SlideShare a Scribd company logo
1© Cloudera, Inc. All rights reserved.
The Redemptive Power of Hadoop
Sean Owen | @sean_r_owen
Scaling Up Genomics with Spark
2© Cloudera, Inc. All rights reserved.
What is genomics?
3© Cloudera, Inc. All rights reserved.
Organism Cell Genome
4© Cloudera, Inc. All rights reserved.
5© Cloudera, Inc. All rights reserved.
Reference chromosome
Location
6© Cloudera, Inc. All rights reserved.
“… decoding the Book of Life”
7© Cloudera, Inc. All rights reserved.
8© Cloudera, Inc. All rights reserved.
9© Cloudera, Inc. All rights reserved.
10© Cloudera, Inc. All rights reserved.
11© Cloudera, Inc. All rights reserved.
12© Cloudera, Inc. All rights reserved.
13© Cloudera, Inc. All rights reserved.
>read1
TTGGACATTTCGGGGTCTCAGATT
>read2
AATGTTGTTAGAGATCCGGGATTT
>read3
GGATTCCCCGCCGTTTGAGAGCCT
>read4
AGGTTGGTACCGCGAAAAGCGCAT
Bioinformatics!
14© Cloudera, Inc. All rights reserved.
Alignment Dedup Recalibrate QC/Filter
Variant
Calling
Variant
Annotation
Pipelines!
15© Cloudera, Inc. All rights reserved.
C
HPC (scheduler)
POSIX filesystem
Java
HPC (Queue)
POSIX filesystem
C++
Single-node
SQLite
It’s file formats all the way down!
16© Cloudera, Inc. All rights reserved.
##fileformat=VCFv4.1
##fileDate=20090805
##source=myImputationProgramV3.1
##reference=file:///seq/references/1000GenomesPilot-NCBI36.fasta
##contig=<ID=20,length=62435964,assembly=B36,md5=f126cdf8a6e0c7f379d618ff66beb2da,species="Homo sapiens",taxonomy=x>
##phasing=partial
##INFO=<ID=NS,Number=1,Type=Integer,Description="Number of Samples With Data">
##INFO=<ID=DP,Number=1,Type=Integer,Description="Total Depth">
##INFO=<ID=AF,Number=A,Type=Float,Description="Allele Frequency">
##INFO=<ID=AA,Number=1,Type=String,Description="Ancestral Allele">
##INFO=<ID=DB,Number=0,Type=Flag,Description="dbSNP membership, build 129">
##INFO=<ID=H2,Number=0,Type=Flag,Description="HapMap2 membership">
##FILTER=<ID=q10,Description="Quality below 10">
##FILTER=<ID=s50,Description="Less than 50% of samples have data">
##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype">
##FORMAT=<ID=GQ,Number=1,Type=Integer,Description="Genotype Quality">
##FORMAT=<ID=DP,Number=1,Type=Integer,Description="Read Depth">
##FORMAT=<ID=HQ,Number=2,Type=Integer,Description="Haplotype Quality">
#CHROM POS ID REF ALT QUAL FILTER INFO FORMAT NA00001 NA00002 NA00003
20 14370 rs6054257 G A 29 PASS NS=3;DP=14;AF=0.5;DB;H2 GT:GQ:DP:HQ 0|0:48:1:51,51 1|0:48:8:51,51 1/1:43:5:.,.
20 17330 . T A 3 q10 NS=3;DP=11;AF=0.017 GT:GQ:DP:HQ 0|0:49:3:58,50 0|1:3:5:65,3 0/0:41:3
20 1110696 rs6040355 A G,T 67 PASS NS=2;DP=10;AF=0.333,0.667 GT:GQ:DP:HQ 1|2:21:6:23,27 2|1:2:0:18,2 2/2:35:4
20 1230237 . T . 47 PASS NS=3;DP=13;AA=T GT:GQ:DP:HQ 0|0:54:7:56,60 0|0:48:4:51,51 0/0:61:2
Compressed text files (non-splittable)
Semi-structured
Poorly specified
Global sort order
17© Cloudera, Inc. All rights reserved.
/**
* Main work method. Reads the BAM file once and collects sorted information about
* the 5' ends of both ends of each read (or just one end in the case of pairs).
* Then makes a pass through those determining duplicates before re-reading the
* input file and writing it out with duplication flags set correctly.
*/
protected int doWork() {
// build some data structures
buildSortedReadEndLists(useBarcodes);
generateDuplicateIndexes(useBarcodes);
final SAMFileWriter out =
new SAMFileWriterFactory().makeSAMOrBAMWriter(outputHeader, true, OUTPUT);
final CloseableIterator<SAMRecord> iterator = headerAndIterator.iterator;
while (iterator.hasNext()) {
final SAMRecord rec = iterator.next();
if (!rec.isSecondaryOrSupplementary()) {
if (recordInFileIndex == nextDuplicateIndex) {
rec.setDuplicateReadFlag(true);
// Now try and figure out the next duplicate index
if (this.duplicateIndexes.hasNext()) {
nextDuplicateIndex = this.duplicateIndexes.next();
} else {
// Only happens once we've marked all the duplicates
nextDuplicateIndex = -1;
}
} else {
Method
Code
18© Cloudera, Inc. All rights reserved.
@Option(shortName = "MAX_FILE_HANDLES",
doc = "Maximum number of file handles to keep open when spilling " +
"read ends to disk. Set this number a little lower than the " +
"per-process maximum number of file that may be open. This " +
"number can be found by executing the 'ulimit -n' command on " +
"a Unix system.")
public int MAX_FILE_HANDLES_FOR_READ_ENDS_MAP = 8000;
Dedup
Method
Code
Platform
19© Cloudera, Inc. All rights reserved.
Alignment Dedup Recalibrate QC/Filter
Variant
Calling
Variant
Annotation
20© Cloudera, Inc. All rights reserved.
It’s pipelines all the way down!
Alignment Dedup Recalibrate QC/Filter
Variant
Calling
Variant
Annotation
Node 1
Alignment Dedup Recalibrate QC/Filter
Variant
Calling
Variant
Annotation
Node 2
Alignment Dedup Recalibrate QC/Filter
Variant
Calling
Variant
Annotation
Node 3
21© Cloudera, Inc. All rights reserved.
22© Cloudera, Inc. All rights reserved.
Alignment Dedup Recalibrate QC/Filter
Variant
Calling
Variant
Annotation
Alignment Dedup Recalibrate QC/Filter
Alignment Dedup Recalibrate QC/Filter
23© Cloudera, Inc. All rights reserved.
Node 1
Alignment Dedup Recalibrate QC/Filter
Variant
Calling
Variant
Annotation
Node 2
Node 3
Alignment Dedup Recalibrate QC/Filter
Alignment Dedup Recalibrate QC/Filter
Node 4
24© Cloudera, Inc. All rights reserved.
Node 1
Alignment Dedup QC/Filter
Variant
Calling
Variant
Annotation
Node 2
Node 3
Alignment Dedup QC/Filter
Alignment Dedup QC/Filter
Node 4
Recalibrate
25© Cloudera, Inc. All rights reserved.
Why Are We Still Defining File Formats By Hand?
• Instead of defining custom file
formats for each data type and
access pattern…
• Parquet creates a compressed
format for each Avro-defined
data model
• Improvements over existing
formats
• ~20% for BAM
• ~90% for VCF
26© Cloudera, Inc. All rights reserved.
YARN-managed
Hadoop cluster
Spark
executors
𝑗=1
𝑑 𝑖
𝑃(𝑏𝑖𝑗|𝑒𝑖𝑗, 𝑓𝑖)
𝑗=1
𝑑 𝑖
𝑃(𝑏𝑖𝑗|𝑒𝑖𝑗, 𝑓𝑖)
𝑗=1
𝑑 𝑖
𝑃(𝑏𝑖𝑗|𝑒𝑖𝑗, 𝑓𝑖)Partial sums
𝑖=1
𝑁
𝑗=1
𝑑 𝑖
𝑃(𝑏𝑖𝑗|𝑒𝑖𝑗, 𝑓𝑖)
Driver
Application
code
ContEst Algorithm
27© Cloudera, Inc. All rights reserved.
Hadoop provides layered abstractions for data processing
HDFS (scalable, distributed storage)
YARN (resource management)
MapReduce Impala (SQL) Solr (search) Spark
ADAMquince guacamole …
bdg-formats(Avro/Parquet)
28© Cloudera, Inc. All rights reserved.
Executing query in Hadoop: interactive Spark shell (ADAM)
def inDbSnp(g: Genotype): Boolean = true or false
def isDeleterious(g: Genotype): Boolean = g.getPolyPhen
val samples = sc.textFile("path/to/samples").map(parseJson(_)).collect()
val dbsnp = sc.textFile("path/to/dbSNP").map(_.split(",")).collect()
val dnaseRDD = sc.adamBEDFeatureLoad("path/to/dnase”)
val genotypesRDD = sc.adamLoad("path/to/genotypes")
val filteredRDD = genotypesRDD
.filter(!inDbSnp(_))
.filter(isDeleterious(_))
.filter(isFramingham(_))
val joinedRDD = RegionJoin.partitionAndJoin(sc, filteredRDD, dnaseRDD)
val maf = joinedRDD
.keyBy(x => (x.getVariant, getPopulation(x)))
.groupByKey()
.map(computeMAF(_))
maf.saveAsNewAPIHadoopFile("path/to/output")
apply predicates
load data
join data
group-by
aggregate (MAF)
persist data
29© Cloudera, Inc. All rights reserved.
• Hosted at Berkeley and the
AMPLab
• Apache 2 License
• Contributors from both
research and commercial
organizations
• Core spatial primitives, variant
calling
• Avro and Parquet for data
models and file formats
Spark + Genomics = ADAM
30© Cloudera, Inc. All rights reserved.
Core Genomics Primitives: Spatial Join
31© Cloudera, Inc. All rights reserved.
ADAM preliminary performance
32© Cloudera, Inc. All rights reserved.
33© Cloudera, Inc. All rights reserved.
Acknowledgements
UCBerkeley
Matt Massie
Frank Nothaft
Michael Heuer
Tamr
Timothy Danford
MSSM
Jeff Hammerbacher
Ryan Williams
Cloudera
Uri Laserson
Tom White
Sandy Ryza
34© Cloudera, Inc. All rights reserved.
Thank you
@sean_r_owen
sowen@cloudera.com
Ad

