Molecular surveillance and phylogenetic traits of babesia bigemina and babesia bovis in cattle (bos taurus) and water buffaloes (bubalus bubalis) from colombia

RESEARCH Open Access
Molecular surveillance and phylogenetic
traits of Babesia bigemina and Babesia bovis
in cattle (Bos taurus) and water buffaloes
(Bubalus bubalis) from Colombia
Jeiczon Jaimes-Dueñez1
, Omar Triana-Chávez1
, Andrés Holguín-Rocha2
, Alberto Tobon-Castaño2
and Ana M. Mejía-Jaramillo1*
Abstract
Background: Babesia bigemina and B. bovis are two economically important hemoparasites affecting both cattle
and buffaloes involved in dairy and beef production. In Colombia, although some parasitological and serological
studies suggest an endemicity of these pathogens in areas under 1000 m, little is known about its molecular
prevalence in different host. The objective of this study was to estimate the prevalence and molecular traits of
these parasites in cattle and buffaloes from two Colombian regions.
Methods: Between 2014 and 2016, a three-point longitudinal survey was designed in farms from Caribbean and
Orinoquia regions to evaluate the molecular prevalence of B. bigemina and B. bovis using a nested PCR (n-PCR)
targeting hypothetical protein (hyp) and rhoptry-associated protein (RAP-1) genes, respectively. A total of 1432 cattle,
152 buffalo and 1439 Rhipicephalus microplus samples were analyzed. Moreover, phylogenetic relationship of isolates
was analyzed using the 18S rRNA gene.
Results: A molecular prevalence of 31.6% (24.2% for B. bigemina and 14.4% for B. bovis), 23.6% (6.5% for B. bigemina
and 17.7% for B. bovis) and 4.3% (3.5% for B. bigemina and 1.0% for B. bovis) was observed in cattle, buffaloes and
Rhipicephalus microplus, respectively. Higher values of infection were observed during the wet season and late wet
season; nevertheless, other variables such as age, production type, sex, breed and babesiosis control were also
significantly associated with infection. Prevalence analysis showed that B. bovis infection was higher in cattle that
coexist with buffaloes, when compared to those which did not. For each species, phylogenetic analyses revealed a
high genetic diversity of isolates without clusters related to the isolation source.
Conclusions: To our knowledge, this is the first longitudinal survey that evaluates through molecular methods, the
infection of B. bigemina and B. bovis in two important livestock regions from Colombia. This study reveals that the
prevalence of infection by Babesia spp., in cattle and buffaloes are modulated by seasonal variations, host factors and
vector traits. Our results provide new insights on the epidemiological aspects of infection of Babesia spp., in cattle and
buffaloes, which must be taken into consideration when babesiosis control programs are implemented in the study area.
Keywords: Babesia, Colombia, nPCR, Cattle, Water buffaloes
* Correspondence: anamejia25@gmail.com
1
Grupo BCEI, Universidad de Antioquia UdeA, Calle 70 No. 52-21, Medellín,
Colombia
Full list of author information is available at the end of the article
© The Author(s). 2018 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0
International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and
reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to
the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver
(http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.
Jaimes-Dueñez et al. Parasites & Vectors (2018) 11:510
https://doi.org/10.1186/s13071-018-3091-2

Background
Babesiosis, caused by species of the genus Babesia,
intraerythrocytic apicomplexan parasites, is a worldwide
tick-borne hemoprotozoosis affecting many domestic
and wild mammalian species. Two species are present in
South America, Babesia bovis and B. bigemina, which
are epidemiologically important in livestock and are bio-
logically transmitted by the cattle tick Rhipicephalus
microplus [1, 2]. Cattle with babesiosis usually show
severe clinical signs that include fever, anemia, jaundice,
loss of appetite, muscle tremors, haemoglobinuria and
death [3], while in buffaloes clinical cases are rare and
hardly associated with clinical signs such as fever, colic,
anorexia and haemoglobinuria [4]. Although B. bigemina
is more widespread, causing mortality rates up to 30% in
animals without treatment, B. bovis is the most virulent
Babesia parasite, generating mortality rates between
70–80%, as a result of the related neurological signs [5].
In Colombia, tick-borne diseases produce economic
losses of approximately 4.2 million USD per year, and
they affect mainly the cattle farms on the Atlantic coast,
the Andean valleys, and the Orinoquia region, represent-
ing more than half of the national livestock population
[6, 7]. Previous parasitological surveys of Babesia spp.
carried out in these regions showed a prevalence of 1.1–
3.8% in cattle [8–10], and 4.6–30.1% in buffaloes [11,
12], suggesting an important role of the latter host in
maintaining the circulation of these pathogens. In
Colombia the buffalo population is increasing with an
annual growth up to 35%, most of them bred in the
same pastures alongside the cattle [13]. In this sense,
studies that evaluate the epidemiology and molecular
features of Babesia spp. in both hosts have not been yet
performed, ignoring whether the differences in the in-
fection rate may be due to epidemiological conditions
from study areas or to the particular traits of isolates
in both hosts.
Although in South America several studies have
shown seasonal variations of R. microplus [14, 15], in
Colombia little is known about these variations in the
infection rates of Babesia spp. in the livestock. There-
fore, the aim of this study was to evaluate the transmis-
sion dynamic and genetic features of the causal agents of
babesiosis in cattle and buffaloes from the Atlantic coast
and Orinoquia regions, in order to understand the epi-
demiology of this disease in Colombian livestock and to
contribute to more efficient control strategies.
Methods
Study area
The study was conducted from October 2014 to March
2016 on ten farms of the Antioquia department (A-J)
(Fig. 1a) and ten farms of Arauca (K-T) (Fig. 1b), which rep-
resented 11.7 and 4.6% of the national livestock population,
respectively [6]. The inclusion criteria for the farms in-
cluded animal age records and restriction for the entry of
livestock from other farms. The farms of Antioquia were
located in the municipalities of Necoclí and Turbo in the
Caribbean region, at altitudes under 8 m, with an annual
biotemperature average of 26 °C and rainfall of 2400 mm,
distributed over a dry season from January to March, a wet
season from April to September, and a late wet season from
October to December [16]. The farms of Arauca were
located in the municipalities of Arauquita, Saravena and
Tame in the Orinoquía region in the east of the country, at
altitudes under 231 m, with an annual biotemperature aver-
age of 27 °C and rainfall of 2500 mm, distributed over a dry
season from November to March, a wet season from April
to July, and a late wet season from August to October [16].
Ninety-five percent of the farms employ extensive
farming systems, where animals are fed with Brachiaria
spp. and native grasses, and are at densities of 1.314 (SD
= 0.359) livestock units (LUs) per hectare (ha), and the
rest use the intensive farming system. The main species
of cattle is Bos indicus, with breeds such as the
Brahman, Gyr and Guzerat, and its crosses with B.
taurus, including breeds such as Limousin, Brown Swiss
and Holstein Friesians. For buffaloes, the main species is
Bubalus bubalis, with breeds such as Carabao, Mediter-
ranean, Murrah and their crosses. Babesiosis control is
mainly based on vector control carried out with insecti-
cides and acaricides such as avermectins, organophos-
phates and pyrethroids, as well as the use of antiprotozoal
drugs such as imidocarb dipropionate and diminazine
accurate. Additional information about the geographical
location and characteristics of each farm is shown in
Additional file 1: Table S1.
Study design
According to previous epidemiological studies concern-
ing seasonal variations of R. microplus and its relation-
ship with transmission patterns of babesiosis [14, 17], a
three-point longitudinal survey was designed to examine
seasonal variations of Babesia spp. infection in the study
area in cattle, buffaloes and ticks during the dry season,
wet season and the late wet season.
Sample size
The sample size was calculated using Epi Info™ 7.0, taking
into account the number of cattle or buffalo in the farms
of each department, a 22.5% probability of being infected
according to Herrera et al. [9], a 95% confidence interval
and a statistical error of 5%. Thus, the estimated sample
size for cattle in each season was 220 and 260, in Arauca
and Antioquia, respectively, while for buffaloes was 148
for Antioquia. Within each farm, the samples were col-
lected randomly, considering the percentage of animals ≤
1 year-old and >1 year-old according to Amorim et al.
Jaimes-Dueñez et al. Parasites & Vectors (2018) 11:510 Page 2 of 12

