This Provisional PDF corresponds to the article as it appeared upon acceptance. Fully formatted
PDF and full text (HTML) versions will be made available soon.
Overexpression of peptide deformylase in breast, colon, and lung cancers
BMC Cancer 2013, 13:321 doi:10.1186/1471-2407-13-321
Harsharan Randhawa (Harsharan.Randhawa@my.ndsu.edu)
Shireen Chikara (Shireen.Chikara@my.ndsu.edu)
Drew Gehring (drew.gehring@unmc.edu)
Tuba Yildirim (yildirimt55@gmail.com)
Jyotsana Menon (Sukumarakurup.Krishnakumar@ndsu.edu)
Katie M Reindl (Katie.Reindl@ndsu.edu)
ISSN 1471-2407
Article type Research article
Submission date 16 July 2012
Acceptance date 21 June 2013
Publication date 1 July 2013
Article URL http://www.biomedcentral.com/1471-2407/13/321
Like all articles in BMC journals, this peer-reviewed article can be downloaded, printed and
distributed freely for any purposes (see copyright notice below).
Articles in BMC journals are listed in PubMed and archived at PubMed Central.
For information about publishing your research in BMC journals or any BioMed Central journal, go to
http://www.biomedcentral.com/info/authors/
BMC Cancer
© 2013 Randhawa et al.
This is an open access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0),
which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
Overexpression of peptide deformylase in breast,
colon, and lung cancers
Harsharan Randhawa1,†
Email: Harsharan.Randhawa@my.ndsu.edu
Shireen Chikara1,†
Email: Shireen.Chikara@my.ndsu.edu
Drew Gehring1
Email: drew.gehring@unmc.edu
Tuba Yildirim2
Email: yildirimt55@gmail.com
Jyotsana Menon3
Email: Sukumarakurup.Krishnakumar@ndsu.edu
Katie M Reindl1*
*
Corresponding author
Email: Katie.Reindl@ndsu.edu
1
Department of Biological Sciences, North Dakota State University, Fargo, ND,
USA
2
Department of Biology, Faculty of Art and Science, Amasya University,
Amasya, Turkey
3
Ben May Department for Cancer Research, University of Chicago, Chicago, IL,
USA
†
Equal contributors.
Abstract
Background
Human mitochondrial peptide deformylase (PDF) has been proposed as a novel cancer
therapeutic target. However, very little is known about its expression and regulation in human
tissues. The purpose of this study was to characterize the expression pattern of PDF in
cancerous tissues and to identify mechanisms that regulate its expression.
Methods
The mRNA expression levels of PDF and methionine aminopeptidase 1D (MAP1D), an
enzyme involved in a related pathway with PDF, were determined using tissue panels
containing cDNA from patients with various types of cancer (breast, colon, kidney, liver,
lung, ovarian, prostate, or thyroid) and human cell lines. Protein levels of PDF were also
determined in 2 colon cancer patients via western blotting. Colon cancer cells were treated
with inhibitors of ERK, Akt, and mTOR signaling pathways and the resulting effects on PDF
and MAP1D mRNA levels were determined by qPCR for colon and lung cancer cell lines.
Finally, the effects of a PDF inhibitor, actinonin, on the proliferation of breast, colon, and
prostate cell lines were determined using the CyQUANT assay.
Results
PDF and MAP1D mRNA levels were elevated in cancer cell lines compared to non-cancer
lines. PDF mRNA levels were significantly increased in breast, colon, and lung cancer
samples while MAP1D mRNA levels were increased in just colon cancers. The expression of
PDF and MAP1D varied with stage in these cancers. Further, PDF protein expression was
elevated in colon cancer tissue samples. Inhibition of the MEK/ERK, but not PI3K or mTOR,
pathway reduced the expression of PDF and MAP1D in both colon and lung cancer cell lines.
Further, inhibition of PDF with actinonin resulted in greater reduction of breast, colon, and
prostate cancer cell proliferation than non-cancer cell lines.
Conclusions
This is the first report showing that PDF is over-expressed in breast, colon, and lung cancers,
and the first evidence that the MEK/ERK pathway plays a role in regulating the expression of
PDF and MAP1D. The over-expression of PDF in several cancers and the inhibition of
cancer cell growth by a PDF inhibitor suggest this enzyme may act as an oncogene to
promote cancer cell proliferation.
Background
In prokaryotic organisms, the N-terminal methionine excision (NME) pathway is
indispensible for proper protein functioning. This pathway involves two enzymes; peptide
deformylase (PDF) which removes the formyl group from the initial methionine in nascent
peptides, and methionine aminopeptidase (MAP) which subsequently removes the initial
methionine [1]. Until recently, PDF was thought to exist only in prokaryotic organisms and
hence has been the target of antimicrobial agents [2-5]. However, the recent discovery of
PDF and a MAP isoform in the mitochondria of eukaryotes raises questions regarding their
role in human cells [6-8].
Studies show that human PDF (HsPDF) can cleave the formyl group from an initiator
methionine, but with reduced kinetics compared to the prokaryotic versions of the enzyme
[2,8,9]. However, many of the respiratory Complex I peptides generated from mtDNA,
putative substrates for PDF and MAP1D, retain their formylated initiator methionine [10]. In
contrast, a recent report suggests that inhibition of PDF with actinonin results in reduced
aerobic respiratory capacity by influencing the expression of proteins derived from the
mtDNA [11].
While there are conflicting views for their role in NME in humans, it is likely PDF and
MAP1D have alternative functions. Indeed, RNA interference of MAP1D altered anchorage-
dependent growth of colon cancer cells [12] and inhibition of PDF with actinonin and
numerous analogs decreased proliferation of many cancer cells while having minimal effects
on non-cancer cell lines [13]. Further, PDF inhibitors resulted in a reduced tumor volume in a
mouse xenograft model using HL-60 [14]. These results have lead to recent studies focused
on the design of inhibitors to target PDF in cancer [14-16].
Despite these advances, little is known about the expression and regulation of the NME
enzymes in cancers. MAP1D is over-expressed in colon cancer [12], but no study has
reported the expression of PDF in cancerous compared to normal tissues. Further, no study
has described a mechanism that regulates human PDF or MAP1D expression. Therefore, the
purpose of this study was to identify the expression profiles of PDF and MAP1D in human
cancers compared to normal tissues and to identify a signaling pathway involved in
regulating their expression. Given the role of human PDF and MAP1D in cancer cell growth
and adhesion, we hypothesized that these proteins would be up-regulated in cancer cells and
tissues compared to normal and their expression would be modulated by growth-regulatory
pathways. In this paper, we report that PDF is elevated in breast, colon, and lung cancer
tissues and MAP1D is elevated in colon cancer tissue samples compared to non-cancer
controls. We also show that PDF and MAP1D mRNA expression is down-regulated when
MEK/ERK signaling is disrupted.
Methods
Cell culture
All cell lines, unless otherwise noted, were obtained from ATCC (Manassas, VA) and
cultured at 37°C with 5% carbon dioxide. Hs578Bst normal breast cells were maintained in
Hybri-Care Medium (ATCC) supplemented with 1.5 g/L sodium bicarbonate (Sigma; St.
Louis, MO), 30 ng/ml mouse EGF (BD Biosciences; San Jose, CA), and 10% fetal bovine
serum (FBS; Atlanta Biologicals; Lawrenceville, GA). Hs578T breast cancer cells were
cultured in Dulbecco's Modified Eagle's Medium (DMEM; Thermo Scientific; Waltham,
MA) supplemented with 0.01 mg/ml bovine insulin (Sigma) and 10% FBS. CCD-18Co
normal colon cells were maintained in Eagle's Minimum Essential Medium (EMEM; ATCC)
supplemented with 10% FBS. HT-29 colon cancer cells were cultured in McCoy’s 5a
(Thermo Scientific) medium supplemented with 10% FBS. Hs888Lu normal lung fibroblasts
and A549 lung cancer cells were cultured in DMEM plus 10% FBS. PrEC normal prostate
epithelial cells were obtained from Cambrex Corporation (East Rutherford, NJ) and
propagated in PrEGM media with Bulletkit growth supplements (Cambrex). PC-3 cells were
grown in Ham’s F-12 K medium supplemented with 10% FBS.
Human tissue samples and cDNA
TissueScan Cancer qPCR Arrays containing cDNA from normal and cancer tissue samples
were purchased from Origene (Rockville, MA). The cDNA panels (cancer survey panel
CSRT101, breast cancer panel BCRT101, matched colon cancer panel HCRT103, and
matched lung cancer panel HLRT104), each had 48–96 samples per microplate. Equal
loading of cDNA was verified by the manufacturer. Additionally, matched normal and colon
cancer samples were obtained from two patients at the Veteran’s Affairs (VA) Hospital in
Fargo, ND. This research was approved by the University of South Dakota and the North
Dakota State University Institutional Review Board and performed according to the ethical
guidelines imposed by these boards. Informed consent was obtained from each participant.
Total RNA was isolated from human cell lines using the Fisher SurePrep Kit (Waltham, MA)
and from human tissue samples using TRI Reagent (Molecular Research Center; Cincinnati,
OH) as per the manufacturer’s suggestions. 100 ng of total RNA were reverse transcribed
into cDNA using the qScript cDNA synthesis kit (Quanta Biosciences; Gaithersburg, MD).
Signal transduction pathway inhibitors
HT-29 colon cancer cells were seeded into a 6 well plate at 1.5 million cells per well and
incubated overnight. The next day, the cells were treated for 5 hours with 10 µM U0126, 10
µM LY294002, or 10 µM rapamycin (all from Cell Signaling). Total RNA or total protein
was collected from the cells for further analysis.
