relationships between them, and decreased redundancy by eliminating repeating attributes
Responsibility MatrixTask/PersonNatalieArturoRickyAnalysisMSER-DiagramSMRedundancySSSSQLMSLogical DesignMAnalysis DocMRelationships DocMReadMe DocSMDatabaseMSS
Software Used:
Analysis:
Google Docs - helped to bring the group together and organize all our information to make sure we were on the same page.
Google Slides- served as the main platform in which to come up with our presentation and visualize what we are going to do.
Draw.io- used to build our many ER diagrams
Database Design:
x10 web hosting- hosted our website and had the tools necessary to get started on the database
phpMyAdmin- here we created our database tables and made sure all the attribute’s data types and entity’s primary key, foreign keys, and attributes were correct.
mySQL Databases- used as relational database management system
generatedata.com-used to create “dummy” data to incorporate in the SQL testing
Analysis and Findings
Problems/Results
Final Decision
Decided to create entities for leadership
Took inspiration from University database setup
ER-Diagram
Tables
Tables
Building the ACM Database
Populated Tables
SQL/RESULTS
3
Name
Course
Date
Instructor
Benchmark - Gospel Essentials
In at least 150 words, complete your introductory paragraph with a thesis statement in which you will address each of the following six sections with at least one paragraph each.
God
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Humanity
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Jesus
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Restoration
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Analysis
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Reflection
In at least 150 words, respond thoroughly to the questions in the assignment. Be sure to include citations.
Conclusion
In at least 150 words, synthesize the main points, pulling the ideas of the paper together. Be sure to include citations.
References
Author, A. A., .
CSC-321 Final Writing Assignment In this assignment, you .docx
CSC-321 Final Writing Assignment In this assignment, you .docxmydrynan CSC-321 Final Writing Assignment
In this assignment, you will write an article about a recent cybersecurity attack (of your choosing). The
article will include the following components:
1) Executive summary: a 1-page executive summary highlighting the potential impact and likelihood
of a similar attack against a fictional company XYZ. XYZ should be a company in a similar field
to the company attacked by the vulnerability.
a. Audience: A C-level business executive. Do not assume they will have any technical
knowledge but assume they are very interested in the economic impact of things.
b. Purpose: Provide a summary that they will use to make business decisions from. You
need to be convincing that the cost of security makes business sense.
2) Technical report: a 3-page technical report including the following topics: Introduction,
Vulnerability(s) exploited, financial impact (if applicable), social impact (if applicable),
technological impact (if applicable), political impact (if applicable), patches available/needed to
prevent these vulnerabilities (if applicable), human training needed (if applicable), comparison to
similar vulnerabilities in the past 20 years, assessment of how common the vulnerability is, and
recommendations for company XYZ to protect itself from similar vulnerabilities.
a. Audience: A Technical manager and his engineering staff. Assume a good knowledge of
computer science, engineering, and math but no specific security knowledge.
b. Purpose: Provides information to engineers at XYZ about the attack and how to prevent a
similar one against XYZ.
3) Press release: a 2-page article for popular consumption (think wired). This should explain the
vulnerability, protection, and potential impact to general audiences (users and share-holders).
a. Format: 2-page wired article. Be informative, objective, and entertaining
b. Audience: General public who are interested in technology but may have never taken a
computer science course and, almost certainly, have never taken a computer security
course.
c. Purpose: To express your understanding to a broad audience.
Choosing your topic
Your article must be about a recent computer security exploit with real world impacts. You must get your
topic approved in lab or by email before April 22nd.
Format: IEEE conference formatting with 12pt font. All page counts are precise. You should not go
over and should be no more than ¼ column under.
Press release (2 pages) Draft: Apr, 29 Due: May, 13
Lastly you are to write a two-page article for a national technical magazine, think Wired. This article is
intended for a general audience who is interested in technology but does not have formal technical
backgrounds. This article should explain the attack, its impact, how it is mitigated, and what (if
anything) the general audience should do. This article should be informative, objective, and entertaining.
Executive Summary (1 page) .
CSc3320 Assignment 6 Due on 24th April, 2013 Socket programming .docx
CSc3320 Assignment 6 Due on 24th April, 2013 Socket programming .docxmydrynan CSc3320 Assignment 6 Due on 24th April, 2013
Socket programming code (server.c & client.c) demoed in class implement a server-client communication by socket. The server sets up a socket and waits for communication request from a client. The client tries to connect to server and asks user for a message to send to server after the connection established. Server then accepts the communication, reads the message, displays it and send confirmation message to the client. The client reads confirmation from server and displays it too.