[18]. Cattle samples were collected on nine farms of Anti-
oquia (A-I) (Fig. 1a) and ten farms of Arauca (K-T)
(Fig. 1b), whereas buffalo samples were collected on three
farms in Antioquia (H-J) (Fig. 1a).
Blood sample collection and proccessing
For each animal, 5 ml of blood was collected from the
coccygeal or jugular vein using EDTA.K3 Vacutainer tubes
(Improve Medical, Guangzhou, China) and stored at 4 °C
until processing. Additional information about the num-
ber of samples collected in each farm during each sam-
pling is detailed in Additional file 1: Table S1. Blood
samples were transferred within 6 h after collection into a
glass micro-hematocrit capillary tube containing Na-hep-
arin (80 IU/ml) (Vitrex Medical, Copenhagen, Denmark),
sealed at one end with Cristaseal (Hawksley, Lancing, UK)
and centrifuged for 5 min at 9000× rpm at room
temperature, to measure the packed cell volume (PCV) in
Fig. 1 Map of Colombia showing the farms in Antioquia (a) and Arauca (b) where sampling was done, and the spatio-temporal prevalence of B.
bigemina and B. bovis observed in cattle in Antioquia (c) and Arauca (d), and buffaloes in Antioquia (e). Yellow, blue and red triangles represent the
farms where samples of cattle, buffaloes and both species were collected, respectively (see Additional file 1: Table S1 for additional information,
according to uppercase farm code letter). Lowercase letters in the graphs represent significant differences assessed by the Chi-square test (P < 0.05)

a micro-hematocrit capillary tube reader (Bacto, Sydney,
Australia). Genomic DNA was extracted from 200 μl of
blood using the Genomic DNA Purification Kit (Invisorb,
Birkenfeld, Germany) according to the manufacturer’s in-
structions. Total DNA was diluted with 100 μl of elution
buffer and stored at -20 °C until molecular diagnosis.
Tick sample collection and processing
Between 5 and 20 ticks were collected from the highly
infested animals selected for blood sampling along with
others located on the same farms, using entomological
forceps through examination of the perineum surface ac-
cording to Baker & Ducasse [19]. All collected speci-
mens were directly preserved in 70% ethanol and stored
at 4 °C until processing. Tick samples were initially ex-
amined under a stereomicroscope (Leica Microsystems,
Mannheim, Germany) and classified up to the species,
sex and life stage according to morphological keys re-
ported for ticks of veterinary importance in South
America [20]. After that, specimens were grouped in
pools of one to six individuals based on their life stage,
sex, species and mammalian host. Considering that a
positive correlation between the blood parasite levels of
infected animals and the numbers of Babesia kinetes in
the hemolymph of the dropped tick has been shown [21,
22], hemolymph DNA from each pool of ticks was ex-
tracted as detailed below. To that end, ticks were washed
three times in 70% ethanol for 5 min to sterilize them
[23], and subsequently, the legs were dissected in PBS as
reported elsewhere [24]. This material was frozen and
disrupted mechanically in liquid nitrogen [25] and then
subjected to genomic DNA extraction using a DNeasy
Blood & Tissue Kit (Qiagen, Hilden, Germany) accord-
ing to the manufacturer’s instructions. Total DNA was
diluted with 100 μl of elution buffer and stored at -20 °C
until molecular diagnosis.
Screening for the presence of B. bigemina and B. bovis
All DNA preparations were screened to test for the pres-
ence of B. bigemina and B. bovis using a nested PCR
(n-PCR) targeting the hypothetical protein (hyp) and
rhoptry associated protein (RAP-1) genes, respectively
[26], which have been reported with a specificity of
100% and an analytical sensitivity corresponding to para-
sitemias of approximately 3.0 × 10-2
and 1.7 × 10-2
para-
sites/μl of the infected blood, respectively [27]. The
oligonucleotide sequences used in the present study and
their annealing temperatures are shown in Table 1. All
PCR assays were conducted in 25 μl reactions containing
1× reaction buffer (100 mM Tris-HCl, 50 mM KCl, pH
8.8), 0.2 mM dNTP, 1.5 mM MgCl2, 0.4 μM of each pri-
mer, 0.625 UI of Taq DNA polymerase (Thermo Scien-
tific, Massachusetts, USA), and 5 μl (100 ng) of DNA
samples for the first PCR and 1 μl of PCR product for
the second. PCR products were analyzed by 2% agarose
gel electrophoresis, stained with GelRed (Thermo Fisher
Scientific) and visualized under UV light. Sample prepa-
rations were considered positive for B. bigemina or B.
Table 1 List of primers used in PCR assays
Organism Target gene Primer Oligonucleotide sequence (5′-3′) Amplicon size (bp) Annealing T (°C) Reference
B. bigemina hyp BiIA CATCTAATTTCTCTCCATACCCCTCC 278 63 [26]
BiIB CCTCGGCTTCAACTCTGATGCCAAAG
BiIAN CGCAAGCCCAGCACGCCCCGGTGC 170 70
BiIBN CCGACCTGGATAGGCTGTGTGATG
B. bovis RAP-1 BoF CACGAGGAAGGAACTACCGATGTTGA 350 61 [26]
BoR CCAAGGAGCTTCAACGTACGAGGTCA
BoFN TCAACAAGGTACTCTATATGGCTACC 290 67
BoRN CTACCGAGCAGAACCTTCTTCACCAT
Babesia spp. 18S rRNA A ACCTGGTTGATCCTGCCAG ~1700 60 [30]
B GATCCTTCTGCAGGTTCACCTAC
B. bigemina 18S rRNA Bbig200F GCGTTTATTAGTTCGTTAACC ~1200 56 [32]
Bbig1400R ACAGGACAAACTCGATGGATGC
B. bovis 18S rRNA AN GCTTGTCTTAAAGATTAAGCCATGC ~1550 60 [31]
BN CGACTTCTCCTTCCTTTAAGTGATAAG
Mammalian cyt b Cyt bF CCCCTCAGAATGATATTTGTCCTCA ~383 60 [28]
Cyt bR CCATCCAACATCTCAGCATGATGAAA
Insects cox1 LCOI490 GGTCAACAAATCATAAAGATATTGG ~710 45 [29]
HCO2198 TAAACTTCAGGGTGACCAAAAAATCA
Abbreviation: T temperature