QPCR
Primers against human PDF and MAP1D were designed using Primer Express software
(Applied Biosystems; Carlsbad, CA) and synthesized by Integrated DNA Technologies
(Coralville, IA). Primer sequences were as follows; PDF forward
AGGCGCTGTGTCGGGAGTGC, PDF reverse TCTCGCAGCCCTCGGGAAAG, MAP1D
forward TATAGTTTTGCCGGCTGCAGT, MAP1D reverse
ATGTGCTTAGGAACCGGATGA, β-actin forward
CAGCCATGTACGTTGCTATCCAGG, β-actin reverse
AGGTCCAGACGCAGGATGGCATG. Steady-state mRNA levels of PDF or MAP1D were
determined for all cDNAs by real-time PCR using PerfeCTa SYBR Green FastMix (Quanta
Biosciences). The cycling parameters were 95°C for 10 min followed by 40 cycles of 95°C
for 30 sec and 60°C for 1 min and a dissociation program that included 95°C for 1 min, 55°C
for 30 sec, and 95°C for 30 sec ramping up at 0.2°C/sec. One distinct peak was observed for
the primer sets. For the cell lines, qPCR standards were prepared using human PDF and
MAP1D full-length cDNA clones from Open Biosystems (Catalog numbers IHS1380-
97652083 and MHS4426-99238965, Huntsville, AL). The 1010
molecules/µL standard was
serially diluted to 102
molecules/µL. The standards were run alongside the cDNA from the
human cell lines in order to approximate the copy number of PDF or MAP1D in these cells.
For the cDNA panels, fold-change in mRNA expression was calculated by comparing
normalized threshold cycle numbers (CT) in the cancerous tissue compared to the normal
tissues. The cell experiments were performed triplicate.
SDS-PAGE and western blotting
Cell pellets or human tissue samples from the VA Hospital were lysed using an SDS lysis
buffer (Cell Signaling Technologies, Danvers, MA) containing protease and phosphatases
inhibitors (Roche; Indianapolis, IN). Samples were briefly sonicated to dissociate cell
membranes. Fifty µg of total protein isolated from the human cell lines or tissues were
separated on 10% SDS-polyacrylamide gels at 100 V for 1 hr. Proteins were transferred to
nitrocellulose membranes at 100 V for 75 min at 4°C. Blots were then probed overnight at
4°C with primary antibodies. The PDF antibody was a kind gift from Carmela Giglione and
Thierry Meinnel (Centre National de la Recherche Scientifique, Gif-sur-Yvette, France). The
MAP1D antibody was obtained from R&D Systems (Minneapolis, MN). The total and
phosphor-ERK antibodies were purchased from Cell Signaling. The next day, blots were
rinsed with 1X TBS-tween (0.1%) and probed with anti-rabbit secondary antibody (Jackson
Immuno Research; West Grove, PA) for 1 hr at room temperature. The western blots were
analyzed using SuperSignal West Pico Chemiluminescent Substrate (Thermo Fisher
Scientific; Rockford, IL) and images captured using the MultiImage™ Light Cabinet (Alpha
Innotech; San Leandro, CA). PDF levels were normalized to β-actin (Cell Signaling)
expression. Immunoblots were performed in triplicate.
Toxicity assay
Hs578Bst, Hs578T, CCD-18Co, HT-29, PrEC, and PC-3 cells were plated in 96-well
microplates in growth medium at a density of 5,000 cells/well and incubated for 24 hours.
The cells were then treated for 4 days with 0–250 uM actinonin. The CyQUANT (Life
Technologies; Grand Island, NY) cell proliferation assay was performed according to the
manufacturer’s instructions. Fluorescent readings were taken on day 4 to determine the
percentage of viable cells. Each condition was performed with eight replicates, and the
experiments were repeated three times.
Statistical analysis
SigmaPlot v12 software (Systat Software Inc.; Chicago, IL) was used for all statistical
analyses. For all tests, a p-value cut-off of < 0.05 was used to determine statistical
significance. For the cell lines, the PDF and MAP1D values were related to the standard
curves for the respective targets to yield the approximate mRNA copy number/cell. These
values were then normalized to β-actin values. The data are expressed as the average copy
number ± SD for 3 replicates. A t-test comparing the PDF or MAP1D mRNA copy number in
the cancer cell lines to the copy number in their respective normal cell lines. For the cancer
tissue cDNA plates, the average Ct value for all of the non-cancer tissue samples was set to 1.
The data are expressed as the relative fold change in each individual sample compared to the
average of these controls. A t-test was run for PDF mRNA expression in the cancer survey
samples compared to their non-cancer controls. One-way ANOVA on ranks was done using
Dunn’s method for multiple comparisons in the cancer stage I-III breast, colon, and lung
samples compared to their normal tissues. A paired t-test was done to compare the effect of
actinonin on the proliferation of the cancer cell line to the normal cell line. The data represent
the percentage of viable cells ± SD for 8 replicates. Finally, a t-test was used to determine the
effect of U0126 on the expression of PDF and MAP1D mRNA in 3 independent replicates.
Results
PDF and MAP1D expression is elevated in human cancer cell lines
We compared the expression of PDF and MAP1D in four different types (breast, colon, lung,
and prostate) of cancer cell lines to non-cancer cell lines. PDF mRNA expression was
significantly higher in the HT-29 colon, A549 lung, and PC-3 prostate cancer cell lines
compared to the CCD-18Co colon, Hs888Lu lung, and PrEC prostate non-cancer cell lines
(Figure 1). MAP1D was significantly elevated in the PC-3 compared to PrEC cell line, but
was not significantly different in the other pairs of cell lines (Figure 1). The Hs578Bst and
Hs578T cell lines are a normal breast and breast cancer cell line isolated from the same
patient. These cell lines did not significantly differ in their PDF or MAP1D expression,
although PDF was slightly elevated and MAP1D was reduced. The data suggest that PDF and
MAP1D expression varies across cell type and that they show altered expression in cancer
compared to non-cancer cells.
Figure 1 PDF and MAP1D mRNA expression varies across human cell lines. The
expression of PDF and MAP1D mRNA in normal breast (Hs578Bst), colon (CCD-18Co),
lung (Hs888Lu), and prostate (PrEC) cell lines was compared to the expression in breast
cancer (Hs578T), colon cancer (HT29), lung cancer (A549), and prostate cancer (PC3) cell
lines, respectively. The mRNA copy numbers for PDF and MAP1D were related to cDNA
standards for these two genes and then normalized to β-actin levels. PDF was significantly
(denoted by “a”) elevated in the colon, lung, and prostate cancer cell lines compared to their
respective normal cell lines while MAP1D was significantly (denoted by “b”) elevated only
in the prostate cancer cell line. The data represent the average mRNA copy number for 3
replicate experiments ± SD.
Actinonin inhibits the growth of both cancer and non-cancer cell lines
The effect of the PDF inhibitor actinonin on the proliferation capacity of colon, breast, and
prostate cancer and non-cancer cell lines was measured. Actinonin inhibited the proliferation
of both cancer and non-cancer cell lines in a concentration-dependent manner, but had greater
inhibition of cell proliferation in cancer cells compared to non-cancer cells (Figure 2A-C).
The IC50’s were 19.3, 17.3, and 113.5 µM for the Hs578T, HT-29, and PC-3 cancer cell lines,
respectively while the IC50’s were 208, 31.9, and 207.4 µM for the Hs578Bst, CCD-18Co,
and PrEC cells, respectively. While the IC50 was higher in the normal colon compared to the
colon cancer cell line, the difference in the percentage of viable cells was not statistically
significant. In contrast, actinonin significantly affected the growth of breast and prostate
cancer cells compared to their non-cancer cell controls. In general, the data suggest that
inhibition of PDF by actinonin has a greater effect on proliferation of cancer cells compared
to normal cells.
Figure 2 Actinonin inhibits the growth of cancer cell lines to a greater degree than non-
cancer cell lines. (A) Normal breast (Hs578Bst) and breast cancer (Hs578T), (B) normal
colon (CCD18Co) and colon cancer (HT29), and (C) normal prostate (PrEC) and prostate
cancer (PC3) cell lines were treated with 0–250 µM actinonin for 96 hrs before the
percentage of viable cells was determined. The growth-inhibitory effect of actinonin was
significantly greater in the breast cancer and prostate cancer cell lines than in their non-cancer
control cell lines. The data represent the percentage of viable cells ± SD for 3 experiments
with 8 replicates each.
PDF mRNA is elevated in many cancer tissues
TissueScanTM
Cancer qPCR Arrays containing cDNA from 96 tissue samples representing
eight different cancers (breast, colon, kidney, liver, lung, ovary, prostate, thyroid) were used
to determine PDF expression in cancer compared to non-cancer tissues. For each tissue type,
the array contained 3 normal control tissues and 9 cancer tissues. With the exception of liver
cancer that showed no change compared to control liver samples, PDF was at least slightly
elevated in all cancer tissues compared to control, and PDF mRNA levels were significantly
elevated in the breast, colon, and lung cancer tissue samples compared to their non-cancer
samples (Figure 3). Breast cancer showed a 5.8-fold increase in expression of PDF while
colon and lung showed a 3.5 and 3.4-fold increase in PDF expression, respectively.
Figure 3 PDF mRNA is significantly elevated in breast, colon, and lung cancer. With the
exception of liver, that showed equal expression, PDF was elevated in all cancers (●)
compared to non-cancer/normal (○) tissues. All stages of disease were pooled for the cancer
groups. Statistically significant differences (*) were observed in breast, colon, and lung
cancers with expression values 5.8, 3.5, and 3.4-fold higher in cancer compared to normal
tissues, respectively.