Please modify the server.c such that the server can carry out the same communication with
3
clients. It creates a child process (fork()) every time a communication request from one client arrives and continues to wait to serve the next client. This child process takes care of reading message/sending confirmation from/to the corresponding client and terminates with the exit code 0. After serving all 3 clients, the server needs to accept (wait()) termination of all child processes it created. Server prints out message about the child process ID and the exit code every time it accepts the termination of a child process (eg. “A child with PID 1959 terminated with exit code 0”).
Client.c
#include
#include
#include
#include
#include
#include
#include
#include
void error(const char *msg)
{
perror(msg);
exit(0);
}
int main(int argc, char *argv[])
{
int sockfd, portno, n;
struct sockaddr_in serv_addr;
struct hostent *server;
char buffer[256];
if (argc < 3) {
fprintf(stderr,"usage %s hostname port\n", argv[0]);
exit(0);
}
portno = atoi(argv[2]);
sockfd = socket(AF_INET, SOCK_STREAM, 0);
if (sockfd < 0)
error("ERROR opening socket");
server = gethostbyname(argv[1]);
if (server == NULL) {
fprintf(stderr,"ERROR, no such host\n");
exit(0);
}
bzero((char *) &serv_addr, sizeof(serv_addr));
serv_addr.sin_family = AF_INET;
bcopy((char *)server->h_addr,
(char *)&serv_addr.sin_addr.s_addr,
server->h_length);
serv_addr.sin_port = htons(portno);
//printf("h_addr: %s\n", inet_ntoa(serv_addr.sin_addr));
if (connect(sockfd,(struct sockaddr *) &serv_addr,sizeof(serv_addr)) < 0)
error("ERROR connecting");
printf("Please enter the message: ");
bzero(buffer,256);
fgets(buffer,255,stdin);
n = write(sockfd,buffer,strlen(buffer));
if (n < 0)
error("ERROR writing to socket");
bzero(buffer,256);
n = read(sockfd,buffer,255);
if (n < 0)
error("ERROR reading from socket");
printf("%s\n",buffer);
close(sockfd);
return 0;
}
Server.c
/* A simple server in the internet domain using TCP
The port number is passed as an argument */
#include
#include
#include
#include
#include
#include
#include
#include
void error(const char *msg)
{
perror(msg);
.
Cryptography KeysCryptography provides confidentiality, inte.docx
Cryptography KeysCryptography provides confidentiality, inte.docxmydrynan Cryptography Keys
Cryptography provides confidentiality, integrity authentication, and nonrepudiation for sensitive information while it is stored (at rest), traveling across a network (in transit), and existing in memory (in use). Cryptography keys play in the world of data security and are an extremely important security technology embedded in many of the security controls used to protect information from unauthorized visibility and use.
Let’s say you work for one of the following types of industry:
Manufacturing
Government
Research
Service
Consulting
After you choose one of the above, consider the three types of algorithms commonly used today. Which do you find to be the most secure? Which is the most complex? Which did you struggle to understand? What do you think you need to know as a manager in order to choose the right security systems for your company? Be sure to fully develop your responses and support your opinion with reasons from your study this week.
.
Ad
Recently uploaded (20)
MCQ PHYSIOLOGY II (DR. NASIR MUSTAFA) MCQS)
MCQ PHYSIOLOGY II (DR. NASIR MUSTAFA) MCQS)Dr. Nasir Mustafa MCQ PHYSIOLOGY II (DR. NASIR MUSTAFA) MCQS)
Botany Assignment Help Guide - Academic Excellence
Botany Assignment Help Guide - Academic Excellenceonline college homework help Struggling with your botany assignments? This comprehensive guide is designed to support college students in mastering key concepts of plant biology. Whether you're dealing with plant anatomy, physiology, ecology, or taxonomy, this guide offers helpful explanations, study tips, and insights into how assignment help services can make learning more effective and stress-free.
📌What's Inside:
• Introduction to Botany
• Core Topics covered
• Common Student Challenges
• Tips for Excelling in Botany Assignments
• Benefits of Tutoring and Academic Support
• Conclusion and Next Steps
Perfect for biology students looking for academic support, this guide is a useful resource for improving grades and building a strong understanding of botany.
WhatsApp:- +91-9878492406
Email:- [email protected]
Website:- https://onlinecollegehomeworkhelp.com/botany-homework-help
BÀI TẬP BỔ TRỢ TIẾNG ANH 9 THEO ĐƠN VỊ BÀI HỌC - GLOBAL SUCCESS - CẢ NĂM (TỪ...