bovis when a band of 170 or 290 bp, respectively, was
observed in the electrophoresis of the second PCR. To
confirm the specificity of the molecular diagnosis, the
PCR product of one positive sample of B. bigemina and
one of B. bovis were purified and sequenced using the
Sanger method at Macrogen, Korea.
Finally, to check the presence of PCR inhibitors and
amplifiable DNA, a 383 bp fragment from the cyt b gene
from mammals [28], and a 710 bp fragment from the
cox1 gene of arthropods [29], were amplified by PCR in
all negative blood and tick samples, respectively
(Table 1). Samples that did not amplify were excluded
from the data analysis.
Amplification and sequencing of genetic markers
After molecular diagnosis, the strongest positive samples
for the amplification of hyp and RAP-1 genes were
selected to amplify the 18S rRNA gene from B. bigemina
and B. bovis. The complete 18S rRNA gene of both
species was initially amplified by PCR using oligonucleo-
tides A and B [30], and 1 μl of PCR product was used as
template in the n-PCR using oligonucleotides set AN/
BN [31], and Bbi200F/Bbi1400R [32] for each species,
respectively. The amplified fragments were separated in
2% agarose gels stained with GelRed (Thermo Fisher
Scientific), excised from the gels, purified by a Zymo-
clean™ Gel DNA Recovery Kit (Zymo Research, Irvine,
CA, USA) and cloned using the pGEM-T Easy vector
system (Promega, Wisconsin, USA) according to the
manufacturer’s instructions. One to two clones from
each isolate were purified and completely sequenced in
both strands using the Sanger method at Macrogen.
Phylogenetic analyses
Sequences were aligned using CLUSTALW [33] as im-
plemented in BioEdit v.7.1.9 [34]. For each species,
phylogenetic analyses were performed using sequences
obtained in this study along with reference sequences of
Babesia spp. derived from cattle, buffaloes and vaccin-
ation strains from America and other continents. Each
alignment was analyzed using the Maximum Composite
Likelihood method with Kimura 2-parameters model in
MEGA6.0 software. Internal branch confidence was
assessed by the boot-strapping method using 1000 boot-
strap replicates. The trees were drawn with FigTree
v.1.4.2 (Institute of Evolutionary Biology, University of
Edinburgh, UK).
Data source
The environmental dataset used in this study corre-
sponded to monthly values of precipitation (mm) and
mean temperature (°C) from 2011 to 2016 in the study
areas, which were provided by the Institute of Hydrology,
Meteorology and Environmental Studies of Colombia
(IDEAM). The meteorological stations (12045010,
12030020 and 12025030) from Antioquia and those of
Arauca (36030030, 37045010 and 36025010) were chosen
according to their proximity to the study farms.
Data analysis
To construct models that could explain the dependent
variable (B. bigemina or B. bovis infection) as a function
of 11 qualitative independent variables related to host
and environmental conditions (Additional file 1: Table
S2), generalized estimated equation (GEE) models were
run using a binomial distribution, a log link function and
exchangeable interclass correlation. In all analyses the
feature farm was included as the group variable. Initially,
the independent variables were subjected to univariate
analysis. Those with a statistical association (here con-
sidered to be P < 0.25, Chi-square test, according to
Hosmer & Lemeshow [35]) were tested in the multivari-
ate model using a stepwise method. The level of statis-
tical significance of the variables included in the
multivariate model was set at P < 0.05. The results are
expressed as Exp (B) (an estimate of the prevalence ratio,
PR) and 95% CI. Additional prevalence comparisons
were performed using the Chi-square test.
The cut-off to determine anemic cattle and buffaloes
was PCV ≤ 24% and ≤ 29%, respectively, according to
described by Abd Ellah et al. [36] and Rockett & Bosted
[37]. Finally, the relationship between Babesia spp.
prevalence in both mammalian hosts with the age was
evaluated through correlation analysis, after a Shapiro-
Wilk normality test. P < 0.05 was considered significant.
The sizes of age groups varied from 4 to 12 % of the
total population. Data analyses were performed using
SPSS v.18.0 statistical software.
Results
Babesia spp. infection is modulated by host and
environmental conditions
A total of 1432 cattle (715 from Arauca and 717 from
Antioquia) and 152 buffaloes were analyzed, which
corresponded to 75.0 and 79.6% of animals > 1 year-old,
with a mean age of 4.69 (SD = 3.64) and 6.42 years (SD
= 5.96), respectively. Of the total cattle analyzed, 31.6%
(453/1432) were positive for Babesia spp. of which
24.2% (347/1432) and 14.4% (207/1432) were positive
for B. bigemina and B. bovis, respectively. For buffaloes,
23.6% (36/152) were positive for Babesia spp. of which
6.5% (10/152) and 17.7% (27/152) were positive for each
species, respectively. The prevalence of co-infections (B.
bigemina + B. bovis) for cattle and buffaloes was 7.0%
(101/1432) and 0.6% (1/152) (Table 2), respectively.
Interestingly, during the three samplings, B. bigemina
was the most prevalent species for cattle (Fig. 1c, d),