Additional tissue panels for breast, colon, and lung cancer patients were used to validate the
previous results and to assess MAP1D levels in these cancer types. Colon and lung tissue
panels contained 48 matched normal and cancer tissue samples from 24 cancer patients while
the breast tissue panels contained 48 unmatched tissue samples that included 12 normal
breast tissue controls and 36 breast cancer samples at various disease stages. Similar to the
first results, PDF was elevated in breast, colon, and lung cancer samples and showed stage-
dependent expression with the highest expression in late stage breast cancer, but early stage
colon and lung cancers (Figure 4A). MAP1D mRNA expression was elevated in early-stage
colon cancer samples, and was surprisingly reduced in breast cancer samples compared to
control samples (Figure 4B). There was no significant change in MAP1D mRNA levels in
lung cancer samples at any stage compared to control. These results suggest PDF and
MAP1D expression is altered in certain cancer tissues and that expression of these enzymes is
correlated with the stage of disease.
Figure 4 PDF and MAP1D mRNA expression varies with stage in breast, colon, and
lung cancer samples. (A) PDF and (B) MAP1D mRNA expression is shown for normal (●)
tissues relative to stage I (○), stage II (▼), and stage III (∆) tissues for breast, colon, and lung
cancer patients. PDF levels are significantly (*) elevated in late-stage breast, and early-stage
colon and lung cancers while MAP1D levels are significantly increased in early-stage colon
cancer, but decreased in breast cancer.
PDF protein levels are elevated in colon cancer tissues
To verify that the increased PDF mRNA levels translated to increased PDF protein levels, we
screened two sets of colon cancer tissues for PDF expression. Matched colon cancer and
normal colon tissue sets were obtained from two patients at the VA Hospital in Fargo, ND in
accordance with IRB policies. Western blotting for PDF revealed a striking elevation of PDF
expression in the tumor sample of both of these patients relative to their matched normal
colon tissue (Figure 5).
Figure 5 PDF protein expression is elevated in colon tumor tissues. Western blotting was
done to determine the expression of PDF in colon cancer tissue samples (T) relative to
normal colon tissue (N) from two patients. Elevated PDF levels were found in the colon
tumor samples for each patient. A β-actin antibody was used to confirm equal protein loading
of the tissue samples for each patient. Two replicate experiments were performed and this
image shows one representative experiment.
Inhibition of MEK/ERK results in reduced expression of PDF and MAP1D in
colon cancer cells
The regulation of PDF or MAP1D expression in human cells has not been previously studied.
To understand potential mechanisms that regulate PDF and MAP1D gene expression, we
used pharmacological inhibitors to target the MEK/ERK, PI3K, and mTOR signaling
pathways and determined their effects on PDF or MAP1D expression. Treatment of HT-29
colon cancer cells with the MEK inhibitor U0126 resulted in a 51% reduction in expression
of PDF mRNA and a 47% reduction in MAP1D (Figure 6A). Western blotting confirmed that
U0126 inhibited ERK signalling these cells (Figure 6B). Unlike U0126, the PI3K inhibitor
LY294002 and mTOR inhibitor rapamycin did not have an effect on PDF expression in HT-
29 cells (Figure 6C).
Figure 6 Inhibition of MEK down-regulates PDF and MAP1D mRNA expression in
colon cancer cells. (A) Treatment of HT-29 colon cancer cells with 10 µM U0126 for 5 hr
resulted in about a 50% reduction in both PDF and MAP1D mRNA expression. (B) Western
blot analysis confirmed that 5 hr treatment of HT-29 colon cancer cells with 10 µM U0126
reduced phosphorylated ERK (pERK) levels. Total ERK (tERK) expression was determined
in order to show equal protein loading. (C) Treatment of HT-29 cells with other inhibitors
Ly294002 (LY) and rapamycin (Rap) does not affect PDF mRNA expression. These
experiments were repeated 3 times and the data represent the average relative gene
expression in the inhibitor-treated cells relative to the vehicle-treated controls. Statistically
significant (p < 0.05) differences are denoted by *.
Discussion
PDF and MAP are essential enzymes in prokaryotic peptide synthesis, but their role in
eukaryotic cells is less appreciated. Previous studies have suggested PDF and MAP1D as
therapeutic targets for cancer treatment given their roles in modulating cell proliferation,
adhesion, and aerobic respiration [11-13]. As a result, the goal of this research was to
characterize the expression pattern of PDF and MAP1D in human cancer tissues in order to
better understand their potential roles in these cancers.
Over-expression of MAP1D has been previously observed in colon cancer tissues; 7 out of 8
colon cancer patients showed increased MAP1D mRNA expression and 9 out of 12 patients
showed increased MAP1D protein expression [12]. Similarly, we also found that MAP1D
was elevated in colon cancers, but not lung cancers. Interestingly we found that MAP1D
mRNA expression was significantly reduced in breast cancer samples compared to normal
breast tissue. This is the first report to suggest PDF is over-expressed in cancer, particularly
breast, colon, and lung. Stage-dependent expression of PDF was observed in the tissue
samples where higher expression was found in early stages of colon and lung cancer, but later
stages of breast cancer. Early expression of PDF indicates it plays a role in the proliferation
of tumor cells. The over-expression of PDF and MAP1D, particularly in early-stage colon
cancer, suggests that these enzymes are important for cancer cell growth.
PDF and MAP1D are encoded in the nuclear genome (chromosome 16 and 2, respectively)
and translocate to mitochondria [14]. It was interesting to find that the expression of both
HsPDF and MAP1D was regulated by a similar pathway. Use of the MEK inhibitor U0126
resulted in about a 50% reduction in PDF and MAP1D expression in a human colon cell line.
Conversely, rapamycin and LY294002 had little effect on PDF expression suggesting the
MEK/ERK pathway specifically contributes to the expression of NME enzymes. A genetic
and functional linkage of PDF and MAP1D has been shown in other animal genomes
suggesting the tight regulation of NME activity in eukaryotic mitochondria (Serero et al.,
2003). The involvement of a growth-regulatory pathway in modulating PDF expression,
provides further support that PDF promotes the growth of tumors and lends support to the
pursuit of PDF inhibitors as cancer therapies.
Lee et al. showed that the PDF inhibitor actinonin selectively inhibited the proliferation of
numerous cancer cell lines while having a minimal effect on the growth of non-cancer cell
lines [13]. Similarly, our data show that actinonin had significantly greater growth-inhibitory
effects on breast and prostate cancer cells than non-cancer cell lines. These results suggest
that PDF does play a role in the growth of cancer cells and may offer a selective target for
cancer treatment.
Conclusions
In conclusion, we found that PDF is up-regulated in several cancer types including breast,
colon, and lung. Our data suggest that the MEK/ERK pathway contributes to the expression
of PDF and MAP1D colon cancer cells. Finally, we demonstrated that the PDF inhibitor
actinonin inhibits the growth of cancer cell lines to a greater degree than non-cancer cell
lines. These data suggest that PDF and MAP1D may function as oncogenes to promote tumor
development and are potential selective targets for colon cancer therapy.
Abbreviations
(ERK), Extracellular-signal-regulated kinase; (MAP), Methionine aminopeptidase; (MEK),
Mitogen-activated protein kinase kinase; (mtDNA), Mitochondrial DNA; (mTOR),
Mammalian target of rapamycin; (NME), N-terminal methionine excision; (PDF), Peptide
deformylase; (PI3K), Phosphatidylinositol 3-kinase
Competing interests
The authors have no competing interests in relation to this paper.
Authors' contributions
KR conceived, designed, and performed mRNA expression and actinonin experiments,
analyzed the data, and wrote the manuscript. HR and SC performed mRNA and protein
expression experiments, analyzed the data, and wrote the manuscript. DG and TY conducted
gene regulation experiments using the signaling molecule inhibitors and analyzed the data.
JM assisted with the design of the expression and regulation experiments and data analysis.
All authors read and approved the final manuscript.
Acknowledgements
We are very grateful to Carmela Giglione and Thierry Meinnel of the Centre National de la
Recherche Scientifique, Gif-sur-Yvette, France for kindly providing the PDF antibody. We
would like to thank the Veteran’s Affairs Hospital in Fargo, ND and their research staff Jodie
Haring, Candice Nelson, Jessica Clairmont, William Becker, Mark Jensen, and Edward
Sauter for their help collecting the human colon cancer tissues for this study. This study was
supported by 2P20 RR015566 from the National Center for Research Resources (NCRR), a
component of the National Institutes of Health (NIH) to KMR and the NDSU Department of
Biological Sciences.
References
1. Solbiati J, Chapman-Smith A, Miller JL, Miller CG, Cronan JE Jr: Processing of the N
termini of nascent polypeptide chains requires deformylation prior to methionine
removal. J Mol Biol 1999, 290(3):607–614.
2. Nguyen KT, Hu X, Colton C, Chakrabarti R, Zhu MX, Pei D: Characterization of a
human peptide deformylase: implications for antibacterial drug design. Biochemistry
2003, 42(33):9952–9958.
3. Giglione C, Meinnel T: Peptide deformylase as an emerging target for antiparasitic
agents. Expert Opin Ther Targets 2001, 5(1):41–57.
4. Giglione C, Pierre M, Meinnel T: Peptide deformylase as a target for new generation,
broad spectrum antimicrobial agents. Mol Microbiol 2000, 36(6):1197–1205.
5. Leeds JA, Dean CR: Peptide deformylase as an antibacterial target: a critical
assessment. Curr Opin Pharmacol 2006, 6(5):445–452.
6. Giglione C, Serero A, Pierre M, Boisson B, Meinnel T: Identification of eukaryotic
peptide deformylases reveals universality of N-terminal protein processing mechanisms.
EMBO J 2000, 19(21):5916–5929.
7. Serero A, Giglione C, Meinnel T: Distinctive features of the two classes of eukaryotic
peptide deformylases. J Mol Biol 2001, 314(4):695–708.