BÀI TẬP BỔ TRỢ TIẾNG ANH 9 THEO ĐƠN VỊ BÀI HỌC - GLOBAL SUCCESS - CẢ NĂM (TỪ...Nguyen Thanh Tu Collection https://app.box.com/s/yfwqwcillls0z4p34958pr8nj0b4udyr
Unit 5 ACUTE, SUBACUTE,CHRONIC TOXICITY.pptx
Unit 5 ACUTE, SUBACUTE,CHRONIC TOXICITY.pptxMayuri Chavan Unit 5 ACUTE, SUBACUTE,CHRONIC TOXICITY.pptx
How to Share Accounts Between Companies in Odoo 18
How to Share Accounts Between Companies in Odoo 18Celine George In this slide we’ll discuss on how to share Accounts between companies in odoo 18. Sharing accounts between companies in Odoo is a feature that can be beneficial in certain scenarios, particularly when dealing with Consolidated Financial Reporting, Shared Services, Intercompany Transactions etc.
The role of wall art in interior designing
The role of wall art in interior designingmeghaark2110 Wall art and wall patterns are not merely decorative elements, but powerful tools in shaping the identity, mood, and functionality of interior spaces. They serve as visual expressions of personality, culture, and creativity, transforming blank and lifeless walls into vibrant storytelling surfaces. Wall art, whether abstract, realistic, or symbolic, adds emotional depth and aesthetic richness to a room, while wall patterns contribute to structure, rhythm, and continuity in design. Together, they enhance the visual experience, making spaces feel more complete, welcoming, and engaging. In modern interior design, the thoughtful integration of wall art and patterns plays a crucial role in creating environments that are not only beautiful but also meaningful and memorable. As lifestyles evolve, so too does the art of wall decor—encouraging innovation, sustainability, and personalized expression within our living and working spaces.
UPSA JUDGEMENT.pdfCopyright Infringement: High Court Rules against UPSA: A Wa...
UPSA JUDGEMENT.pdfCopyright Infringement: High Court Rules against UPSA: A Wa...businessweekghana Copyright Infringement: High Court Rules against UPSA: A Wake-Up Call for Educational Institutions
ANTI-VIRAL DRUGS unit 3 Pharmacology 3.pptx
ANTI-VIRAL DRUGS unit 3 Pharmacology 3.pptxMayuri Chavan ANTI-VIRAL DRUGS unit 3 Pharmacology 3.pptx
Chemotherapy of Malignancy -Anticancer.pptx
Chemotherapy of Malignancy -Anticancer.pptxMayuri Chavan Chemotherapy of Malignancy -Anticancer.pptx
Conditions for Boltzmann Law – Biophysics Lecture Slide
Conditions for Boltzmann Law – Biophysics Lecture SlidePKLI-Institute of Nursing and Allied Health Sciences Lahore , Pakistan. This presentation covers the conditions required for the application of Boltzmann Law, aimed at undergraduate nursing and allied health science students studying Biophysics. It explains the prerequisites for the validity of the law, including assumptions related to thermodynamic equilibrium, distinguishability of particles, and energy state distribution.
Ideal for students learning about molecular motion, statistical mechanics, and energy distribution in biological systems.
Classification of mental disorder in 5th semester bsc. nursing and also used ...
Classification of mental disorder in 5th semester bsc. nursing and also used ...parmarjuli1412 Classification of mental disorder in 5th semester Bsc. Nursing and also used in 2nd year GNM Nursing Included topic is ICD-11, DSM-5, INDIAN CLASSIFICATION, Geriatric-psychiatry, review of personality development, different types of theory, defense mechanism, etiology and bio-psycho-social factors, ethics and responsibility, responsibility of mental health nurse, practice standard for MHN, CONCEPTUAL MODEL and role of nurse, preventive psychiatric and rehabilitation, Psychiatric rehabilitation,
ITI COPA Question Paper PDF 2017 Theory MCQ
ITI COPA Question Paper PDF 2017 Theory MCQSONU HEETSON ITI COPA Previous Year 2017, 1st semester (Session 2016-2017) Original Theory Question Paper NCVT with PDF, Answer Key for Computer Operator and Programming Assistant Trade Students.
Antepartum fetal surveillance---Dr. H.K.Cheema pdf.pdf
Antepartum fetal surveillance---Dr. H.K.Cheema pdf.pdfDr H.K. Cheema Ante natal fetal surveillance is the need of the hour to decrease fetal morbidity & mortality, Medical students need to be aware of it.