More Related Content

What's hot (20)

How does that PySpark thing work? And why Arrow makes it faster?
How does that PySpark thing work? And why Arrow makes it faster?How does that PySpark thing work? And why Arrow makes it faster?
How does that PySpark thing work? And why Arrow makes it faster?
Rubén Berenguel
 
Keeping Spark on Track: Productionizing Spark for ETL
Keeping Spark on Track: Productionizing Spark for ETLKeeping Spark on Track: Productionizing Spark for ETL
Keeping Spark on Track: Productionizing Spark for ETL
Databricks
 
Sparkly Notebook: Interactive Analysis and Visualization with Spark
Sparkly Notebook: Interactive Analysis and Visualization with SparkSparkly Notebook: Interactive Analysis and Visualization with Spark
Sparkly Notebook: Interactive Analysis and Visualization with Spark
felixcss
 
Problem Solving Recipes Learned from Supporting Spark: Spark Summit East talk...
Problem Solving Recipes Learned from Supporting Spark: Spark Summit East talk...Problem Solving Recipes Learned from Supporting Spark: Spark Summit East talk...
Problem Solving Recipes Learned from Supporting Spark: Spark Summit East talk...
Spark Summit
 
Spark
SparkSpark
Spark
Intellipaat
 
Hadoop, Hive, Spark and Object Stores
Hadoop, Hive, Spark and Object StoresHadoop, Hive, Spark and Object Stores
Hadoop, Hive, Spark and Object Stores
Steve Loughran
 