while for buffaloes B. bovis was most prevalent (Fig. 1e).
The highest Babesia spp. prevalence values for both cat-
tle and buffaloes were observed during the wet season
or late wet season, with significant seasonal variations
found in cattle from both departments (Fig. 1c, d). B.
bovis infection was higher in cattle that coexist with buf-
faloes, when compared to those who did not (P < 0.05)
(Fig. 2).
In cattle, PCV analyses showed a mean of 33.7% (SD =
5.7%), 29.6% (SD = 6.4%) and 31.1% (SD = 6.01%) for Bos
indicus, B. taurus and their crosses, respectively, while for
buffaloes the mean PCV was 33.5% (SD = 7.13%). A pro-
portion of 8.9% (123/1379) and 33.5% (51/152) of cattle
and buffaloes showing anemia signs was observed, re-
spectively. Both B. bigemina and B. bovis prevalence was
higher in animals with normal PCV values than those with
anemia signs (Additional file 1: Table S2). Significant
negative Pearson’s correlation coefficients (Spearman’s r =
-0.674, P = 0.008) was observed between Babesia spp.
prevalence and the age range in cattle, with lower preva-
lence of infection in older animals (Fig. 3a). On the con-
trary, no significant correlation was observed in the case
of buffaloes (Fig. 3b). All cattle and buffalo negative sam-
ples amplified cyt b gene. Finally, the hyp gene 128 bp
derived from Arauca’s cattle (Additional file 2: nucleotide
sequence) showed 95% identity with scaffold 71,030 of the
B. bigemina genome (LK055111.1), while the 267 bp of
the RAP-1 gene from Antioquia’s cattle (KX365053)
showed 100% identity with the R1A strain of B. bovis iden-
tified in Argentina (AF030062.1).
Molecular analysis detected a low infection rate of
Babesia spp. in R. microplus
Of 1479 ticks collected from 216 bovines across the
three sampling periods in both departments, 97.2%
(1439/1479) corresponded to R. microplus, 1.8% (27/
1479) to Dermacentor nitens and 0.9% (13/1479) to
Amblyoma cajennense (sensu lato). Regarding life stages,
97.5% of R. microplus samples were adults (89.6% fe-
males and 10.4% males) and 2.5% nymphs; for D. nitens
88.9% were adults (100% females) and 11.1% nymphs,
while for A. cajennense (s.l.) 60.0% were adults (100% fe-
males) and 40.0% nymphs. Of the total of pools of R.
microplus analyzed, 4.3% (12/278) were positive for Ba-
besia spp. of which 3.5% (10/278), 1.0% (3/278) and 0.3%
(1/278) were positive for B. bigemina, B. bovis, and
co-infected, respectively (Table 2). All positive pools cor-
responded to engorged female, without significant differ-
ences in the infection rate between both departments. D.
nitens and A. cajennense (s.l.) were negative for both B.
bigemina and B. bovis. All ticks negative samples had an
amplified cox1 gene.
Babesia spp. infection in cattle and buffaloes is influenced
by different variables
In univariate analysis, the detection of at least one Babe-
sia spp.-positive cattle by molecular techniques was
statistically associated (P < 0.25) with all independent
variables, except for breed, PCV, sampling season and
department for B. bigemina; and breed, sampling season,
department, farming system and vector control for B.
Table 2 Prevalence of Babesia bigemina and Babesia bovis determined by molecular techniques in cattle, buffaloes and ticks from
Colombia, during dry, wet and late wet seasons
Detected pathogens Dry season Wet season Late wet season Annual
n Positive (%) n Positive (%) n Positive (%) n Positive (%)
B. bigemina
Cattle 466 105 (22.5) 463 118 (25.4) 503 124 (24.6) 1432 347 (24.2)
Buffaloes 57 2 (3.5) 51 5 (9.8) 44 3 (6.8) 152 10 (6.5)
R. microplus (pools) 45 2 (4.4) 23 0 (0.0) 210 8 (3.8) 278 10 (3.5)
D. nitens (pools) 7 – – – 4 0 (0) 11 0 (0)
A. cajennense (s.l.) (pools) – – – – 9 0 (0) 9 0 (0)
B. bovis
Cattle 466 61 (13.0) 463 67 (14.4) 503 79 (15.7) 1432 207 (14.4)
Buffaloes 57 11 (19.3) 51 7 (13.7) 44 9 (20.5) 152 27 (17.7)
R. microplus (pools) 45 0 (0) 23 0 (0) 210 3 (1.4) 278 3 (1.0)
D. nitens (pools) 7 – – – 4 0 (0) 11 0 (0)
A. cajennense (s.l.) (pools) – – – – 9 0 (0) 9 0 (0)
B. bigemina + B. bovis
Cattle 466 25 (5.3) 463 35 (7.5) 503 41 (8.1) 1432 101 (7.0)
Buffaloes 57 0 (0) 51 0 (0) 44 1 (2.2) 152 1 (0.6)
R. microplus (pools) 45 0 (0) 23 0 (0) 210 1 (0.4) 278 1 (0.3)

bovis (Additional file 1: Table S2). However, in the multi-
variate analysis, only age and production type, were sig-
nificantly associated (P < 0.05) with the infection of both
B. bovis and B. bigemina (Fig. 4a).
For the case of buffaloes, univariate analysis showed
statistical associations (P < 0.25) of Babesia spp. infec-
tion with all independent variables except for sex, PCV,
sampling season, ambiental temperature, babesiosis con-
trol and municipality for B. bigemina; and PCV, sam-
pling season, ambient temperature and production type
for B. bovis (Additional file 1: Table S2). However, in the
multivariate analysis, only sex and production type were
significantly associated (P < 0.05) with the infection of B.
bigemina, and breed and babesiosis control were signifi-
cantly associated with the infection of B. bovis (Fig. 4b).
Phylogenetic analyses of Babesia spp. do not show
differentiation between isolation sources
A total of 10 (MH194385-MH194394) sequences of B.
bigemina derived from PCR products cloned into the
pGEM-T Easy vector system (Promega) from 4 cattle, 5
buffaloes and 1 pool of ticks (R. microplus), and 13
(MH194395-MH194407) sequences of B. bovis from 8
cattle and 5 buffaloes were analyzed. Both B. bigemina
and B. bovis phylogenetic trees showed clusters with
high proximity of the Colombian isolates to world iso-
lates derived from different hosts. Moreover, clusters re-
lated to each isolation source were not observed in each
species (Fig. 5a, b).
Discussion
Babesia bigemina and B. bovis are the two economically
important species affecting livestock farms involved in
dairy and beef production in Colombia [1, 10, 12]. Given
the paucity of studies on the distribution and
characterization of these pathogens in different mamma-
lian hosts, control strategies have been unsuccessful. To
our knowledge, this is the first longitudinal survey and
molecular characterization of B. bigemina and B. bovis in
cattle and buffaloes from livestock areas in Colombia to
consider eco-epidemiological variables associated with in-
fection; this can improve the epidemiological understand-
ing and control strategies of babesiosis in this country.
The results reported herein demonstrate that in the
study area, the two Babesia species exhibited differences
in prevalence between the mammalian hosts studied, with
B. bigemina being most prevalent in cattle (24.2%) and B.
bovis in buffaloes (17.7%). Similar results were observed in
Fig. 2 Comparison of the prevalence of B. bigemina and B. bovis in animals who did not share habitat (cattle or buffaloes) compared with animals
sharing habitat (cattle and buffaloes). *Significant differences assessed by the Chi-square test (P < 0.05)
Fig. 3 Correlation analysis between the prevalence of Babesia spp. and age groups of cattle (a) and buffaloes (b) from the study area. A significant
negative Pearson’s correlation coefficient (r = -0.674) was observed for cattle