8. Serero A, Giglione C, Sardini A, Martinez-Sanz J, Meinnel T: An unusual peptide
deformylase features in the human mitochondrial N-terminal methionine excision
pathway. J Biol Chem 2003, 278(52):52953–52963.
9. Lee MD, Antczak C, Li Y, Sirotnak FM, Bornmann WG, Scheinberg DA: A new human
peptide deformylase inhibitable by actinonin. Biochem Biophys Res Commun 2003,
312(2):309–315.
10. Carroll J, Fearnley IM, Walker JE: Definition of the mitochondrial proteome by
measurement of molecular masses of membrane proteins. Proc Natl Acad Sci USA 2006,
103(44):16170–16175.
11. Escobar-Alvarez S, Gardner J, Sheth A, Manfredi G, Yang G, Ouerfelli O, Heaney ML,
Scheinberg DA: Inhibition of human peptide deformylase disrupts mitochondrial
function. Mol Cell Biol 2010, 30(21):5099–5109.
12. Leszczyniecka M, Bhatia U, Cueto M, Nirmala NR, Towbin H, Vattay A, Wang B,
Zabludoff S, Phillips PE: MAP1D, a novel methionine aminopeptidase family member is
overexpressed in colon cancer. Oncogene 2006, 25(24):3471–3478.
13. Lee MD, She Y, Soskis MJ, Borella CP, Gardner JR, Hayes PA, Dy BM, Heaney ML,
Philips MR, Bornmann WG, et al: Human mitochondrial peptide deformylase, a new
anticancer target of actinonin-based antibiotics. J Clin Invest 2004, 114(8):1107–1116.
14. Antczak C, Shum D, Bassit B, Frattini MG, Li Y, Stanchina E, Scheinberg DA, Djaballah
H: Identification of benzofuran-4,5-diones as novel and selective non-hydroxamic acid,
non-peptidomimetic based inhibitors of human peptide deformylase. Bioorg Med Chem
Lett 2011, 21(15):4528–4532.
15. Antczak C, Shum D, Escobar S, Bassit B, Kim E, Seshan VE, Wu N, Yang G, Ouerfelli
O, Li YM, et al: High-throughput identification of inhibitors of human mitochondrial
peptide deformylase. J Biomol Screen 2007, 12(4):521–535.
16. Escobar-Alvarez S, Goldgur Y, Yang G, Ouerfelli O, Li Y, Scheinberg DA: Structure
and activity of human mitochondrial peptide deformylase, a novel cancer target. J Mol
Biol 2009, 387(5):1211–1228.
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5
Figure 6

More Related Content

PDF
Frizzled-8 receptor is activated by the Wnt-2 ligand in non-small cell lung c...
PDF
Roles of circular rn as and their interactions with micro rnas in human disor...
PDF
A review of micro rn as related to the occurrence, diagnosis, and prognosis o...
PDF
The Presence and Persistence of Resistant and Stem Cell-Like Tumor Cells as a...
PDF
Genomic oncology and personalized medicine
PDF
Abnormal expression of Pygopus 2 correlates with a malignant phenotype in hum...
PDF
Lnc rna nnt as1 affect progesterone resistance by regulating mir-542-3p or su...
PPTX
Nigella sativa bioactives against Non-Small Cell Lung Cancer & Breast Cancer
Frizzled-8 receptor is activated by the Wnt-2 ligand in non-small cell lung c...
Roles of circular rn as and their interactions with micro rnas in human disor...
A review of micro rn as related to the occurrence, diagnosis, and prognosis o...
The Presence and Persistence of Resistant and Stem Cell-Like Tumor Cells as a...
Genomic oncology and personalized medicine
Abnormal expression of Pygopus 2 correlates with a malignant phenotype in hum...
Lnc rna nnt as1 affect progesterone resistance by regulating mir-542-3p or su...
Nigella sativa bioactives against Non-Small Cell Lung Cancer & Breast Cancer

What's hot (20)

PDF
Sequencing 60,000 Samples: An Innovative Large Cohort Study for Breast Cancer...
PPTX
APPLICATION OF NEXT GENERATION SEQUENCING (NGS) IN CANCER TREATMENT
PPTX
NGS in cancer treatment
PDF
Genes and Tissue Culture Technology - Next Generation Sequencing - Applicatio...
PDF
Metanalisys
PPTX
Assessing the clinical utility of cancer genomic and proteomic data across tu...
PPTX
Proteogenomic analysis of human colon cancer reveals new therapeutic opportun...
PDF
Clinical Genomics for Personalized Cancer Medicine: Recent Advances, Challeng...
PDF
20140711 5 s_pond_ercc2.0_workshop
PDF
JLS-064-077-MASTANEH-ABNORMAL-PATIENTS(1)
PDF
Alternative lengthening of telomeres is enriched in, and impacts survival of ...
PPT
Role of tp53 mutations in therapy related acute myeloid leukaemia(t-aml)
PDF
PDL1 Regulation by p53 via miR-34 publication
PDF
Lancet Oncology 2004
PDF
Discoidin receptors a proteomic portret
PDF
The Application of Next Generation Sequencing (NGS) in cancer treatment
PPTX
Osteoblasts remotely supply lung tumors with cancer-promoting SiglecFhigh neu...
PDF
HDAC4 and HDAC7 Promote Breast and Ovarian Cancer Cell Migration by Regulatin...
PDF
Molecular Detection of Epstein-Barr Virus and Human Cytomegalovirus Antigen E...
Sequencing 60,000 Samples: An Innovative Large Cohort Study for Breast Cancer...
APPLICATION OF NEXT GENERATION SEQUENCING (NGS) IN CANCER TREATMENT
NGS in cancer treatment
Genes and Tissue Culture Technology - Next Generation Sequencing - Applicatio...
Metanalisys
Assessing the clinical utility of cancer genomic and proteomic data across tu...
Proteogenomic analysis of human colon cancer reveals new therapeutic opportun...
Clinical Genomics for Personalized Cancer Medicine: Recent Advances, Challeng...
20140711 5 s_pond_ercc2.0_workshop
JLS-064-077-MASTANEH-ABNORMAL-PATIENTS(1)
Alternative lengthening of telomeres is enriched in, and impacts survival of ...
Role of tp53 mutations in therapy related acute myeloid leukaemia(t-aml)
PDL1 Regulation by p53 via miR-34 publication
Lancet Oncology 2004
Discoidin receptors a proteomic portret
The Application of Next Generation Sequencing (NGS) in cancer treatment
Osteoblasts remotely supply lung tumors with cancer-promoting SiglecFhigh neu...
HDAC4 and HDAC7 Promote Breast and Ovarian Cancer Cell Migration by Regulatin...
Molecular Detection of Epstein-Barr Virus and Human Cytomegalovirus Antigen E...
Ad

Viewers also liked (20)

PDF
Guía para descubrir Twitter
PDF
Post-diagnosis hemoglobin change associates with overall survival of multiple...
PPT
Social Media Strategy for International NGOs &amp; Universities
PDF
Off Label Spanish
PDF
Organic Gardening for Primary Schools
PDF
Nitroglycerin 0.4% ointment vs placebo in the treatment of pain resulting fro...
PDF
Anti-lymphangiogenic properties of mTOR inhibitors in head and neck squamous ...
PDF
The cysteinyl leukotriene 2 receptor contributes to all-trans retinoic acid-i...
PDF
Sox2 suppresses the invasiveness of breast cancer cells via a mechanism that ...
PDF
Perceived benefits and barriers to exercise for recently treated patients wit...
PDF
Fatty liver index correlates with non-alcoholic fatty liver disease, but not ...
PDF
Sticky siRNAs targeting survivin and cyclin B1 exert an antitumoral effect on...
PDF
Chemokine (C-X-C) ligand 1 (CXCL1) protein expression is increased in aggress...
PDF
Intensity-modulated radiotherapy with simultaneous modulated accelerated boos...
PDF
Intraepithelial lymphocyte distribution differs between the bulb and the seco...
PDF
Antibiotic exposure and the development of coeliac disease: a nationwide case...
PDF
Association between variations in the fat mass and obesity-associated gene an...
PDF
Clinical features and outcome of cryptogenic hepatocellular carcinoma compare...
PDF
A phase I/II trial to evaluate the safety, feasibility and activity of salvag...
PDF
Implication from thyroid function decreasing during chemotherapy in breast ca...
Guía para descubrir Twitter
Post-diagnosis hemoglobin change associates with overall survival of multiple...
Social Media Strategy for International NGOs &amp; Universities
Off Label Spanish
Organic Gardening for Primary Schools
Nitroglycerin 0.4% ointment vs placebo in the treatment of pain resulting fro...
Anti-lymphangiogenic properties of mTOR inhibitors in head and neck squamous ...
The cysteinyl leukotriene 2 receptor contributes to all-trans retinoic acid-i...
Sox2 suppresses the invasiveness of breast cancer cells via a mechanism that ...
Perceived benefits and barriers to exercise for recently treated patients wit...
Fatty liver index correlates with non-alcoholic fatty liver disease, but not ...
Sticky siRNAs targeting survivin and cyclin B1 exert an antitumoral effect on...
Chemokine (C-X-C) ligand 1 (CXCL1) protein expression is increased in aggress...
Intensity-modulated radiotherapy with simultaneous modulated accelerated boos...
Intraepithelial lymphocyte distribution differs between the bulb and the seco...
Antibiotic exposure and the development of coeliac disease: a nationwide case...
Association between variations in the fat mass and obesity-associated gene an...
Clinical features and outcome of cryptogenic hepatocellular carcinoma compare...
A phase I/II trial to evaluate the safety, feasibility and activity of salvag...