Frustration-Reduced PySpark: Data engineering with DataFrames
Frustration-Reduced PySpark: Data engineering with DataFramesFrustration-Reduced PySpark: Data engineering with DataFrames
Frustration-Reduced PySpark: Data engineering with DataFrames
Ilya Ganelin
 
Parallelizing Existing R Packages with SparkR
Parallelizing Existing R Packages with SparkRParallelizing Existing R Packages with SparkR
Parallelizing Existing R Packages with SparkR
Databricks
 
CaffeOnSpark Update: Recent Enhancements and Use Cases
CaffeOnSpark Update: Recent Enhancements and Use CasesCaffeOnSpark Update: Recent Enhancements and Use Cases
CaffeOnSpark Update: Recent Enhancements and Use Cases
DataWorks Summit
 
Apache Spark - Intro to Large-scale recommendations with Apache Spark and Python
Apache Spark - Intro to Large-scale recommendations with Apache Spark and PythonApache Spark - Intro to Large-scale recommendations with Apache Spark and Python
Apache Spark - Intro to Large-scale recommendations with Apache Spark and Python
Christian Perone
 
Introduction to Apache Spark
Introduction to Apache SparkIntroduction to Apache Spark
Introduction to Apache Spark
Mohamed hedi Abidi
 
Project Tungsten: Bringing Spark Closer to Bare Metal
Project Tungsten: Bringing Spark Closer to Bare MetalProject Tungsten: Bringing Spark Closer to Bare Metal
Project Tungsten: Bringing Spark Closer to Bare Metal
Databricks
 
Scalable Machine Learning with PySpark
Scalable Machine Learning with PySparkScalable Machine Learning with PySpark
Scalable Machine Learning with PySpark
Ladle Patel
 
Apache Spark Introduction | Big Data Hadoop Spark Tutorial | CloudxLab
Apache Spark Introduction | Big Data Hadoop Spark Tutorial | CloudxLabApache Spark Introduction | Big Data Hadoop Spark Tutorial | CloudxLab
Apache Spark Introduction | Big Data Hadoop Spark Tutorial | CloudxLab
CloudxLab
 
Osd ctw spark
Osd ctw sparkOsd ctw spark
Osd ctw spark
Wisely chen
 
Fault Tolerance in Spark: Lessons Learned from Production: Spark Summit East ...
Fault Tolerance in Spark: Lessons Learned from Production: Spark Summit East ...Fault Tolerance in Spark: Lessons Learned from Production: Spark Summit East ...
Fault Tolerance in Spark: Lessons Learned from Production: Spark Summit East ...
Spark Summit
 
Advanced Apache Spark Meetup: How Spark Beat Hadoop @ 100 TB Daytona GraySor...
Advanced Apache Spark Meetup:  How Spark Beat Hadoop @ 100 TB Daytona GraySor...Advanced Apache Spark Meetup:  How Spark Beat Hadoop @ 100 TB Daytona GraySor...
Advanced Apache Spark Meetup: How Spark Beat Hadoop @ 100 TB Daytona GraySor...
Chris Fregly
 
Transactional writes to cloud storage with Eric Liang
Transactional writes to cloud storage with Eric LiangTransactional writes to cloud storage with Eric Liang
Transactional writes to cloud storage with Eric Liang
Databricks
 
Analyzing Log Data With Apache Spark
Analyzing Log Data With Apache SparkAnalyzing Log Data With Apache Spark
Analyzing Log Data With Apache Spark
Spark Summit
 
Monitoring the Dynamic Resource Usage of Scala and Python Spark Jobs in Yarn:...
Monitoring the Dynamic Resource Usage of Scala and Python Spark Jobs in Yarn:...Monitoring the Dynamic Resource Usage of Scala and Python Spark Jobs in Yarn:...
Monitoring the Dynamic Resource Usage of Scala and Python Spark Jobs in Yarn:...
Spark Summit
 
How does that PySpark thing work? And why Arrow makes it faster?
How does that PySpark thing work? And why Arrow makes it faster?How does that PySpark thing work? And why Arrow makes it faster?
How does that PySpark thing work? And why Arrow makes it faster?
Rubén Berenguel
 
Keeping Spark on Track: Productionizing Spark for ETL
Keeping Spark on Track: Productionizing Spark for ETLKeeping Spark on Track: Productionizing Spark for ETL
Keeping Spark on Track: Productionizing Spark for ETL
Databricks
 
Sparkly Notebook: Interactive Analysis and Visualization with Spark
Sparkly Notebook: Interactive Analysis and Visualization with SparkSparkly Notebook: Interactive Analysis and Visualization with Spark
Sparkly Notebook: Interactive Analysis and Visualization with Spark
felixcss
 
Problem Solving Recipes Learned from Supporting Spark: Spark Summit East talk...
Problem Solving Recipes Learned from Supporting Spark: Spark Summit East talk...Problem Solving Recipes Learned from Supporting Spark: Spark Summit East talk...
Problem Solving Recipes Learned from Supporting Spark: Spark Summit East talk...
Spark Summit
 
Hadoop, Hive, Spark and Object Stores
Hadoop, Hive, Spark and Object StoresHadoop, Hive, Spark and Object Stores
Hadoop, Hive, Spark and Object Stores
Steve Loughran
 
Frustration-Reduced PySpark: Data engineering with DataFrames
Frustration-Reduced PySpark: Data engineering with DataFramesFrustration-Reduced PySpark: Data engineering with DataFrames
Frustration-Reduced PySpark: Data engineering with DataFrames
Ilya Ganelin
 
Parallelizing Existing R Packages with SparkR
Parallelizing Existing R Packages with SparkRParallelizing Existing R Packages with SparkR
Parallelizing Existing R Packages with SparkR
Databricks
 
CaffeOnSpark Update: Recent Enhancements and Use Cases
CaffeOnSpark Update: Recent Enhancements and Use CasesCaffeOnSpark Update: Recent Enhancements and Use Cases
CaffeOnSpark Update: Recent Enhancements and Use Cases
DataWorks Summit
 