livestock areas from Argentina, Brazil and Colombia, in
which the molecular prevalence of B. bigemina and B.
bovis in cattle was 46.4 ± 7.0% and 11.7 ± 3.6%, respect-
ively [10, 18, 38–40], while in buffaloes it was 8.6 ± 7.6%
and 17.5 ± 8.8% for each species, respectively [41–43].
These findings, together with those obtained from the
spatio-temporal analysis, in which these proportions did
not vary with time (Fig. 1c-e), suggest that South Ameri-
can buffalo populations tend to support a higher preva-
lence of B. bovis compared to cattle populations.
The 18S rRNA gene has been previously used to
identify genetic clusters of Babesia spp. associated with
specific hosts [32]. Considering the paucity of phylo-
genetic studies of Babesia spp. in livestock from South
America, a phylogenetic approach to Colombian iso-
lates was applied. Interestingly, our results showed that
Babesia spp. isolates derived from cattle and buffaloes
are not associated with particular clusters, suggesting a
lack of genetic structure in these isolates and a possible
circulation of strains between both hosts. These results,
together with the higher prevalence of B. bovis ob-
served in cattle coexisting with buffaloes (Fig. 2), sup-
port the idea that buffaloes might act as reservoir hosts
for the infection of B. bovis in cattle. Therefore, special
management measures have to be taken to prevent eco-
nomic losses related to infection of this pathogen in
cattle populations such as decreasing the tick transfer
between cattle and buffaloes on farms with both hosts,
as well as sharing of needles between them. On the
other hand, the lack of genetic structure could be due
to a variability of apicomplexan parasites that has been
proposed as a survival strategy against the vertebrate
immune response [44–46]. In this sense, genetic diver-
sity observed here could be associated with continuous
immune pressure by both hosts. Nevertheless, other
factors, such as multiple introductions of strains from
various geographical locations, and the diversity of bio-
logical and mechanical vectors, could also explain this
behavior.
According to Smith et al. [47] enzootic stability of Ba-
besia spp. is maintained when at least 75% of the herd is
infected before nine months of age. On this matter, ex-
perimental and epidemiological studies in South Amer-
ica have provided evidence for significant differences
between molecular and serological diagnosis of Babesia
spp. showing that prevalence is two to three times more
in indirect-ELISA compared to PCR analysis [41, 48].
Thus, the active infection rate detected by molecular
methods in cattle under six months old (> 60%) together
with the lack of anemic signs associated (Fig. 3a), suggest
an enzootic stability in this population, as observed in
other livestock areas from Colombia [10, 12, 49]. How-
ever, future studies using serological test are necessary
to confirm the enzootic stability in the study area.
Fig. 4 Forest plot of prevalence ratio (PR) obtained from the multivariate model (GEE) of infection with B. bigemina and B. bovis in cattle (a) and
buffaloes (b) from Colombia. All prevalence ratios of independent variables are discriminated by category comparison. Squares and horizontal
bars represent PRs and 95% CIs, respectively

Although buffaloes did not show clinical signs associ-
ated with infection, the prevalence was variable between
age groups (Fig. 3b), as previously observed in endemic
areas of South America [11, 50]. In Colombia, like in
other South American countries, buffalo populations
have increased notably during recent years from ap-
proximately 100,000 buffaloes in 2010 to 250,000 in
2016 [6, 13]. This is mainly due to changing approaches
towards meat and milk production, and to the percep-
tion that buffaloes are more tolerant than cattle to infec-
tion with Babesia spp. and the subsequent acute clinical
effects resulting from such infections [51, 52]. This ten-
dency, which included movement of animals to new
areas with different transmission rates, could explain the
heterogeneous dynamic of the prevalence in the age
groups and the lack of clinical signs observed in these
hosts; nevertheless, the low number of farms and blood
samples evaluated for this species and the use of mo-
lecular techniques also could explain these results.
In Colombia, ecological studies that evaluated the dy-
namics of R. microplus at altitudes under 600 m showed
that high infestation rates in cattle were observed in the
days after the rain peaks, when the humidity and
temperature conditions were optimal for the develop-
ment of all tick life stages [53, 54]. Interestingly, our re-
sults showed that although B. bigemina and B. bovis
were found during all samplings, seasonal variations
were observed, with high frequencies detected during
wet and late wet season in both hosts (Fig. 1c-e). This
suggests that ticks and babesiosis control systems should
be intensified during these seasons to reduce the eco-
nomic impact resulting from outbreaks associated with
the high transmission of these pathogens during the
humid months.
In South America, little is known about the infection
rates of Babesia spp., established by molecular methods,
in R. microplus. Epidemiological studies that evaluated
this feature in endemic areas from Brazil [27, 55] and
Fig. 5 Maximum likelihood tree based on 18S rRNA genes of B. bigemina (a) and B. bovis (b) isolates. Taxa in red represent the sequences of isolates
reported in this paper. Node support bootstrap values > 80% are shown on the branches. Abbreviations: N.I, non-identified source; V.S, vaccination strain