Implication from thyroid function decreasing during chemotherapy in breast ca...
Ad

Similar to Overexpression of peptide deformylase in breast, colon, and lung cancers (20)

PDF
Advances in Cancer Research 80 1st Edition George F. Vande Woude (Editor)
PDF
CancerResearch2003
PDF
Role of Wnt Signaling in Cancer
PPTX
Epidermal growth factor and its receptor tyrosine kinase
PPTX
Mutagenic signal transduction (5)
PPTX
Coloncancer3
PDF
Advances in Cancer Research 80 1st Edition George F. Vande Woude (Editor)
PDF
Hallmarks of cancer and radiopharmaceuticals
PPTX
Epidermal growth factor(egf)
PDF
New stratigies for_combating_cancer
PDF
Current Topics in Developmental Biology Vol 78 1st Edition Gerald P. Schatten...
PDF
Coloncancer3
PDF
Patel_et_al-2016-Journal_of_Cellular_and_Molecular_Medicine
PDF
The expression of ITPK in normal colon and colorectal cancer cells - Paper
PPT
Dr. Carlos García Echeverría - Simposio Internacional 'Terapias oncológicas a...
PDF
Ccn Proteins In Health And Disease An Overview Of The Fifth International Wor...
PDF
ncomms8821-최종본
PPTX
N fk b signaling in cancer
PPT
Giovanni Blandino: geni e tumori
PDF
Alterazioni molecolari come bersaglio per la terapia in osteosarcoma metastat...
Advances in Cancer Research 80 1st Edition George F. Vande Woude (Editor)
CancerResearch2003
Role of Wnt Signaling in Cancer
Epidermal growth factor and its receptor tyrosine kinase
Mutagenic signal transduction (5)
Coloncancer3
Advances in Cancer Research 80 1st Edition George F. Vande Woude (Editor)
Hallmarks of cancer and radiopharmaceuticals
Epidermal growth factor(egf)
New stratigies for_combating_cancer
Current Topics in Developmental Biology Vol 78 1st Edition Gerald P. Schatten...
Coloncancer3
Patel_et_al-2016-Journal_of_Cellular_and_Molecular_Medicine
The expression of ITPK in normal colon and colorectal cancer cells - Paper
Dr. Carlos García Echeverría - Simposio Internacional 'Terapias oncológicas a...
Ccn Proteins In Health And Disease An Overview Of The Fifth International Wor...
ncomms8821-최종본
N fk b signaling in cancer
Giovanni Blandino: geni e tumori
Alterazioni molecolari come bersaglio per la terapia in osteosarcoma metastat...

More from Enrique Moreno Gonzalez (20)

PDF
Incidence of pneumonia and risk factors among patients with head and neck can...
PDF
Gene expression analysis of a Helicobacter pyloriinfected and high-salt diet-...
PDF
Overexpression of primary microRNA 221/222 in acute myeloid leukemia
PDF
1471 2407-13-363
PDF
Differences in microRNA expression during tumor development in the transition...
PDF
Multicentric and multifocal versus unifocal breast cancer: differences in the...
PDF
The life in sight application study (LISA): design of a randomized controlled...
PDF
Clinical and experimental studies regarding the expression and diagnostic val...
PDF
Assessment of preoperative exercise capacity in hepatocellular carcinoma pati...
PDF
Overexpression of YAP 1 contributes to progressive features and poor prognosi...
PDF
CXCR7 is induced by hypoxia and mediates glioma cell migration towards SDF-1a...
PDF
Differentiation of irradiation and cetuximab induced skin reactions in patien...
PDF
Cholestasis induces reversible accumulation of periplakin in mouse liver
PDF
Disruption of focal adhesion kinase and p53 interaction with small molecule c...
PDF
Functional p53 is required for rapid restoration of daunorubicin-induced lesi...
PDF
Cost-effectiveness of MRI for breast cancer screening in BRCA1/2 mutation car...
PDF
Impaired mitochondrial beta-oxidation in patients with chronic hepatitis C: r...
PDF
Laudatio padrino
PDF
Optimal schedule of Bacillus Calmette-Guerin for non-muscle-invasive bladder ...
PDF
Effects of hypoxia on human cancer cell line chemosensitivity
Incidence of pneumonia and risk factors among patients with head and neck can...
Gene expression analysis of a Helicobacter pyloriinfected and high-salt diet-...
Overexpression of primary microRNA 221/222 in acute myeloid leukemia
1471 2407-13-363
Differences in microRNA expression during tumor development in the transition...
Multicentric and multifocal versus unifocal breast cancer: differences in the...
The life in sight application study (LISA): design of a randomized controlled...
Clinical and experimental studies regarding the expression and diagnostic val...
Assessment of preoperative exercise capacity in hepatocellular carcinoma pati...
Overexpression of YAP 1 contributes to progressive features and poor prognosi...
CXCR7 is induced by hypoxia and mediates glioma cell migration towards SDF-1a...
Differentiation of irradiation and cetuximab induced skin reactions in patien...
Cholestasis induces reversible accumulation of periplakin in mouse liver
Disruption of focal adhesion kinase and p53 interaction with small molecule c...
Functional p53 is required for rapid restoration of daunorubicin-induced lesi...
Cost-effectiveness of MRI for breast cancer screening in BRCA1/2 mutation car...
Impaired mitochondrial beta-oxidation in patients with chronic hepatitis C: r...
Laudatio padrino
Optimal schedule of Bacillus Calmette-Guerin for non-muscle-invasive bladder ...
Effects of hypoxia on human cancer cell line chemosensitivity

Recently uploaded (20)

PPTX
IND is a submission to the food and drug administration (FDA), requesting per...
PPTX
PARASYMPATHETIC NERVOUS SYSTEM and its correlation with HEART .pptx
PPTX
المحاضرة الثالثة Urosurgery (Inflammation).pptx
PPTX
AWMI case presentation ppt AWMI case presentation ppt
PPTX
Methods of population control Community Medicine
PPTX
Hypertensive disorders in pregnancy.pptx
PDF
NCM-107-LEC-REVIEWER.pdf 555555555555555
PPTX
CASE PRESENTATION CLUB FOOT management.pptx
PPTX
DIARRHOEA IN CHILDREN presented to COG.ppt
PPTX
Biostatistics Lecture Notes_Dadason.pptx
PPTX
Pharynx and larynx -4.............pptx
PPTX
PRE ECLAPSIA AND ECLAPSIA presentation-1.pptx
PPT
intrduction to nephrologDDDDDDDDDy lec1.ppt
PPTX
abgs and brain death dr js chinganga.pptx
PDF
Diabetes mellitus - AMBOSS.pdf
PPTX
Critical Issues in Periodontal Research- An overview
PPTX
01. cell injury-2018_11_19 -student copy.pptx
PPTX
SUMMARY OF EAR, NOSE AND THROAT DISORDERS INCLUDING DEFINITION, CAUSES, CLINI...
PPT
ANTI-HYPERTENSIVE PHARMACOLOGY Department.ppt
PPTX
Tuberculosis : NTEP and recent updates (2024)
IND is a submission to the food and drug administration (FDA), requesting per...
PARASYMPATHETIC NERVOUS SYSTEM and its correlation with HEART .pptx
المحاضرة الثالثة Urosurgery (Inflammation).pptx
AWMI case presentation ppt AWMI case presentation ppt
Methods of population control Community Medicine
Hypertensive disorders in pregnancy.pptx
NCM-107-LEC-REVIEWER.pdf 555555555555555
CASE PRESENTATION CLUB FOOT management.pptx
DIARRHOEA IN CHILDREN presented to COG.ppt
Biostatistics Lecture Notes_Dadason.pptx
Pharynx and larynx -4.............pptx
PRE ECLAPSIA AND ECLAPSIA presentation-1.pptx
intrduction to nephrologDDDDDDDDDy lec1.ppt
abgs and brain death dr js chinganga.pptx
Diabetes mellitus - AMBOSS.pdf
Critical Issues in Periodontal Research- An overview
01. cell injury-2018_11_19 -student copy.pptx
SUMMARY OF EAR, NOSE AND THROAT DISORDERS INCLUDING DEFINITION, CAUSES, CLINI...