Apache Spark - Intro to Large-scale recommendations with Apache Spark and Python
Apache Spark - Intro to Large-scale recommendations with Apache Spark and PythonApache Spark - Intro to Large-scale recommendations with Apache Spark and Python
Apache Spark - Intro to Large-scale recommendations with Apache Spark and Python
Christian Perone
 
Project Tungsten: Bringing Spark Closer to Bare Metal
Project Tungsten: Bringing Spark Closer to Bare MetalProject Tungsten: Bringing Spark Closer to Bare Metal
Project Tungsten: Bringing Spark Closer to Bare Metal
Databricks
 
Scalable Machine Learning with PySpark
Scalable Machine Learning with PySparkScalable Machine Learning with PySpark
Scalable Machine Learning with PySpark
Ladle Patel
 
Apache Spark Introduction | Big Data Hadoop Spark Tutorial | CloudxLab
Apache Spark Introduction | Big Data Hadoop Spark Tutorial | CloudxLabApache Spark Introduction | Big Data Hadoop Spark Tutorial | CloudxLab
Apache Spark Introduction | Big Data Hadoop Spark Tutorial | CloudxLab
CloudxLab
 
Fault Tolerance in Spark: Lessons Learned from Production: Spark Summit East ...
Fault Tolerance in Spark: Lessons Learned from Production: Spark Summit East ...Fault Tolerance in Spark: Lessons Learned from Production: Spark Summit East ...
Fault Tolerance in Spark: Lessons Learned from Production: Spark Summit East ...
Spark Summit
 
Advanced Apache Spark Meetup: How Spark Beat Hadoop @ 100 TB Daytona GraySor...
Advanced Apache Spark Meetup:  How Spark Beat Hadoop @ 100 TB Daytona GraySor...Advanced Apache Spark Meetup:  How Spark Beat Hadoop @ 100 TB Daytona GraySor...
Advanced Apache Spark Meetup: How Spark Beat Hadoop @ 100 TB Daytona GraySor...
Chris Fregly
 
Transactional writes to cloud storage with Eric Liang
Transactional writes to cloud storage with Eric LiangTransactional writes to cloud storage with Eric Liang
Transactional writes to cloud storage with Eric Liang
Databricks
 
Analyzing Log Data With Apache Spark
Analyzing Log Data With Apache SparkAnalyzing Log Data With Apache Spark
Analyzing Log Data With Apache Spark
Spark Summit
 
Monitoring the Dynamic Resource Usage of Scala and Python Spark Jobs in Yarn:...
Monitoring the Dynamic Resource Usage of Scala and Python Spark Jobs in Yarn:...Monitoring the Dynamic Resource Usage of Scala and Python Spark Jobs in Yarn:...
Monitoring the Dynamic Resource Usage of Scala and Python Spark Jobs in Yarn:...
Spark Summit
 

Similar to "Petascale Genomics with Spark", Sean Owen,Director of Data Science at Cloudera (20)

DataEngConf: Uri Laserson (Data Scientist, Cloudera) Scaling up Genomics with...
DataEngConf: Uri Laserson (Data Scientist, Cloudera) Scaling up Genomics with...DataEngConf: Uri Laserson (Data Scientist, Cloudera) Scaling up Genomics with...
DataEngConf: Uri Laserson (Data Scientist, Cloudera) Scaling up Genomics with...
Hakka Labs
 
Spark etl
Spark etlSpark etl
Spark etl
Imran Rashid
 
The Hadoop Ecosystem
The Hadoop EcosystemThe Hadoop Ecosystem
The Hadoop Ecosystem
Mathias Herberts
 
Keynote (Nandini Ramani) - The Role of Java in Heterogeneous Computing & How ...
Keynote (Nandini Ramani) - The Role of Java in Heterogeneous Computing & How ...Keynote (Nandini Ramani) - The Role of Java in Heterogeneous Computing & How ...
Keynote (Nandini Ramani) - The Role of Java in Heterogeneous Computing & How ...
AMD Developer Central
 
Testing Cassandra Guarantees under Diverse Failure Modes with Jepsen
Testing Cassandra Guarantees under Diverse Failure Modes with JepsenTesting Cassandra Guarantees under Diverse Failure Modes with Jepsen
Testing Cassandra Guarantees under Diverse Failure Modes with Jepsen
jkni
 
DataStax: Testing Cassandra Guarantees Under Diverse Failure Modes With Jepsen
DataStax: Testing Cassandra Guarantees Under Diverse Failure Modes With JepsenDataStax: Testing Cassandra Guarantees Under Diverse Failure Modes With Jepsen
DataStax: Testing Cassandra Guarantees Under Diverse Failure Modes With Jepsen
DataStax Academy
 
What's New in Apache Hive
What's New in Apache HiveWhat's New in Apache Hive
What's New in Apache Hive
DataWorks Summit
 
zookeeperProgrammers
zookeeperProgrammerszookeeperProgrammers
zookeeperProgrammers
Hiroshi Ono
 
Petascale Genomics (Strata Singapore 20151203)
Petascale Genomics (Strata Singapore 20151203)Petascale Genomics (Strata Singapore 20151203)
Petascale Genomics (Strata Singapore 20151203)
Uri Laserson
 
SFBay Area Solr Meetup - June 18th: Benchmarking Solr Performance
SFBay Area Solr Meetup - June 18th: Benchmarking Solr PerformanceSFBay Area Solr Meetup - June 18th: Benchmarking Solr Performance
SFBay Area Solr Meetup - June 18th: Benchmarking Solr Performance
Lucidworks (Archived)
 
Zookeeper Introduce
Zookeeper IntroduceZookeeper Introduce
Zookeeper Introduce
jhao niu
 
High Performance Spark Best Practices for Scaling and Optimizing Apache Spark...
High Performance Spark Best Practices for Scaling and Optimizing Apache Spark...High Performance Spark Best Practices for Scaling and Optimizing Apache Spark...
High Performance Spark Best Practices for Scaling and Optimizing Apache Spark...
arianmutchpp
 