Colombia [40], showed molecular infection rates ranging
between 16.8–88.6%. Surprisingly, our results showed
that infection rates in R. microplus were lower than 5.0%
during all samplings (Table 2), indicating a discrepancy
with those previously reported. Given that samples ana-
lyzed in previous studies correspond to DNA obtained
from the whole body of the specimen, it is likely that in-
festation rates detected by them correspond to parasite
stages or DNA present in the midgut, and not specific-
ally to parasites in the hemolymph of the female tick.
However, other factors such as levels of parasitemia in
the hosts, which can modulate the infection rates in tick
populations [21], as well as differences in the sensitivity
of molecular diagnostic methods, cannot be ruled out.
With regard to the high proportion of B. bigemina de-
tected in the hemolymph compared to B. bovis (Table 2),
this may be due to the ability of B. bigemina to remain
through generations of Rhipicephalus spp. in the absence
of reinfection, which does not happen in B. bovis [21,
56]; nevertheless, the high degree of pathogenicity of B.
bovis in cattle, which lead to parasitemia less that 1%
during acute infection [57], may also explain these
results.
Although, the Babesia spp. infection is mainly associ-
ated with tick exposure [2, 55], its dynamics is complex
and depends on many factors, whose association deter-
mines the prevalence of infection in the livestock.
Herein, we identified different variables related to Babe-
sia spp. infection, which could be modulating the preva-
lence of infection in the study area. In cattle, both B.
bigemina and B. bovis infection were specifically associ-
ated with the age and production type (Fig. 4a). As dis-
cussed previously, the lower probability of adults of
being infected with Babesia spp. when compared to
calves is explained by the apparent enzootic stability in
the study area, in which the higher infection rate ob-
served in calves give rise to a fully protected adult herd
with little chance of developing clinical signs against
new infections [48, 58]. In the same way, the signifi-
cantly higher infection rate of Babesia spp. observed in
young animals can be explained by the fact that they
have a softer skin compared to adults, which facilities
the mouth-part penetration of the vector, making them
the preferred host of ticks [59]. These findings, together
with the low infection rate of Babesia spp. detected in
ticks and the poor transovarial transmission of these
pathogens in R. microplus (< 50%) [21, 60] suggest that a
high tick infestation rate in young cattle is necesary to
produce the high infection rate detected in this age group.
On the other hand, the protective effect observed both in
cattle and buffaloes dedicated to dual-purpose (Fig. 4a, b)
suggest that frequent hygiene practices and tendency to
use adult females in this group, could explain their low
prevalence compared with those dedicated only to beef
production. As a consequence, improving the implemen-
tation of vector and vector-borne pathogen control sys-
tems in animals dedicated to beef production will prevent
sporadic outbreaks of babesiosis in these productions type.
Finally, other variables such as sex, breed and babesiosis
control were differentially associated with Babesia spp. in-
fection in buffaloes (Fig. 4b). These findings showing a
higher probability of infection in males, animals of the
Murrah breed, and those kept on farms without babesiosis
control systems, could encourage farmers from the study
area to intensify these in buffalo populations.
Conclusions
To our knowledge, this is the first epidemiological study
investigating the spatio-temporal prevalence of B. bovis
and B. bigemina in cattle, buffaloes and ticks, from two
important livestock areas of Colombia. Our results re-
vealed that the prevalence of infection by Babesia spp.,
in cattle and buffaloes are modulated by seasonal varia-
tions, host factors and vector traits. Furthermore, while
in cattle the infection occurs under enzootic stability, in
buffaloes it could be associated with an enzootic instabil-
ity, accompanied by a high prevalence of B. bovis which
suggests an important role of these animals as possible
reservoir hosts of infection for cattle.
Additional files
Additional file 1: Table S1. Geographical location and characteristics of
the farms evaluated in Antioquia and Arauca, Colombia. Table S2.
Bivariate model of infection with Babesia spp., in livestock herds from
Antioquia and Arauca, Colombia. (DOCX 58 kb)
Additional file 2: Nucleotide sequences derived from a hypothetical
protein of Babesia bigemina. (FAS 1 kb)
Abbreviations
rRNA: Ribosomal ribonucleic acid; SD: Standard deviation
Funding
This research was supported by the Universidad de Antioquia (UdeA). JJD
was supported by a fellowship from COLCIENCIAS.
Availability of data and materials
Data supporting the conclusions of this article are included within the article
and its additional files. The raw data of this study are available from the
corresponding author upon reasonable request. Representative sequences
were submitted to the GenBank database under the accession numbers
KX365053, MH194385-MH194407.
Authors’ contributions
Conceived and designed the experiments: JJD, OTC, ATC and AMJ.
Performed the experiments: JJD and AHR. Analyzed the data: JJD and AHR.
Wrote the paper: JJD, OTC and AMJ. All authors read and approved the final
manuscript.
Ethics approval
Animal work was approved by the authorities of the Ethics Committee for
Animal Experimentation of the University of Antioquia (authorization no.
18084). All in vivo procedures were performed in respect to the law 84 of
1989 and 576 of 2000 established by Ministry of National Education from