ANTI-HYPERTENSIVE PHARMACOLOGY Department.ppt
Tuberculosis : NTEP and recent updates (2024)

Overexpression of peptide deformylase in breast, colon, and lung cancers

  • 1. This Provisional PDF corresponds to the article as it appeared upon acceptance. Fully formatted PDF and full text (HTML) versions will be made available soon. Overexpression of peptide deformylase in breast, colon, and lung cancers BMC Cancer 2013, 13:321 doi:10.1186/1471-2407-13-321 Harsharan Randhawa ([email protected]) Shireen Chikara ([email protected]) Drew Gehring ([email protected]) Tuba Yildirim ([email protected]) Jyotsana Menon ([email protected]) Katie M Reindl ([email protected]) ISSN 1471-2407 Article type Research article Submission date 16 July 2012 Acceptance date 21 June 2013 Publication date 1 July 2013 Article URL http://www.biomedcentral.com/1471-2407/13/321 Like all articles in BMC journals, this peer-reviewed article can be downloaded, printed and distributed freely for any purposes (see copyright notice below). Articles in BMC journals are listed in PubMed and archived at PubMed Central. For information about publishing your research in BMC journals or any BioMed Central journal, go to http://www.biomedcentral.com/info/authors/ BMC Cancer © 2013 Randhawa et al. This is an open access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
  • 2. Overexpression of peptide deformylase in breast, colon, and lung cancers Harsharan Randhawa1,† Email: [email protected] Shireen Chikara1,† Email: [email protected] Drew Gehring1 Email: [email protected] Tuba Yildirim2 Email: [email protected] Jyotsana Menon3 Email: [email protected] Katie M Reindl1* * Corresponding author Email: [email protected] 1 Department of Biological Sciences, North Dakota State University, Fargo, ND, USA 2 Department of Biology, Faculty of Art and Science, Amasya University, Amasya, Turkey 3 Ben May Department for Cancer Research, University of Chicago, Chicago, IL, USA † Equal contributors. Abstract Background Human mitochondrial peptide deformylase (PDF) has been proposed as a novel cancer therapeutic target. However, very little is known about its expression and regulation in human tissues. The purpose of this study was to characterize the expression pattern of PDF in cancerous tissues and to identify mechanisms that regulate its expression. Methods The mRNA expression levels of PDF and methionine aminopeptidase 1D (MAP1D), an enzyme involved in a related pathway with PDF, were determined using tissue panels containing cDNA from patients with various types of cancer (breast, colon, kidney, liver, lung, ovarian, prostate, or thyroid) and human cell lines. Protein levels of PDF were also
  • 3. determined in 2 colon cancer patients via western blotting. Colon cancer cells were treated with inhibitors of ERK, Akt, and mTOR signaling pathways and the resulting effects on PDF and MAP1D mRNA levels were determined by qPCR for colon and lung cancer cell lines. Finally, the effects of a PDF inhibitor, actinonin, on the proliferation of breast, colon, and prostate cell lines were determined using the CyQUANT assay. Results PDF and MAP1D mRNA levels were elevated in cancer cell lines compared to non-cancer lines. PDF mRNA levels were significantly increased in breast, colon, and lung cancer samples while MAP1D mRNA levels were increased in just colon cancers. The expression of PDF and MAP1D varied with stage in these cancers. Further, PDF protein expression was elevated in colon cancer tissue samples. Inhibition of the MEK/ERK, but not PI3K or mTOR, pathway reduced the expression of PDF and MAP1D in both colon and lung cancer cell lines. Further, inhibition of PDF with actinonin resulted in greater reduction of breast, colon, and prostate cancer cell proliferation than non-cancer cell lines. Conclusions This is the first report showing that PDF is over-expressed in breast, colon, and lung cancers, and the first evidence that the MEK/ERK pathway plays a role in regulating the expression of PDF and MAP1D. The over-expression of PDF in several cancers and the inhibition of cancer cell growth by a PDF inhibitor suggest this enzyme may act as an oncogene to promote cancer cell proliferation. Background In prokaryotic organisms, the N-terminal methionine excision (NME) pathway is indispensible for proper protein functioning. This pathway involves two enzymes; peptide deformylase (PDF) which removes the formyl group from the initial methionine in nascent peptides, and methionine aminopeptidase (MAP) which subsequently removes the initial methionine [1]. Until recently, PDF was thought to exist only in prokaryotic organisms and hence has been the target of antimicrobial agents [2-5]. However, the recent discovery of PDF and a MAP isoform in the mitochondria of eukaryotes raises questions regarding their role in human cells [6-8]. Studies show that human PDF (HsPDF) can cleave the formyl group from an initiator methionine, but with reduced kinetics compared to the prokaryotic versions of the enzyme [2,8,9]. However, many of the respiratory Complex I peptides generated from mtDNA, putative substrates for PDF and MAP1D, retain their formylated initiator methionine [10]. In contrast, a recent report suggests that inhibition of PDF with actinonin results in reduced aerobic respiratory capacity by influencing the expression of proteins derived from the mtDNA [11]. While there are conflicting views for their role in NME in humans, it is likely PDF and MAP1D have alternative functions. Indeed, RNA interference of MAP1D altered anchorage- dependent growth of colon cancer cells [12] and inhibition of PDF with actinonin and numerous analogs decreased proliferation of many cancer cells while having minimal effects on non-cancer cell lines [13]. Further, PDF inhibitors resulted in a reduced tumor volume in a
  • 4. mouse xenograft model using HL-60 [14]. These results have lead to recent studies focused on the design of inhibitors to target PDF in cancer [14-16]. Despite these advances, little is known about the expression and regulation of the NME enzymes in cancers. MAP1D is over-expressed in colon cancer [12], but no study has reported the expression of PDF in cancerous compared to normal tissues. Further, no study has described a mechanism that regulates human PDF or MAP1D expression. Therefore, the purpose of this study was to identify the expression profiles of PDF and MAP1D in human cancers compared to normal tissues and to identify a signaling pathway involved in regulating their expression. Given the role of human PDF and MAP1D in cancer cell growth and adhesion, we hypothesized that these proteins would be up-regulated in cancer cells and tissues compared to normal and their expression would be modulated by growth-regulatory pathways. In this paper, we report that PDF is elevated in breast, colon, and lung cancer tissues and MAP1D is elevated in colon cancer tissue samples compared to non-cancer controls. We also show that PDF and MAP1D mRNA expression is down-regulated when MEK/ERK signaling is disrupted. Methods Cell culture All cell lines, unless otherwise noted, were obtained from ATCC (Manassas, VA) and cultured at 37°C with 5% carbon dioxide. Hs578Bst normal breast cells were maintained in Hybri-Care Medium (ATCC) supplemented with 1.5 g/L sodium bicarbonate (Sigma; St. Louis, MO), 30 ng/ml mouse EGF (BD Biosciences; San Jose, CA), and 10% fetal bovine serum (FBS; Atlanta Biologicals; Lawrenceville, GA). Hs578T breast cancer cells were cultured in Dulbecco's Modified Eagle's Medium (DMEM; Thermo Scientific; Waltham, MA) supplemented with 0.01 mg/ml bovine insulin (Sigma) and 10% FBS. CCD-18Co normal colon cells were maintained in Eagle's Minimum Essential Medium (EMEM; ATCC) supplemented with 10% FBS. HT-29 colon cancer cells were cultured in McCoy’s 5a (Thermo Scientific) medium supplemented with 10% FBS. Hs888Lu normal lung fibroblasts and A549 lung cancer cells were cultured in DMEM plus 10% FBS. PrEC normal prostate epithelial cells were obtained from Cambrex Corporation (East Rutherford, NJ) and propagated in PrEGM media with Bulletkit growth supplements (Cambrex). PC-3 cells were grown in Ham’s F-12 K medium supplemented with 10% FBS. Human tissue samples and cDNA TissueScan Cancer qPCR Arrays containing cDNA from normal and cancer tissue samples were purchased from Origene (Rockville, MA). The cDNA panels (cancer survey panel CSRT101, breast cancer panel BCRT101, matched colon cancer panel HCRT103, and matched lung cancer panel HLRT104), each had 48–96 samples per microplate. Equal loading of cDNA was verified by the manufacturer. Additionally, matched normal and colon cancer samples were obtained from two patients at the Veteran’s Affairs (VA) Hospital in Fargo, ND. This research was approved by the University of South Dakota and the North Dakota State University Institutional Review Board and performed according to the ethical guidelines imposed by these boards. Informed consent was obtained from each participant. Total RNA was isolated from human cell lines using the Fisher SurePrep Kit (Waltham, MA) and from human tissue samples using TRI Reagent (Molecular Research Center; Cincinnati,