"Bridging Cultures Through Holiday Cards: 39 Students Celebrate Global Tradit...
"Bridging Cultures Through Holiday Cards: 39 Students Celebrate Global Tradit...AlionaBujoreanu Holiday Exchanging Cards iEARN Project.
"Mihai Eminescu"PI TL Cahul Moldova.
INDIA QUIZ FOR SCHOOLS | THE QUIZ CLUB OF PSGCAS | AUGUST 2024
INDIA QUIZ FOR SCHOOLS | THE QUIZ CLUB OF PSGCAS | AUGUST 2024Quiz Club of PSG College of Arts & Science PREPARE FOR AN ALL-INDIA ODYSSEY!
THE QUIZ CLUB OF PSGCAS BRINGS YOU A QUIZ FROM THE PEAKS OF KASHMIR TO THE SHORES OF KUMARI AND FROM THE DHOKLAS OF KATHIAWAR TO THE TIGERS OF BENGAL.
QM: EIRAIEZHIL R K, THE QUIZ CLUB OF PSGCAS
BÀI TẬP BỔ TRỢ TIẾNG ANH 9 THEO ĐƠN VỊ BÀI HỌC - GLOBAL SUCCESS - CẢ NĂM (TỪ...
BÀI TẬP BỔ TRỢ TIẾNG ANH 9 THEO ĐƠN VỊ BÀI HỌC - GLOBAL SUCCESS - CẢ NĂM (TỪ...Nguyen Thanh Tu Collection
Conditions for Boltzmann Law – Biophysics Lecture Slide
Conditions for Boltzmann Law – Biophysics Lecture SlidePKLI-Institute of Nursing and Allied Health Sciences Lahore , Pakistan.
INDIA QUIZ FOR SCHOOLS | THE QUIZ CLUB OF PSGCAS | AUGUST 2024
INDIA QUIZ FOR SCHOOLS | THE QUIZ CLUB OF PSGCAS | AUGUST 2024Quiz Club of PSG College of Arts & Science
Ad
Cryptography is the application of algorithms to ensure the confiden.docx
- 1. Cryptography is the application of algorithms to ensure the confidentiality, integrity, and availability of data, while it is at rest, in motion, or in use. Cryptography systems can include local encryptions at the file or disk level or databases. Cryptography systems can also extend to an enterprise-wide public key infrastructure for whole agencies or corporations. The following are the deliverables for this project: Deliverables Enterprise Key Management Plan: An eight- to 10-page double-spaced Word document with citations in APA format. The page count does not include figures, diagrams, tables, or citations. Enterprise Key Management Policy: A two- to three-page double-spaced Word document. Lab Report: A Word document sharing your lab experience along with screenshots. There are seven steps to complete the project. Most steps of this project should take no more than two hours to complete. The entire project should take no more than one week to complete. Begin with the workplace scenario, and then continue to Step 1, “Identify Components of Key Management.” When you submit your project, your work will be evaluated using the competencies listed below. You can use the list below to self-check your work before submission.
- 2. Step 1: Identify Components of Key Management Key management will be an important aspect of the new electronic protected health information (e-PHI). Key management is often considered the most difficult part of designing a cryptosystem. Choose a fictitious or an actual organization. The idea is to provide an overview of the current state of enterprise key management for Superior Health Care. Review these authentication resources to learn about authentication and the characteristics of key management. Provide a high-level, top-layer network view (diagram) of the systems in Superior Health Care. The diagram can be a bubble chart or Visio drawing of a simple network diagram with servers. Conduct independent research to identify a suitable network diagram. Read these resources on data at rest , data in use, and data in motion . Identify data at rest, data in use, and data in motion as it could apply to your organization. Start by focusing on where data are stored and how data are accessed. Review these resources on insecure handling, and identify areas where insecure handling may be a concern for your organization.
- 3. Incorporate this information in your key management plan. In the next step, you will consider key management capabilities. Step 3: Identify Key Management Gaps, Risks, Solution s, and Challenges In the previous step, you identified the key components of an enterprise key management system. In this step, you will conduct independent research on key management issues in existing organizations. You will use this research to help identify gaps in key management, in each of the key management areas within Superior Health Care. Conduct independent research to identify typical gaps in key management within organizations. Incorporate and cite actual findings within your key management plan. If unable to find data on real organizations, use authoritative material discussing typical gaps. Identify crypto attacks and other risks to the cryptographic systems posed by these gaps. Read these resources to brush up on your understanding of
- 4. crypto attacks . Propose solutions organizations may use to address these gaps and identify necessary components of these solutions. Finally, identify challenges, including remedies, other organizations have faced in implementing a key management system. Include this information in your enterprise key management plan. Provide a summary table of the information within your key management plan. Incorporate this information in your implementation plan. Step 4: Provide Additional Considerations for the CISO You have satisfactorily identified key management gaps. Incorporate these additional objectives of an enterprise key management system as you compile information for the CISO.