Graal and Truffle: One VM to Rule Them All
Graal and Truffle: One VM to Rule Them AllGraal and Truffle: One VM to Rule Them All
Graal and Truffle: One VM to Rule Them All
Thomas Wuerthinger
 
MySQL Webinar 2/4 Performance tuning, hardware, optimisation
MySQL Webinar 2/4 Performance tuning, hardware, optimisationMySQL Webinar 2/4 Performance tuning, hardware, optimisation
MySQL Webinar 2/4 Performance tuning, hardware, optimisation
Mark Swarbrick
 
Percona XtraDB 集群文档
Percona XtraDB 集群文档Percona XtraDB 集群文档
Percona XtraDB 集群文档
YUCHENG HU
 
[Hic2011] using hadoop lucene-solr-for-large-scale-search by systex
[Hic2011] using hadoop lucene-solr-for-large-scale-search by systex[Hic2011] using hadoop lucene-solr-for-large-scale-search by systex
[Hic2011] using hadoop lucene-solr-for-large-scale-search by systex
James Chen
 
Why your Spark Job is Failing
Why your Spark Job is FailingWhy your Spark Job is Failing
Why your Spark Job is Failing
DataWorks Summit
 
Why Your Apache Spark Job is Failing
Why Your Apache Spark Job is FailingWhy Your Apache Spark Job is Failing
Why Your Apache Spark Job is Failing
Cloudera, Inc.
 
55j7
55j755j7
55j7
swein2
 
Introduction to Apache Spark
Introduction to Apache Spark Introduction to Apache Spark
Introduction to Apache Spark
Hubert Fan Chiang
 
DataEngConf: Uri Laserson (Data Scientist, Cloudera) Scaling up Genomics with...
DataEngConf: Uri Laserson (Data Scientist, Cloudera) Scaling up Genomics with...DataEngConf: Uri Laserson (Data Scientist, Cloudera) Scaling up Genomics with...
DataEngConf: Uri Laserson (Data Scientist, Cloudera) Scaling up Genomics with...
Hakka Labs
 
Keynote (Nandini Ramani) - The Role of Java in Heterogeneous Computing & How ...
Keynote (Nandini Ramani) - The Role of Java in Heterogeneous Computing & How ...Keynote (Nandini Ramani) - The Role of Java in Heterogeneous Computing & How ...
Keynote (Nandini Ramani) - The Role of Java in Heterogeneous Computing & How ...
AMD Developer Central
 
Testing Cassandra Guarantees under Diverse Failure Modes with Jepsen
Testing Cassandra Guarantees under Diverse Failure Modes with JepsenTesting Cassandra Guarantees under Diverse Failure Modes with Jepsen
Testing Cassandra Guarantees under Diverse Failure Modes with Jepsen
jkni
 
DataStax: Testing Cassandra Guarantees Under Diverse Failure Modes With Jepsen
DataStax: Testing Cassandra Guarantees Under Diverse Failure Modes With JepsenDataStax: Testing Cassandra Guarantees Under Diverse Failure Modes With Jepsen
DataStax: Testing Cassandra Guarantees Under Diverse Failure Modes With Jepsen
DataStax Academy
 
zookeeperProgrammers
zookeeperProgrammerszookeeperProgrammers
zookeeperProgrammers
Hiroshi Ono
 
Petascale Genomics (Strata Singapore 20151203)
Petascale Genomics (Strata Singapore 20151203)Petascale Genomics (Strata Singapore 20151203)
Petascale Genomics (Strata Singapore 20151203)
Uri Laserson
 
SFBay Area Solr Meetup - June 18th: Benchmarking Solr Performance
SFBay Area Solr Meetup - June 18th: Benchmarking Solr PerformanceSFBay Area Solr Meetup - June 18th: Benchmarking Solr Performance
SFBay Area Solr Meetup - June 18th: Benchmarking Solr Performance
Lucidworks (Archived)
 
Zookeeper Introduce
Zookeeper IntroduceZookeeper Introduce
Zookeeper Introduce
jhao niu
 
High Performance Spark Best Practices for Scaling and Optimizing Apache Spark...
High Performance Spark Best Practices for Scaling and Optimizing Apache Spark...High Performance Spark Best Practices for Scaling and Optimizing Apache Spark...
High Performance Spark Best Practices for Scaling and Optimizing Apache Spark...
arianmutchpp
 
Graal and Truffle: One VM to Rule Them All
Graal and Truffle: One VM to Rule Them AllGraal and Truffle: One VM to Rule Them All
Graal and Truffle: One VM to Rule Them All
Thomas Wuerthinger
 
MySQL Webinar 2/4 Performance tuning, hardware, optimisation
MySQL Webinar 2/4 Performance tuning, hardware, optimisationMySQL Webinar 2/4 Performance tuning, hardware, optimisation
MySQL Webinar 2/4 Performance tuning, hardware, optimisation
Mark Swarbrick
 
Percona XtraDB 集群文档
Percona XtraDB 集群文档Percona XtraDB 集群文档
Percona XtraDB 集群文档
YUCHENG HU
 
[Hic2011] using hadoop lucene-solr-for-large-scale-search by systex
[Hic2011] using hadoop lucene-solr-for-large-scale-search by systex[Hic2011] using hadoop lucene-solr-for-large-scale-search by systex
[Hic2011] using hadoop lucene-solr-for-large-scale-search by systex
James Chen
 
Why your Spark Job is Failing
Why your Spark Job is FailingWhy your Spark Job is Failing
Why your Spark Job is Failing
DataWorks Summit
 
Why Your Apache Spark Job is Failing
Why Your Apache Spark Job is FailingWhy Your Apache Spark Job is Failing
Why Your Apache Spark Job is Failing
Cloudera, Inc.
 