  • 5. OH) as per the manufacturer’s suggestions. 100 ng of total RNA were reverse transcribed into cDNA using the qScript cDNA synthesis kit (Quanta Biosciences; Gaithersburg, MD). Signal transduction pathway inhibitors HT-29 colon cancer cells were seeded into a 6 well plate at 1.5 million cells per well and incubated overnight. The next day, the cells were treated for 5 hours with 10 µM U0126, 10 µM LY294002, or 10 µM rapamycin (all from Cell Signaling). Total RNA or total protein was collected from the cells for further analysis. QPCR Primers against human PDF and MAP1D were designed using Primer Express software (Applied Biosystems; Carlsbad, CA) and synthesized by Integrated DNA Technologies (Coralville, IA). Primer sequences were as follows; PDF forward AGGCGCTGTGTCGGGAGTGC, PDF reverse TCTCGCAGCCCTCGGGAAAG, MAP1D forward TATAGTTTTGCCGGCTGCAGT, MAP1D reverse ATGTGCTTAGGAACCGGATGA, β-actin forward CAGCCATGTACGTTGCTATCCAGG, β-actin reverse AGGTCCAGACGCAGGATGGCATG. Steady-state mRNA levels of PDF or MAP1D were determined for all cDNAs by real-time PCR using PerfeCTa SYBR Green FastMix (Quanta Biosciences). The cycling parameters were 95°C for 10 min followed by 40 cycles of 95°C for 30 sec and 60°C for 1 min and a dissociation program that included 95°C for 1 min, 55°C for 30 sec, and 95°C for 30 sec ramping up at 0.2°C/sec. One distinct peak was observed for the primer sets. For the cell lines, qPCR standards were prepared using human PDF and MAP1D full-length cDNA clones from Open Biosystems (Catalog numbers IHS1380- 97652083 and MHS4426-99238965, Huntsville, AL). The 1010 molecules/µL standard was serially diluted to 102 molecules/µL. The standards were run alongside the cDNA from the human cell lines in order to approximate the copy number of PDF or MAP1D in these cells. For the cDNA panels, fold-change in mRNA expression was calculated by comparing normalized threshold cycle numbers (CT) in the cancerous tissue compared to the normal tissues. The cell experiments were performed triplicate. SDS-PAGE and western blotting Cell pellets or human tissue samples from the VA Hospital were lysed using an SDS lysis buffer (Cell Signaling Technologies, Danvers, MA) containing protease and phosphatases inhibitors (Roche; Indianapolis, IN). Samples were briefly sonicated to dissociate cell membranes. Fifty µg of total protein isolated from the human cell lines or tissues were separated on 10% SDS-polyacrylamide gels at 100 V for 1 hr. Proteins were transferred to nitrocellulose membranes at 100 V for 75 min at 4°C. Blots were then probed overnight at 4°C with primary antibodies. The PDF antibody was a kind gift from Carmela Giglione and Thierry Meinnel (Centre National de la Recherche Scientifique, Gif-sur-Yvette, France). The MAP1D antibody was obtained from R&D Systems (Minneapolis, MN). The total and phosphor-ERK antibodies were purchased from Cell Signaling. The next day, blots were rinsed with 1X TBS-tween (0.1%) and probed with anti-rabbit secondary antibody (Jackson Immuno Research; West Grove, PA) for 1 hr at room temperature. The western blots were analyzed using SuperSignal West Pico Chemiluminescent Substrate (Thermo Fisher Scientific; Rockford, IL) and images captured using the MultiImage™ Light Cabinet (Alpha
  • 6. Innotech; San Leandro, CA). PDF levels were normalized to β-actin (Cell Signaling) expression. Immunoblots were performed in triplicate. Toxicity assay Hs578Bst, Hs578T, CCD-18Co, HT-29, PrEC, and PC-3 cells were plated in 96-well microplates in growth medium at a density of 5,000 cells/well and incubated for 24 hours. The cells were then treated for 4 days with 0–250 uM actinonin. The CyQUANT (Life Technologies; Grand Island, NY) cell proliferation assay was performed according to the manufacturer’s instructions. Fluorescent readings were taken on day 4 to determine the percentage of viable cells. Each condition was performed with eight replicates, and the experiments were repeated three times. Statistical analysis SigmaPlot v12 software (Systat Software Inc.; Chicago, IL) was used for all statistical analyses. For all tests, a p-value cut-off of < 0.05 was used to determine statistical significance. For the cell lines, the PDF and MAP1D values were related to the standard curves for the respective targets to yield the approximate mRNA copy number/cell. These values were then normalized to β-actin values. The data are expressed as the average copy number ± SD for 3 replicates. A t-test comparing the PDF or MAP1D mRNA copy number in the cancer cell lines to the copy number in their respective normal cell lines. For the cancer tissue cDNA plates, the average Ct value for all of the non-cancer tissue samples was set to 1. The data are expressed as the relative fold change in each individual sample compared to the average of these controls. A t-test was run for PDF mRNA expression in the cancer survey samples compared to their non-cancer controls. One-way ANOVA on ranks was done using Dunn’s method for multiple comparisons in the cancer stage I-III breast, colon, and lung samples compared to their normal tissues. A paired t-test was done to compare the effect of actinonin on the proliferation of the cancer cell line to the normal cell line. The data represent the percentage of viable cells ± SD for 8 replicates. Finally, a t-test was used to determine the effect of U0126 on the expression of PDF and MAP1D mRNA in 3 independent replicates. Results PDF and MAP1D expression is elevated in human cancer cell lines We compared the expression of PDF and MAP1D in four different types (breast, colon, lung, and prostate) of cancer cell lines to non-cancer cell lines. PDF mRNA expression was significantly higher in the HT-29 colon, A549 lung, and PC-3 prostate cancer cell lines compared to the CCD-18Co colon, Hs888Lu lung, and PrEC prostate non-cancer cell lines (Figure 1). MAP1D was significantly elevated in the PC-3 compared to PrEC cell line, but was not significantly different in the other pairs of cell lines (Figure 1). The Hs578Bst and Hs578T cell lines are a normal breast and breast cancer cell line isolated from the same patient. These cell lines did not significantly differ in their PDF or MAP1D expression, although PDF was slightly elevated and MAP1D was reduced. The data suggest that PDF and MAP1D expression varies across cell type and that they show altered expression in cancer compared to non-cancer cells.
  • 7. Figure 1 PDF and MAP1D mRNA expression varies across human cell lines. The expression of PDF and MAP1D mRNA in normal breast (Hs578Bst), colon (CCD-18Co), lung (Hs888Lu), and prostate (PrEC) cell lines was compared to the expression in breast cancer (Hs578T), colon cancer (HT29), lung cancer (A549), and prostate cancer (PC3) cell lines, respectively. The mRNA copy numbers for PDF and MAP1D were related to cDNA standards for these two genes and then normalized to β-actin levels. PDF was significantly (denoted by “a”) elevated in the colon, lung, and prostate cancer cell lines compared to their respective normal cell lines while MAP1D was significantly (denoted by “b”) elevated only in the prostate cancer cell line. The data represent the average mRNA copy number for 3 replicate experiments ± SD. Actinonin inhibits the growth of both cancer and non-cancer cell lines The effect of the PDF inhibitor actinonin on the proliferation capacity of colon, breast, and prostate cancer and non-cancer cell lines was measured. Actinonin inhibited the proliferation of both cancer and non-cancer cell lines in a concentration-dependent manner, but had greater inhibition of cell proliferation in cancer cells compared to non-cancer cells (Figure 2A-C). The IC50’s were 19.3, 17.3, and 113.5 µM for the Hs578T, HT-29, and PC-3 cancer cell lines, respectively while the IC50’s were 208, 31.9, and 207.4 µM for the Hs578Bst, CCD-18Co, and PrEC cells, respectively. While the IC50 was higher in the normal colon compared to the colon cancer cell line, the difference in the percentage of viable cells was not statistically significant. In contrast, actinonin significantly affected the growth of breast and prostate cancer cells compared to their non-cancer cell controls. In general, the data suggest that inhibition of PDF by actinonin has a greater effect on proliferation of cancer cells compared to normal cells. Figure 2 Actinonin inhibits the growth of cancer cell lines to a greater degree than non- cancer cell lines. (A) Normal breast (Hs578Bst) and breast cancer (Hs578T), (B) normal colon (CCD18Co) and colon cancer (HT29), and (C) normal prostate (PrEC) and prostate cancer (PC3) cell lines were treated with 0–250 µM actinonin for 96 hrs before the percentage of viable cells was determined. The growth-inhibitory effect of actinonin was significantly greater in the breast cancer and prostate cancer cell lines than in their non-cancer control cell lines. The data represent the percentage of viable cells ± SD for 3 experiments with 8 replicates each. PDF mRNA is elevated in many cancer tissues TissueScanTM Cancer qPCR Arrays containing cDNA from 96 tissue samples representing eight different cancers (breast, colon, kidney, liver, lung, ovary, prostate, thyroid) were used to determine PDF expression in cancer compared to non-cancer tissues. For each tissue type, the array contained 3 normal control tissues and 9 cancer tissues. With the exception of liver cancer that showed no change compared to control liver samples, PDF was at least slightly elevated in all cancer tissues compared to control, and PDF mRNA levels were significantly elevated in the breast, colon, and lung cancer tissue samples compared to their non-cancer samples (Figure 3). Breast cancer showed a 5.8-fold increase in expression of PDF while colon and lung showed a 3.5 and 3.4-fold increase in PDF expression, respectively. Figure 3 PDF mRNA is significantly elevated in breast, colon, and lung cancer. With the exception of liver, that showed equal expression, PDF was elevated in all cancers (●)
  • 8. compared to non-cancer/normal (○) tissues. All stages of disease were pooled for the cancer groups. Statistically significant differences (*) were observed in breast, colon, and lung cancers with expression values 5.8, 3.5, and 3.4-fold higher in cancer compared to normal tissues, respectively. Additional tissue panels for breast, colon, and lung cancer patients were used to validate the previous results and to assess MAP1D levels in these cancer types. Colon and lung tissue panels contained 48 matched normal and cancer tissue samples from 24 cancer patients while the breast tissue panels contained 48 unmatched tissue samples that included 12 normal breast tissue controls and 36 breast cancer samples at various disease stages. Similar to the first results, PDF was elevated in breast, colon, and lung cancer samples and showed stage- dependent expression with the highest expression in late stage breast cancer, but early stage colon and lung cancers (Figure 4A). MAP1D mRNA expression was elevated in early-stage colon cancer samples, and was surprisingly reduced in breast cancer samples compared to control samples (Figure 4B). There was no significant change in MAP1D mRNA levels in lung cancer samples at any stage compared to control. These results suggest PDF and MAP1D expression is altered in certain cancer tissues and that expression of these enzymes is correlated with the stage of disease. Figure 4 PDF and MAP1D mRNA expression varies with stage in breast, colon, and lung cancer samples. (A) PDF and (B) MAP1D mRNA expression is shown for normal (●) tissues relative to stage I (○), stage II (▼), and stage III (∆) tissues for breast, colon, and lung cancer patients. PDF levels are significantly (*) elevated in late-stage breast, and early-stage colon and lung cancers while MAP1D levels are significantly increased in early-stage colon cancer, but decreased in breast cancer. PDF protein levels are elevated in colon cancer tissues To verify that the increased PDF mRNA levels translated to increased PDF protein levels, we screened two sets of colon cancer tissues for PDF expression. Matched colon cancer and normal colon tissue sets were obtained from two patients at the VA Hospital in Fargo, ND in accordance with IRB policies. Western blotting for PDF revealed a striking elevation of PDF expression in the tumor sample of both of these patients relative to their matched normal colon tissue (Figure 5). Figure 5 PDF protein expression is elevated in colon tumor tissues. Western blotting was done to determine the expression of PDF in colon cancer tissue samples (T) relative to normal colon tissue (N) from two patients. Elevated PDF levels were found in the colon tumor samples for each patient. A β-actin antibody was used to confirm equal protein loading of the tissue samples for each patient. Two replicate experiments were performed and this image shows one representative experiment. Inhibition of MEK/ERK results in reduced expression of PDF and MAP1D in colon cancer cells The regulation of PDF or MAP1D expression in human cells has not been previously studied. To understand potential mechanisms that regulate PDF and MAP1D gene expression, we used pharmacological inhibitors to target the MEK/ERK, PI3K, and mTOR signaling pathways and determined their effects on PDF or MAP1D expression. Treatment of HT-29
