Genome sequencing
- 1. Genome sequencing Present by: Musaddaq Hafeez BS(hons) MLT Govt. college university Faisalabad
- 2. Definition DNA sequencing is the process of determining the exact sequence of nucleotides within a DNA molecule. This means that by sequencing a stretch of DNA, it will be possible to know the order in which the four nucleotide bases ā adenine, guanine, cytosine and thymine ā occur within that nucleic acid molecule The first DNA sequence were obtained by academic researchers, using laboratories methods based on 2- dimensional chromatography in the early 1970s. By the development of dye-based sequencing method with automated analysis, DNA sequencing has become easier and faster.
- 3. First generation sequencing Sanger and Maxam-Gilbert sequencing technologies were classifieds the First Generation Sequencing Technology who initiated the field of DNA sequencing with their publication in 1977 ļµ ā Sequencing by synthesis (Sanger) ļµ ā Sequencing by degradation (Maxam-Gilbert)
- 4. Maxam-gilbert sequencing ļµ First generation of sequencing known as the chemical degradation method. ļµ performed without DNA cloning. ļµ Relies on the cleaving of nucleotides by chemical. ļµ Chemical treatment generates breaks at a small proportion of one or two of the four nucleotide bases in each of the four reactions (C, T+C, G, A+G). ļµ This reaction leads to a series of marked fragments. ļµ that can be separated according to their size by electrophoresis
- 5. Maxam-gilbert sequencing ļµ Chemicals ā¢ Guanine-Dimethyl sulphate followed by piperdine ā¢ G+A- Dimethyl sulphate in formic acid followed by fomic acid ā¢ C+T- hydrazine followed perperdine ā¢ C- hydrazine in 2M Nacl followed by perperdine it is also considered dangerous because it uses toxic and radioactive chemicals.
- 6. Sanger sequencing ļµ Uses DNA polymerase ļµ All four nucleotides, plus one dideoxynucleotide (ddNTP) ļµ Random termination at specific bases ļµ Separate by gel electrophoresis ļµ Incorporation of di-deoxynucleotides terminates DNA elongation ļµ Individual reactions for each base
- 7. Sanger sequencing ļµ TCTGATGCAT* ļµ TCTGATGCATGAACT* ļµ TCTGATGCATGAACTGCT* ļµ TCTGATGCATGAACTGCTCAT ļµ AGACTACGTACTTGACGAGTAC......
- 9. Computer based sanger ā¢Maximum read length ~900 base ā¢Maximum yield/day < 2.1 million bases (rapid mode, 500 bp reads) costly technique
- 10. Next generation sequencing(NGS) ļµ In 2005 the emergence of a new generation of sequencers to break the limitations of the first generation. ļµ The basic characteristics of second generation (1) The generation of many millions of short reads in parallel, (2) The speed up of sequencing the process compared to the first generation, (3) The low cost of sequencing and (4) The sequencing output is directly detected without the need for electrophoresis.
- 11. Next generation sequencing(NGS Next generation sequencing/Massively parallel sequencing It allows millions of sequencing reactions to be carried out in parallel ļµ It allows multiplexing for different patient samples ļµ Sequencing and detection takes place simultaneously ļµ Sequencing is of clonally amplified DNA templates which has been amplified from a single fragment. Mostly produce short reads- from <400bp Read numbers vary from ~ 1 million to ~1 billion per run
- 12. Next generation sequencing(NGS ļµ With massively parallel sequencing new methods for sequencing template preparation is required ļµ Current NGS platforms utilize clonal amplification on solid supports via two main methods: ļµ ā emulsion PCR (emPCR) ļµ ā bridge amplification (DNA cluster generation)
- 13. Workflow of NGS
- 14. Steps of NGS ļµ Library preparation ļµ Custer generation ļµ Sequencing ļµ Data analysis
- 16. Library preparation Rapid fragmentation and ligation with adapters
- 17. Cluster generation ļµ Emulsion PCR ļµ Emulsion PCR is a method of clonal amplification which allows for millions of unique PCRs to be performed at once through the generation of micro-reactors.