Introduction to Apache Spark
Introduction to Apache Spark Introduction to Apache Spark
Introduction to Apache Spark
Hubert Fan Chiang
 
Ad

More from Dataconomy Media (20)

Data Natives Paris v 10.0 | "Blockchain in Healthcare" - Lea Dias & David An...
Data Natives Paris v 10.0 | "Blockchain in Healthcare" - Lea Dias & 	David An...Data Natives Paris v 10.0 | "Blockchain in Healthcare" - Lea Dias & 	David An...
Data Natives Paris v 10.0 | "Blockchain in Healthcare" - Lea Dias & David An...
Dataconomy Media
 
Data Natives Frankfurt v 11.0 | "Competitive advantages with knowledge graphs...
Data Natives Frankfurt v 11.0 | "Competitive advantages with knowledge graphs...Data Natives Frankfurt v 11.0 | "Competitive advantages with knowledge graphs...
Data Natives Frankfurt v 11.0 | "Competitive advantages with knowledge graphs...
Dataconomy Media
 
Data Natives Frankfurt v 11.0 | "Can we be responsible for misuse of data & a...
Data Natives Frankfurt v 11.0 | "Can we be responsible for misuse of data & a...Data Natives Frankfurt v 11.0 | "Can we be responsible for misuse of data & a...
Data Natives Frankfurt v 11.0 | "Can we be responsible for misuse of data & a...
Dataconomy Media
 
Data Natives Munich v 12.0 | "How to be more productive with Autonomous Data ...
Data Natives Munich v 12.0 | "How to be more productive with Autonomous Data ...Data Natives Munich v 12.0 | "How to be more productive with Autonomous Data ...
Data Natives Munich v 12.0 | "How to be more productive with Autonomous Data ...
Dataconomy Media
 
Data Natives meets DataRobot | "Build and deploy an anti-money laundering mo...
Data Natives meets DataRobot |  "Build and deploy an anti-money laundering mo...Data Natives meets DataRobot |  "Build and deploy an anti-money laundering mo...
Data Natives meets DataRobot | "Build and deploy an anti-money laundering mo...
Dataconomy Media
 
Data Natives Munich v 12.0 | "Political Data Science: A tale of Fake News, So...
Data Natives Munich v 12.0 | "Political Data Science: A tale of Fake News, So...Data Natives Munich v 12.0 | "Political Data Science: A tale of Fake News, So...
Data Natives Munich v 12.0 | "Political Data Science: A tale of Fake News, So...
Dataconomy Media
 
Data Natives Vienna v 7.0 | "Building Kubernetes Operators with KUDO for Dat...
Data Natives Vienna v 7.0  | "Building Kubernetes Operators with KUDO for Dat...Data Natives Vienna v 7.0  | "Building Kubernetes Operators with KUDO for Dat...
Data Natives Vienna v 7.0 | "Building Kubernetes Operators with KUDO for Dat...
Dataconomy Media
 
Data Natives Vienna v 7.0 | "The Ingredients of Data Innovation" - Robbert de...
Data Natives Vienna v 7.0 | "The Ingredients of Data Innovation" - Robbert de...Data Natives Vienna v 7.0 | "The Ingredients of Data Innovation" - Robbert de...
Data Natives Vienna v 7.0 | "The Ingredients of Data Innovation" - Robbert de...
Dataconomy Media
 
Data Natives Cologne v 4.0 | "The Data Lorax: Planting the Seeds of Fairness...
Data Natives Cologne v 4.0  | "The Data Lorax: Planting the Seeds of Fairness...Data Natives Cologne v 4.0  | "The Data Lorax: Planting the Seeds of Fairness...
Data Natives Cologne v 4.0 | "The Data Lorax: Planting the Seeds of Fairness...
Dataconomy Media
 
Data Natives Cologne v 4.0 | "How People Analytics Can Reveal the Hidden Aspe...
Data Natives Cologne v 4.0 | "How People Analytics Can Reveal the Hidden Aspe...Data Natives Cologne v 4.0 | "How People Analytics Can Reveal the Hidden Aspe...
Data Natives Cologne v 4.0 | "How People Analytics Can Reveal the Hidden Aspe...
Dataconomy Media
 
Data Natives Amsterdam v 9.0 | "Ten Little Servers: A Story of no Downtime" -...
Data Natives Amsterdam v 9.0 | "Ten Little Servers: A Story of no Downtime" -...Data Natives Amsterdam v 9.0 | "Ten Little Servers: A Story of no Downtime" -...
Data Natives Amsterdam v 9.0 | "Ten Little Servers: A Story of no Downtime" -...
Dataconomy Media
 
Data Natives Amsterdam v 9.0 | "Point in Time Labeling at Scale" - Timothy Th...
Data Natives Amsterdam v 9.0 | "Point in Time Labeling at Scale" - Timothy Th...Data Natives Amsterdam v 9.0 | "Point in Time Labeling at Scale" - Timothy Th...
Data Natives Amsterdam v 9.0 | "Point in Time Labeling at Scale" - Timothy Th...
Dataconomy Media
 
Data Natives Hamburg v 6.0 | "Interpersonal behavior: observing Alex to under...
Data Natives Hamburg v 6.0 | "Interpersonal behavior: observing Alex to under...Data Natives Hamburg v 6.0 | "Interpersonal behavior: observing Alex to under...
Data Natives Hamburg v 6.0 | "Interpersonal behavior: observing Alex to under...
Dataconomy Media
 
Data Natives Hamburg v 6.0 | "About Surfing, Failing & Scaling" - Florian Sch...
Data Natives Hamburg v 6.0 | "About Surfing, Failing & Scaling" - Florian Sch...Data Natives Hamburg v 6.0 | "About Surfing, Failing & Scaling" - Florian Sch...
Data Natives Hamburg v 6.0 | "About Surfing, Failing & Scaling" - Florian Sch...
Dataconomy Media
 
Data NativesBerlin v 20.0 | "Serving A/B experimentation platform end-to-end"...
Data NativesBerlin v 20.0 | "Serving A/B experimentation platform end-to-end"...Data NativesBerlin v 20.0 | "Serving A/B experimentation platform end-to-end"...
Data NativesBerlin v 20.0 | "Serving A/B experimentation platform end-to-end"...
Dataconomy Media
 