  • 9. colon cancer cells with the MEK inhibitor U0126 resulted in a 51% reduction in expression of PDF mRNA and a 47% reduction in MAP1D (Figure 6A). Western blotting confirmed that U0126 inhibited ERK signalling these cells (Figure 6B). Unlike U0126, the PI3K inhibitor LY294002 and mTOR inhibitor rapamycin did not have an effect on PDF expression in HT- 29 cells (Figure 6C). Figure 6 Inhibition of MEK down-regulates PDF and MAP1D mRNA expression in colon cancer cells. (A) Treatment of HT-29 colon cancer cells with 10 µM U0126 for 5 hr resulted in about a 50% reduction in both PDF and MAP1D mRNA expression. (B) Western blot analysis confirmed that 5 hr treatment of HT-29 colon cancer cells with 10 µM U0126 reduced phosphorylated ERK (pERK) levels. Total ERK (tERK) expression was determined in order to show equal protein loading. (C) Treatment of HT-29 cells with other inhibitors Ly294002 (LY) and rapamycin (Rap) does not affect PDF mRNA expression. These experiments were repeated 3 times and the data represent the average relative gene expression in the inhibitor-treated cells relative to the vehicle-treated controls. Statistically significant (p < 0.05) differences are denoted by *. Discussion PDF and MAP are essential enzymes in prokaryotic peptide synthesis, but their role in eukaryotic cells is less appreciated. Previous studies have suggested PDF and MAP1D as therapeutic targets for cancer treatment given their roles in modulating cell proliferation, adhesion, and aerobic respiration [11-13]. As a result, the goal of this research was to characterize the expression pattern of PDF and MAP1D in human cancer tissues in order to better understand their potential roles in these cancers. Over-expression of MAP1D has been previously observed in colon cancer tissues; 7 out of 8 colon cancer patients showed increased MAP1D mRNA expression and 9 out of 12 patients showed increased MAP1D protein expression [12]. Similarly, we also found that MAP1D was elevated in colon cancers, but not lung cancers. Interestingly we found that MAP1D mRNA expression was significantly reduced in breast cancer samples compared to normal breast tissue. This is the first report to suggest PDF is over-expressed in cancer, particularly breast, colon, and lung. Stage-dependent expression of PDF was observed in the tissue samples where higher expression was found in early stages of colon and lung cancer, but later stages of breast cancer. Early expression of PDF indicates it plays a role in the proliferation of tumor cells. The over-expression of PDF and MAP1D, particularly in early-stage colon cancer, suggests that these enzymes are important for cancer cell growth. PDF and MAP1D are encoded in the nuclear genome (chromosome 16 and 2, respectively) and translocate to mitochondria [14]. It was interesting to find that the expression of both HsPDF and MAP1D was regulated by a similar pathway. Use of the MEK inhibitor U0126 resulted in about a 50% reduction in PDF and MAP1D expression in a human colon cell line. Conversely, rapamycin and LY294002 had little effect on PDF expression suggesting the MEK/ERK pathway specifically contributes to the expression of NME enzymes. A genetic and functional linkage of PDF and MAP1D has been shown in other animal genomes suggesting the tight regulation of NME activity in eukaryotic mitochondria (Serero et al., 2003). The involvement of a growth-regulatory pathway in modulating PDF expression, provides further support that PDF promotes the growth of tumors and lends support to the pursuit of PDF inhibitors as cancer therapies.
  • 10. Lee et al. showed that the PDF inhibitor actinonin selectively inhibited the proliferation of numerous cancer cell lines while having a minimal effect on the growth of non-cancer cell lines [13]. Similarly, our data show that actinonin had significantly greater growth-inhibitory effects on breast and prostate cancer cells than non-cancer cell lines. These results suggest that PDF does play a role in the growth of cancer cells and may offer a selective target for cancer treatment. Conclusions In conclusion, we found that PDF is up-regulated in several cancer types including breast, colon, and lung. Our data suggest that the MEK/ERK pathway contributes to the expression of PDF and MAP1D colon cancer cells. Finally, we demonstrated that the PDF inhibitor actinonin inhibits the growth of cancer cell lines to a greater degree than non-cancer cell lines. These data suggest that PDF and MAP1D may function as oncogenes to promote tumor development and are potential selective targets for colon cancer therapy. Abbreviations (ERK), Extracellular-signal-regulated kinase; (MAP), Methionine aminopeptidase; (MEK), Mitogen-activated protein kinase kinase; (mtDNA), Mitochondrial DNA; (mTOR), Mammalian target of rapamycin; (NME), N-terminal methionine excision; (PDF), Peptide deformylase; (PI3K), Phosphatidylinositol 3-kinase Competing interests The authors have no competing interests in relation to this paper. Authors' contributions KR conceived, designed, and performed mRNA expression and actinonin experiments, analyzed the data, and wrote the manuscript. HR and SC performed mRNA and protein expression experiments, analyzed the data, and wrote the manuscript. DG and TY conducted gene regulation experiments using the signaling molecule inhibitors and analyzed the data. JM assisted with the design of the expression and regulation experiments and data analysis. All authors read and approved the final manuscript. Acknowledgements We are very grateful to Carmela Giglione and Thierry Meinnel of the Centre National de la Recherche Scientifique, Gif-sur-Yvette, France for kindly providing the PDF antibody. We would like to thank the Veteran’s Affairs Hospital in Fargo, ND and their research staff Jodie Haring, Candice Nelson, Jessica Clairmont, William Becker, Mark Jensen, and Edward Sauter for their help collecting the human colon cancer tissues for this study. This study was supported by 2P20 RR015566 from the National Center for Research Resources (NCRR), a component of the National Institutes of Health (NIH) to KMR and the NDSU Department of Biological Sciences.
  • 11. References 1. Solbiati J, Chapman-Smith A, Miller JL, Miller CG, Cronan JE Jr: Processing of the N termini of nascent polypeptide chains requires deformylation prior to methionine removal. J Mol Biol 1999, 290(3):607–614. 2. Nguyen KT, Hu X, Colton C, Chakrabarti R, Zhu MX, Pei D: Characterization of a human peptide deformylase: implications for antibacterial drug design. Biochemistry 2003, 42(33):9952–9958. 3. Giglione C, Meinnel T: Peptide deformylase as an emerging target for antiparasitic agents. Expert Opin Ther Targets 2001, 5(1):41–57. 4. Giglione C, Pierre M, Meinnel T: Peptide deformylase as a target for new generation, broad spectrum antimicrobial agents. Mol Microbiol 2000, 36(6):1197–1205. 5. Leeds JA, Dean CR: Peptide deformylase as an antibacterial target: a critical assessment. Curr Opin Pharmacol 2006, 6(5):445–452. 6. Giglione C, Serero A, Pierre M, Boisson B, Meinnel T: Identification of eukaryotic peptide deformylases reveals universality of N-terminal protein processing mechanisms. EMBO J 2000, 19(21):5916–5929. 7. Serero A, Giglione C, Meinnel T: Distinctive features of the two classes of eukaryotic peptide deformylases. J Mol Biol 2001, 314(4):695–708. 8. Serero A, Giglione C, Sardini A, Martinez-Sanz J, Meinnel T: An unusual peptide deformylase features in the human mitochondrial N-terminal methionine excision pathway. J Biol Chem 2003, 278(52):52953–52963. 9. Lee MD, Antczak C, Li Y, Sirotnak FM, Bornmann WG, Scheinberg DA: A new human peptide deformylase inhibitable by actinonin. Biochem Biophys Res Commun 2003, 312(2):309–315. 10. Carroll J, Fearnley IM, Walker JE: Definition of the mitochondrial proteome by measurement of molecular masses of membrane proteins. Proc Natl Acad Sci USA 2006, 103(44):16170–16175. 11. Escobar-Alvarez S, Gardner J, Sheth A, Manfredi G, Yang G, Ouerfelli O, Heaney ML, Scheinberg DA: Inhibition of human peptide deformylase disrupts mitochondrial function. Mol Cell Biol 2010, 30(21):5099–5109. 12. Leszczyniecka M, Bhatia U, Cueto M, Nirmala NR, Towbin H, Vattay A, Wang B, Zabludoff S, Phillips PE: MAP1D, a novel methionine aminopeptidase family member is overexpressed in colon cancer. Oncogene 2006, 25(24):3471–3478. 13. Lee MD, She Y, Soskis MJ, Borella CP, Gardner JR, Hayes PA, Dy BM, Heaney ML, Philips MR, Bornmann WG, et al: Human mitochondrial peptide deformylase, a new anticancer target of actinonin-based antibiotics. J Clin Invest 2004, 114(8):1107–1116.
  • 12. 14. Antczak C, Shum D, Bassit B, Frattini MG, Li Y, Stanchina E, Scheinberg DA, Djaballah H: Identification of benzofuran-4,5-diones as novel and selective non-hydroxamic acid, non-peptidomimetic based inhibitors of human peptide deformylase. Bioorg Med Chem Lett 2011, 21(15):4528–4532. 15. Antczak C, Shum D, Escobar S, Bassit B, Kim E, Seshan VE, Wu N, Yang G, Ouerfelli O, Li YM, et al: High-throughput identification of inhibitors of human mitochondrial peptide deformylase. J Biomol Screen 2007, 12(4):521–535. 16. Escobar-Alvarez S, Goldgur Y, Yang G, Ouerfelli O, Li Y, Scheinberg DA: Structure and activity of human mitochondrial peptide deformylase, a novel cancer target. J Mol Biol 2009, 387(5):1211–1228.