Colombia. The arthropods capture was regulated by the National
Environmental Licensing Authority of Colombia (ANLA).
Consent for publication
Not applicable.
Competing interests
The authors declare that they have no competing interests.
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published
maps and institutional affiliations.
Author details
1
Grupo BCEI, Universidad de Antioquia UdeA, Calle 70 No. 52-21, Medellín,
Colombia. 2
Grupo Malaria, Universidad de Antioquia UdeA, Calle 70 No.
52-21, Medellín, Colombia.
Received: 18 May 2018 Accepted: 31 August 2018
References
1. Alonso M, Arellano-Sota C, Cereser VH, Cordoves CO, Guglielmone AA,
Kessler R, et al. Epidemiology of bovine anaplasmosis and babesiosis in
Latin America and the Caribbean. Rev Sci Tech. 1992;11:713–33.
2. Chauvin A, Moreau E, Bonnet S, Plantard O, Malandrin L. Babesia and its
hosts: adaptation to long-lasting interactions as a way to achieve efficient
transmission. Vet Res. 2009;40:37.
3. Merck S, Dohme C. Babesiosis. In: The Merck Veterinary Manual; 2017.
https://www.msdvetmanual.com/circulatory-system/blood-parasites/
babesiosis. Accessed 1 May 2017.
4. Patel PA, Modi LC, Chaudhary PM, Patel SP, Joshi AH. A rare case of
babesiosis in Mehsana Buffalo. IJAVMS. 2011;5:383–4.
5. Kaufmann J. Parasitic Infections of Domestic Animals: A Diagnostic Manual.
Basel-Boston-Berlin: Birkhauser; 1996.
6. ICA. Instituto Colombiano de Agricultura - Censo Pecuario Nacional 2016.
Bogota: Instituto Colombiano de Agricultura (ICA); 2016.
7. Vizcaíno OG, Benavides EO. Vacuna colombiana contra anaplasmosis y
babesiosis bovinas: la alternativa más eficaz y económica para el control de
estos hemoparasitismos. Corpoica. 2004;1:2–11.
8. Blanco R, Cardona J, Vargas M. Prevalencia de parásitos hematrópicos
endoglobulares en bovinos gyr puros en Córdoba, Colombia. Rev Med Vet.
2016;31:67–74.
9. Herrera M, Soto A, Urrego V, Rivera G, Zapata M, Rios M. Frequency of
hemoparasites of bovines from Cauca and San Jorge Rivers, 2000–2005. Rev
MVZ Córdoba. 2008;13:1486–94.
10. Jaimes-Dueñez J, Triana-Chávez O, Mejía-Jaramillo AM. Parasitological and
molecular surveys reveal high rates of infection with vector-borne pathogens
and clinical anemia signs associated with infection in cattle from two
important livestock areas in Colombia. Ticks Tick Borne Dis. 2017;8:290–9.
11. Cardona JA, Hoyos CE, Garay OV. Frecuencia de hematrópicos en tres
explotaciones de búfalos (Bubalus bubalis) del Departamento de Córdoba,
Colombia. FCV-LUZ. 2012;22:530–6.
12. Ríos L, Zapata R, Reyes J, Mejía J, Baena A. Estabilidad enzoótica de
babesiosis bovina en la región de Puerto Berrío, Colombia. FCV-LUZ.
2010;20:485–92.
13. ICA. Líbano es el nuevo mercado para búfalos colombianos. Bogotá:
Instituto Colombiano Agropecuario; 2016.
14. Lima WS, Ribeiro MF, Guimaraes MP. Seasonal variation of Boophilus
microplus (Canestrini, 1887) (Acari: Ixodidae) in cattle in Minas Gerais State,
Brazil. Trop Anim Health Prod. 2000;32:375–80.
15. Mangold AJ, Aguirre DH, Gaido AB, Guglielmone AA. Seasonal variation of
ticks (Ixodidae) in Bos taurus x Bos indicus cattle under rotational grazing in
forested and deforested habitats in northwestern Argentina. Vet Parasitol.
1994;54:389–95.
16. IDEAM. Atlas climatológico de Colombia. Bogotá: Instituto de Hidrología,
Meteorología y Estudios Ambientales; 2014.
17. Quintão-Silva MG, Ribeiro MF. Infection rate of Babesia spp. sporokinetes in
engorged Boophilus microplus from an area of enzootic stability in the State
of Minas Gerais, Brazil. Mem Inst Oswaldo Cruz. 2003;98:999–1002.
18. Amorim LS, Wenceslau AA, Carvalho FS, Carneiro PL, Albuquerque GR.
Bovine babesiosis and anaplasmosis complex: diagnosis and evaluation of
the risk factors from Bahia, Brazil. Rev Bras Parasitol Vet. 2014;23:328–36.
19. Baker M, Ducasse F. Tick infestation of livestock in Natal. I. The predilection sites
and seasonal variations of cattle ticks. J South Afr Vet Assoc. 1967;38:447–53.
20. Barros-Battesti D, Arzua M, Bechara G. Carrapatos de importancia medico
veterinaria da regiao neotropical: Um guia ilustrado para identificaçao de
especies. São Paulo: IDTTD-3, Butanta; 2006.
21. Howell JM, Ueti MW, Palmer GH, Scoles GA, Knowles DP. Transovarial
transmission efficiency of Babesia bovis tick stages acquired by Rhipicephalus
(Boophilus) microplus during acute infection. J Clin Microbiol. 2007;45:426–31.
22. Howell JM, Ueti MW, Palmer GH, Scoles GA, Knowles DP. Persistently
infected calves as reservoirs for acquisition and transovarial transmission of
Babesia bovis by Rhipicephalus (Boophilus) microplus. J Clin Microbiol. 2007;
45:3155–9.
23. Mitsuhashi J. Invertebrate Tissue Culture. Tokyo: Springer; 2002. p. 358–68.
24. Patton TG, Dietrich G, Brandt K, Dolan MC, Piesman J, Gilmore RD. Saliva,
salivary gland, and hemolymph collection from Ixodes scapularis ticks. J Vis
Exp. 2012;21:3894.
25. Rodríguez I, Fraga J, Noda JA, Mayet M, Duarte Y, Echevarria E, et al. An
alternative and rapid method for the extraction of nucleic acids from ixodid
ticks by potassium acetate procedure. Braz Arch Biol Technol. 2014;57:542–7.
26. Figueroa JV, Chieves LP, Johnson GS, Buening GM. Multiplex polymerase chain
reaction based assay for the detection of Babesia bigemina, Babesia bovis and
Anaplasma marginale DNA in bovine blood. Vet Parasitol. 1993;50:69–81.
27. Oliveira-Sequeira TC, Oliveira MC, Araujo JP, Amarante AF. PCR-based
detection of Babesia bovis and Babesia bigemina in their natural host
Boophilus microplus and cattle. Int J Parasitol. 2005;35:105–11.
28. Boakye DA, Tang J, Truc P, Merriweather A, Unnasch TR. Identification of
bloodmeals in haematophagous Diptera by cytochrome B heteroduplex
analysis. Med Vet Entomol. 1999;13:282–7.
29. Folmer M, Black W, Hoeh R. Vrijenhoek R. DNA primers for amplication of
mitochondrial cytochrome c oxidase subunit I from diverse metazoan
invertebrates. Mol Mar Biol Biotechnol. 1994;3:294–9.
30. Sogin M. Amplification of ribosomal RNA genes for molecular evolution
studies. In: Innis MA, Gelfand DH, Sninsky JJ, White TJ, editors. PCR-Protocols: A
Guide to Methods and Applications. London: Academic Press; 1990.
31. Schoelkopf L, Hutchinson CE, Bendele KG, Goff WL, Willette M,
Rasmussen JM, et al. New ruminant hosts and wider geographic range
identified for Babesia odocoilei (Emerson and Wright 1970). J Wildl Dis.
2005;41:683–90.
32. Holman PJ, Carroll JE, Pugh R, Davis DS. Molecular detection of Babesia
bovis and Babesia bigemina in white-tailed deer (Odocoileus virginianus)
from Tom Green County in central Texas. Vet Parasitol. 2011;177:298–304.
33. Thompson J, Gibson T, Plewniak F, Jeanmougin F, Higgins D. The ClustalX
windows interface: Xexible strategies for multiple sequence alignment
aided by quality analysis tools. Nucleic Acids Res. 1997;25:4876–82.
34. Hall T. BioEdit: a user-friendly biological sequence alignment editor and
analysis program for Windows 95/98/NT. Nucleic Acids Symp Ser. 1999;
41:95–8.
35. Hosmer D, Lemeshow S. Applied Logistic Regression. 2nd ed. New York:
Wiley; 2005.
36. Abd Ellah MR, Hamed MI, Ibrahim DR, Rateb HZ. Serum biochemical and
haematological reference intervals for water buffalo Bubalus bubalis heifers.
J South Afr Vet Assoc. 2014;85:962.
37. Rockett J, Bosted S. Veterinary Clinical Procedures in Large Animal Practice
(Veterinary Technology). Boston: Cengage Learning; 2007.
38. Canever MF, Vieira LL, Reck C, Richter L, Miletti LC. First evaluation of an
outbreak of bovine babesiosis and anaplasmosis in southern Brazil using
multiplex PCR. Korean J Parasitol. 2014;52:507–11.
39. Paoletta MS, López Arias L, de la Fournière S, Guillemi EC, Luciani C,
Sarmiento NF, et al. Epidemiology of Babesia, Anaplasma and Trypanosoma
species using a new expanded reverse line blot hybridization assay. Ticks
Tick Borne Dis. 2017;9:155–63.
40. Ríos-Tobón S, Gutiérrez-Builes L, Ríos-Osorio L. Assessing bovine babesiosis
in Rhipicephalus (Boophilus) microplus ticks and 3 to 9-month-old cattle in
the middle Magdalena region, Colombia. Pesqui Vet Bras. 2014;34:313–9.
41. da Silva JB, André MR, da Fonseca AH, de Albuquerque Lopes CT, da Silva
Lima DH, de Andrade SJ, et al. Molecular and serological prevalence of
Babesia bovis and Babesia bigemina in water buffaloes in the north region
of Brazil. Vet Parasitol. 2013;197:678–81.