Data Natives Berlin v 20.0 | "Ten Little Servers: A Story of no Downtime" - A...
Data Natives Berlin v 20.0 | "Ten Little Servers: A Story of no Downtime" - A...Data Natives Berlin v 20.0 | "Ten Little Servers: A Story of no Downtime" - A...
Data Natives Berlin v 20.0 | "Ten Little Servers: A Story of no Downtime" - A...
Dataconomy Media
 
Big Data Frankfurt meets Thinkport | "The Cloud as a Driver of Innovation" - ...
Big Data Frankfurt meets Thinkport | "The Cloud as a Driver of Innovation" - ...Big Data Frankfurt meets Thinkport | "The Cloud as a Driver of Innovation" - ...
Big Data Frankfurt meets Thinkport | "The Cloud as a Driver of Innovation" - ...
Dataconomy Media
 
Thinkport meets Frankfurt | "Financial Time Series Analysis using Wavelets" -...
Thinkport meets Frankfurt | "Financial Time Series Analysis using Wavelets" -...Thinkport meets Frankfurt | "Financial Time Series Analysis using Wavelets" -...
Thinkport meets Frankfurt | "Financial Time Series Analysis using Wavelets" -...
Dataconomy Media
 
Big Data Helsinki v 3 | "Distributed Machine and Deep Learning at Scale with ...
Big Data Helsinki v 3 | "Distributed Machine and Deep Learning at Scale with ...Big Data Helsinki v 3 | "Distributed Machine and Deep Learning at Scale with ...
Big Data Helsinki v 3 | "Distributed Machine and Deep Learning at Scale with ...
Dataconomy Media
 
Big Data Helsinki v 3 | "Federated Learning and Privacy-preserving AI" - Oguz...
Big Data Helsinki v 3 | "Federated Learning and Privacy-preserving AI" - Oguz...Big Data Helsinki v 3 | "Federated Learning and Privacy-preserving AI" - Oguz...
Big Data Helsinki v 3 | "Federated Learning and Privacy-preserving AI" - Oguz...
Dataconomy Media
 
Data Natives Paris v 10.0 | "Blockchain in Healthcare" - Lea Dias & David An...
Data Natives Paris v 10.0 | "Blockchain in Healthcare" - Lea Dias & 	David An...Data Natives Paris v 10.0 | "Blockchain in Healthcare" - Lea Dias & 	David An...
Data Natives Paris v 10.0 | "Blockchain in Healthcare" - Lea Dias & David An...
Dataconomy Media
 
Data Natives Frankfurt v 11.0 | "Competitive advantages with knowledge graphs...
Data Natives Frankfurt v 11.0 | "Competitive advantages with knowledge graphs...Data Natives Frankfurt v 11.0 | "Competitive advantages with knowledge graphs...
Data Natives Frankfurt v 11.0 | "Competitive advantages with knowledge graphs...
Dataconomy Media
 
Data Natives Frankfurt v 11.0 | "Can we be responsible for misuse of data & a...
Data Natives Frankfurt v 11.0 | "Can we be responsible for misuse of data & a...Data Natives Frankfurt v 11.0 | "Can we be responsible for misuse of data & a...
Data Natives Frankfurt v 11.0 | "Can we be responsible for misuse of data & a...
Dataconomy Media
 
Data Natives Munich v 12.0 | "How to be more productive with Autonomous Data ...
Data Natives Munich v 12.0 | "How to be more productive with Autonomous Data ...Data Natives Munich v 12.0 | "How to be more productive with Autonomous Data ...
Data Natives Munich v 12.0 | "How to be more productive with Autonomous Data ...
Dataconomy Media
 
Data Natives meets DataRobot | "Build and deploy an anti-money laundering mo...
Data Natives meets DataRobot |  "Build and deploy an anti-money laundering mo...Data Natives meets DataRobot |  "Build and deploy an anti-money laundering mo...
Data Natives meets DataRobot | "Build and deploy an anti-money laundering mo...
Dataconomy Media
 
Data Natives Munich v 12.0 | "Political Data Science: A tale of Fake News, So...
Data Natives Munich v 12.0 | "Political Data Science: A tale of Fake News, So...Data Natives Munich v 12.0 | "Political Data Science: A tale of Fake News, So...
Data Natives Munich v 12.0 | "Political Data Science: A tale of Fake News, So...
Dataconomy Media
 
Data Natives Vienna v 7.0 | "Building Kubernetes Operators with KUDO for Dat...
Data Natives Vienna v 7.0  | "Building Kubernetes Operators with KUDO for Dat...Data Natives Vienna v 7.0  | "Building Kubernetes Operators with KUDO for Dat...
Data Natives Vienna v 7.0 | "Building Kubernetes Operators with KUDO for Dat...
Dataconomy Media
 
Data Natives Vienna v 7.0 | "The Ingredients of Data Innovation" - Robbert de...
Data Natives Vienna v 7.0 | "The Ingredients of Data Innovation" - Robbert de...Data Natives Vienna v 7.0 | "The Ingredients of Data Innovation" - Robbert de...
Data Natives Vienna v 7.0 | "The Ingredients of Data Innovation" - Robbert de...
Dataconomy Media
 
Data Natives Cologne v 4.0 | "The Data Lorax: Planting the Seeds of Fairness...
Data Natives Cologne v 4.0  | "The Data Lorax: Planting the Seeds of Fairness...Data Natives Cologne v 4.0  | "The Data Lorax: Planting the Seeds of Fairness...
Data Natives Cologne v 4.0 | "The Data Lorax: Planting the Seeds of Fairness...
Dataconomy Media
 
Data Natives Cologne v 4.0 | "How People Analytics Can Reveal the Hidden Aspe...
Data Natives Cologne v 4.0 | "How People Analytics Can Reveal the Hidden Aspe...Data Natives Cologne v 4.0 | "How People Analytics Can Reveal the Hidden Aspe...
Data Natives Cologne v 4.0 | "How People Analytics Can Reveal the Hidden Aspe...
Dataconomy Media
 