- 18. Cluster generation ļµ Bridge amplification (Illumina) ļµ ā¢ Takes place on the sequencing instrument (flow cell). ļµ The surface of the flow cell is densely coated with primers that are complementary to the primers attached to the DNA library fragments
- 19. sequencing ļµ There are four main sequence methods: ļµ Pyrosequencing (454) ļµ Reversible terminator sequencing (Illumina) ļµ Sequencing by ligation (SOLiD) ļµ Semiconductor sequencing (Ion Torrent)
- 20. Pyrosequencing Roche/454 sequencing ļµ DNA samples are randomly fragmented and each fragment is attached to a bead. ļµ Then, each bead is isolated and amplified using PCR ļµ The beads are then transferred to a plate containing many wells called picotiter plate (PTP) ļµ pyrosequencing technique is applied which consists in activating of a series of downstream reactions producing light at each incorporation of nucleotide ļµ .By detecting the light emission, the sequence of the DNA fragment is deduced ļµ picotiter plate allows hundreds of thousands of reactions occur in parallel, ļµ reads with lengths of up to 1000 bp and can produce ~1Million reads per run
- 22. pyrosequencing Disadvantage The main errors detected of sequencing are insertions and deletions due to the presence of homopolymer regions. the identification of the size of homopolymers should be determined by the intensity of the light emitted by pyrosequencing. Signals with too high or too low intensity lead to under or overestimation of the number of nucleotides which causes errors of nucleotides identification
- 23. Reversible terminator sequencing (Illumina) ļµ During the first step, the DNA samples are randomly fragmented ļµ adapters are ligated to both ends of each sequence. ļµ these adapters are fixed themselves to the respective complementary adapters, ļµ the latter are hooked on a slide with many variants of adapters placed on a solid plate ļµ āPCR bridge amplification ļµ Illumina uses the sequencing by synthesis approach ļµ four modified nucleotides, sequencing primers and DNA polymerases are added as a mix, and the primers are hybridized to the sequences. Nucleotides areflourescently labeled
- 24. Reversible terminator sequencing (Illumina) ļµ Clusters are excited by laser for emitting a light signal specific to each nucleotide, which will be detected by a coupled-charge device (CCD) camera ļµ Computer programs will translate these signals into a nucleotide sequence ļµ lengths of short reads are about 125 bp.Illumina sequencers is currently higher than 600 Gpb ļµ Drawbacks ļµ Illumina/Solexa platform is the high requirement for sample loading control because overloading can result in overlapping clusters and poor sequencing quality.
- 26. Semiconductor sequencing (Ion Torrent) ļµ Detection of hydrogen ions during the polymerization DNA ļµ Sequencing occurs in micro wells with ion sensors ļµ No modified nucleotides ļµ No optics ļµ Fragments attach with beads are placed in micro wells Lengths of 200 bp, 400 bp and 600 bp with throughput that can reach 10 Gb for ion proton sequencer
- 27. Semiconductor sequencing (Ion Torrent) ā¢ The major advantages of this sequencing are focused on read lengths which are longer to other SGS sequencers and fast sequencing time between 2 and 8 hours. ā¢ The major disadvantage is the difficulty of interpreting the homopolymer sequences
- 28. Sequencing by ligation (SOLiD) ļµ It starts by attaching adapters to the DNA fragments, fixed on beads and cloned by PCR emulsion. ļµ These beads are then placed on a glass slide ļµ the 8-mer with a fluorescent label at the end are sequentially ligated to DNA fragments, ļµ the color emitted by the label is recorded ļµ Then, the output format is color space which is the encoded form of the nucleotide where four fluorescent colors are used to represent 16 possible combinations of two bases. ļµ The recovered data from the color space can be translated to letters of DNA bases and the sequence of the DNA fragment can be deduced
- 29. Sequencing by ligation (SOLiD) ļµ sequencer that produce short reads with length 35 bp and output of 3 Gb/run and continued to improve their sequencing which increased the length of reads to 75 bp with an output up to 30 Gb/run ļµ The errors of sequencing in this technology is due to noise during the ligation cycle which causes error identification of bases.
- 30. Sequencing by ligation (SOLiD)
- 31. Data analysis ļµ Sequences produce from poled library are separated upon the base of indices induce during library preparation ļµ Reads with Similar stretches are locally clustered ļµ Forward and reverse strands are paired and create contiguous sequences ļµ These sequences are aligned to the reference genome for variant identification
- 32. Thanks