42. Ferreri L, Benitez D, Dominguez M, Rodriguez A, Asenzo G, et al. Water
buffalos as carriers of Babesia bovis in Argentina. Ann N Y Acad Sci. 2008;
1149:149–51.
43. Silveira JAG, de Oliveira CHS, Silvestre BT, Albernaz TT, Leite RC, Barbosa JD,
et al. Molecular assays reveal the presence of Theileria spp. and Babesia spp.
in Asian water buffaloes (Bubalus bubalis, Linnaeus, 1758) in the Amazon
region of Brazil. Ticks Tick Borne Dis. 2016;7:1017–23.
44. Jackson AP, Otto TD, Darby A, Ramaprasad A, Xia D, Echaide IE, et al. The
evolutionary dynamics of variant antigen genes in Babesia reveal a history
of genomic innovation underlying host-parasite interaction. Nucleic Acids
Res. 2014;42:7113–31.
45. Silva JC, Cornillot E, McCracken C, Usmani-Brown S, Dwivedi A, Ifeonu OO,
et al. Genome-wide diversity and gene expression profiling of Babesia
microti isolates identify polymorphic genes that mediate host-pathogen
interactions. Sci Rep. 2016;6:35284.
46. Guillemi E, Ruybal P, Lia V, González S, Farber M, Wilkowsky SE. Multi-locus
typing scheme for Babesia bovis and Babesia bigemina reveals high levels of
genetic variability in strains from Northern Argentina. Infect Genet Evol.
2013;14:214–22.
47. Smith RD, Evans DE, Martins JR, Ceresér VH, Correa BL, Petraccia C, et al.
Babesiosis (Babesia bovis) stability in unstable environments. Ann N Y Acad
Sci. 2000;916:510–20.
48. da Silva J, dos Santos P, Fonseca A. Molecular and serological detection of
Babesia bovis and Babesia bigemina in cattle in the Rio de Janeiro, Brazil.
Semin Cienc Agrar. 2014;35:3139.
49. Zapata R, Ramírez N, Zapata A, Vélez J, Osorio L. Seroprevalencia de
babesiosis bovina en la hacienda Vegas de la Clara, Gómez Plata
(Antioquia), 2008. Rev Med Vet. 2011;21:63–71.
50. Néo T, Giglioti R, Obregón D, Bilhassi T, Oliveira H, Machado R. Detection of
Babesia bovis and Babesia bigemina in water buffaloes (Bubalus bubalis) in
endemic areas of São Paulo state, Brazil. Open J Vet Med. 2016;6:75–84.
51. Mahmmod Y. Natural Babesia bovis infection in water buffaloes (Bubalus
bubalis) and crossbred cattle under field conditions in Egypt: a preliminary
study. J Arthropod Borne Dis. 2014;8:1–9.
52. Mingala CN, Konnai S, Cruz LC, Onuma M, Ohashi K. Comparative moleculo-
immunological analysis of swamp-and riverine-type water buffaloes
responses. Cytokine. 2009;46:273–82.
53. Aycardi E, Benavides E, Garcia O, Mateus G, Henao F, Zuluaga FN. Boophilus
microplus tick burdens on grazing cattle in Colombia. Trop Anim Health
Prod. 1984;16:78–84.
54. Salazar R. Variación de la población de garrapatas Rhipicephalus microplus
sobre bovinos pastoreando en sistemas silvopastoriles y monocultivos
tradicionales. 2017. http://www.bdigital.unal.edu.co/54614/1/32183129.2015.
pdf. Accessed 1 May 2017.
55. Oliveira MC, Oliveira-Sequeira TC, Regitano LC, Alencar MM, Néo TA, Silva
AM, et al. Detection of Babesia bigemina in cattle of different genetic
groups and in Rhipicephalus (Boophilus) microplus tick. Vet Parasitol. 2008;
155:281–6.
56. Dalgliesh RJ, Stewart NP. Some effects of time, temperature and feeding on
infection rates with Babesia bovis and Babesia bigemina in Boophilus
microplus larvae. Int J Parasitol. 1982;12:323–6.
57. Rolls PJ, Bock RE, de Vos AJ, Waldron SJ. Bovine babesiosis. OIE manual of
diagnostic tests and vaccine for terrestrial animals. Babesiosis bovina. Paris:
Work Organisation for Animal Health (OIE); 2012.
58. Mahoney DF, Ross DR. Epizootiological factors in the control of bovine
babesiosis. Aust Vet J. 1972;48:292–8.
59. Kabir M, Mondal M, Eliyas M, Mannan M, Hashem M, Debnath N, et al. An
epidemiological survey on investigation of tick infestation in cattle at
Chittagong District, Bangladesh. Afr J Microbiol Res. 2011;5:346–52.
60. Cafrune MM, Aguirre DH, Mangold AJ, Guglielmone AA. Experimental
studies of the rate of infection of Boophilus microplus eggs with Babesia
bovis. Res Vet Sci. 1995;58:284–5.

Molecular surveillance and phylogenetic traits of babesia bigemina and babesia bovis in cattle (bos taurus) and water buffaloes (bubalus bubalis) from colombia

More Related Content

What's hot(11)

Similar to Molecular surveillance and phylogenetic traits of babesia bigemina and babesia bovis in cattle (bos taurus) and water buffaloes (bubalus bubalis) from colombia(20)

More from Noor Zada(20)

Recently uploaded(20)

Molecular surveillance and phylogenetic traits of babesia bigemina and babesia bovis in cattle (bos taurus) and water buffaloes (bubalus bubalis) from colombia