- 5. Explain the uses of encryption and the benefits of securing communications by hash functions and other types of encryption. When discussing encryption, be sure to evaluate and assess whether or not to incorporate file encryption, full disc encryption, and partition encryption. Discuss the benefits of using DES, triple DES, or other encryption technologies. To complete this task, review the following resources: Uses of encryption Hash functions types of encryption DES triple DES Describe the use and purpose of hashes and digital signatures in providing message authentication and integrity. Review these resources on authentication
- 6. to further your understanding. Focus on resources pertaining to message authentication. Review the resources related to cryptanalysis . Explain the use of cryptography and cryptanalysis in data confidentiality. Cryptanalysts are a very technical and specialized workforce. Your organization already has a workforce of security engineers (SEs). Cryptanalysts could be added to support part of the operation and maintenance functions of the enterprise key management system. Conduct research on the need, cost, and benefits of adding cryptanalysts to the organization’s workforce. Determine if it will be more effective to develop the SEs to perform these tasks. Discuss alternative ways for obtaining cryptanalysis if the organization chooses not to maintain this new skilled community in-house. Research and explain the concepts and practices commonly used for data confidentiality: the private and public key protocol for authentication, public key infrastructure (PKI), the X.509 cryptography standard, and PKI security. Read about the following cryptography and identity management concepts: public key infrastructure and the X.509
- 7. cryptography standard. Incorporate this information in your implementation plan. In the next step, you will provide information on different cryptographic systems for the CISO. Step 5: Analyze Cryptographic Systems In the previous step, you covered aspects of cryptographic methods. In this step, you will recommend cryptographic systems that your organization should consider procuring. Independently research commercially available enterprise key management system products, discuss at least two systems and recommend a system for Superior Health Care. Describe the cryptographic system, its effectiveness and efficiencies. Provide an analysis of the trade-offs of different cryptographic systems. Review and include information learned from conducting independent research on the following topics:
- 8. Security index rating Level of complexity Availability or utilization of system resources Include information on the possible complexity and expense of implementing and operating various cryptographic ciphers. Check out these resources on ciphers to familiarize yourself with the topic. Incorporate this information in your implementation plan. In the next step, you will begin final work on the enterprise key management plan. Step 6: Develop the Enterprise Key Management Plan In the previous steps, you gathered information about systems used elsewhere. Using the materials produced in those steps, develop your Enterprise Key Management Plan for
- 9. implementation, operation, and maintenance of the new system. Address these as separate sections in the plan. In this plan, you will identify the key components, the possible solutions, the risks, and benefits comparisons of each solution, and proposed mitigations to the risks. These, too, should be considered as a separate section or could be integrated within the implementation, operation, and maintenance sections. A possible outline could be: Introduction Purpose Key Components Implementation Operation Maintenance Benefits and Risks
- 10. Summary/Conclusion The following are the deliverables for this segment of the project: Deliverables Enterprise Key Management Plan: An eight- to 10-page double-spaced Word document with citations in APA format. The page count does not include figures, diagrams, tables, or citations. Lab Report: A Word document sharing your lab experience along with screenshots. Submit your plan to the Assignments folder. After submission, complete the final step of writing the enterprise key management policy.
- 11. Step 7: Develop the Enterprise Key Management Policy The final step in this project requires you to use the information from the previous steps to develop the Enterprise Key Management Policy. The policy governs the processes, procedures, rules of behavior, and training for users and administrators of the enterprise key management system. Research similar policy documents used by other organizations and adapt an appropriate example to create your policy. Review and discuss the following within the policy: digital certificates certificate authority certificate revocation lists Discuss different scenarios and hypothetical situations. For
- 12. example, the policy could require that when employees leave the company, their digital certificates must be revoked within 24 hours. Another could require that employees must receive initial and annual security training. Include at least three scenarios and provide policy standards, guidance, and procedures that would be invoked by the enterprise key management policy. Each statement should be short and should define what someone would have to do to comply with the policy. The following is the deliverable for this segment of the project: Deliverables Enterprise Key Management Policy: A two- to three-page double-spaced Word document.