Data Natives Amsterdam v 9.0 | "Ten Little Servers: A Story of no Downtime" -...
Data Natives Amsterdam v 9.0 | "Ten Little Servers: A Story of no Downtime" -...Data Natives Amsterdam v 9.0 | "Ten Little Servers: A Story of no Downtime" -...
Data Natives Amsterdam v 9.0 | "Ten Little Servers: A Story of no Downtime" -...
Dataconomy Media
 
Data Natives Amsterdam v 9.0 | "Point in Time Labeling at Scale" - Timothy Th...
Data Natives Amsterdam v 9.0 | "Point in Time Labeling at Scale" - Timothy Th...Data Natives Amsterdam v 9.0 | "Point in Time Labeling at Scale" - Timothy Th...
Data Natives Amsterdam v 9.0 | "Point in Time Labeling at Scale" - Timothy Th...
Dataconomy Media
 
Data Natives Hamburg v 6.0 | "Interpersonal behavior: observing Alex to under...
Data Natives Hamburg v 6.0 | "Interpersonal behavior: observing Alex to under...Data Natives Hamburg v 6.0 | "Interpersonal behavior: observing Alex to under...
Data Natives Hamburg v 6.0 | "Interpersonal behavior: observing Alex to under...
Dataconomy Media
 
Data Natives Hamburg v 6.0 | "About Surfing, Failing & Scaling" - Florian Sch...
Data Natives Hamburg v 6.0 | "About Surfing, Failing & Scaling" - Florian Sch...Data Natives Hamburg v 6.0 | "About Surfing, Failing & Scaling" - Florian Sch...
Data Natives Hamburg v 6.0 | "About Surfing, Failing & Scaling" - Florian Sch...
Dataconomy Media
 
Data NativesBerlin v 20.0 | "Serving A/B experimentation platform end-to-end"...
Data NativesBerlin v 20.0 | "Serving A/B experimentation platform end-to-end"...Data NativesBerlin v 20.0 | "Serving A/B experimentation platform end-to-end"...
Data NativesBerlin v 20.0 | "Serving A/B experimentation platform end-to-end"...
Dataconomy Media
 
Data Natives Berlin v 20.0 | "Ten Little Servers: A Story of no Downtime" - A...
Data Natives Berlin v 20.0 | "Ten Little Servers: A Story of no Downtime" - A...Data Natives Berlin v 20.0 | "Ten Little Servers: A Story of no Downtime" - A...
Data Natives Berlin v 20.0 | "Ten Little Servers: A Story of no Downtime" - A...
Dataconomy Media
 
Big Data Frankfurt meets Thinkport | "The Cloud as a Driver of Innovation" - ...
Big Data Frankfurt meets Thinkport | "The Cloud as a Driver of Innovation" - ...Big Data Frankfurt meets Thinkport | "The Cloud as a Driver of Innovation" - ...
Big Data Frankfurt meets Thinkport | "The Cloud as a Driver of Innovation" - ...
Dataconomy Media
 
Thinkport meets Frankfurt | "Financial Time Series Analysis using Wavelets" -...
Thinkport meets Frankfurt | "Financial Time Series Analysis using Wavelets" -...Thinkport meets Frankfurt | "Financial Time Series Analysis using Wavelets" -...
Thinkport meets Frankfurt | "Financial Time Series Analysis using Wavelets" -...
Dataconomy Media
 
Big Data Helsinki v 3 | "Distributed Machine and Deep Learning at Scale with ...
Big Data Helsinki v 3 | "Distributed Machine and Deep Learning at Scale with ...Big Data Helsinki v 3 | "Distributed Machine and Deep Learning at Scale with ...
Big Data Helsinki v 3 | "Distributed Machine and Deep Learning at Scale with ...
Dataconomy Media
 
Big Data Helsinki v 3 | "Federated Learning and Privacy-preserving AI" - Oguz...
Big Data Helsinki v 3 | "Federated Learning and Privacy-preserving AI" - Oguz...Big Data Helsinki v 3 | "Federated Learning and Privacy-preserving AI" - Oguz...
Big Data Helsinki v 3 | "Federated Learning and Privacy-preserving AI" - Oguz...
Dataconomy Media
 
Ad

Recently uploaded (20)

Conic Sectionfaggavahabaayhahahahahs.pptx
Conic Sectionfaggavahabaayhahahahahs.pptxConic Sectionfaggavahabaayhahahahahs.pptx
Conic Sectionfaggavahabaayhahahahahs.pptx
taiwanesechetan
 
Thingyan is now a global treasure! See how people around the world are search...
Thingyan is now a global treasure! See how people around the world are search...Thingyan is now a global treasure! See how people around the world are search...
Thingyan is now a global treasure! See how people around the world are search...
Pixellion
 
C++_OOPs_DSA1_Presentation_Template.pptx
C++_OOPs_DSA1_Presentation_Template.pptxC++_OOPs_DSA1_Presentation_Template.pptx
C++_OOPs_DSA1_Presentation_Template.pptx
aquibnoor22079
 
How to join illuminati Agent in uganda call+256776963507/0741506136
How to join illuminati Agent in uganda call+256776963507/0741506136How to join illuminati Agent in uganda call+256776963507/0741506136
How to join illuminati Agent in uganda call+256776963507/0741506136
illuminati Agent uganda call+256776963507/0741506136
 
Molecular methods diagnostic and monitoring of infection - Repaired.pptx
Molecular methods diagnostic and monitoring of infection  -  Repaired.pptxMolecular methods diagnostic and monitoring of infection  -  Repaired.pptx
Molecular methods diagnostic and monitoring of infection - Repaired.pptx
7tzn7x5kky
 
183409-christina-rossetti.pdfdsfsdasggsag
183409-christina-rossetti.pdfdsfsdasggsag183409-christina-rossetti.pdfdsfsdasggsag
183409-christina-rossetti.pdfdsfsdasggsag
fardin123rahman07
 
Calories_Prediction_using_Linear_Regression.pptx
Calories_Prediction_using_Linear_Regression.pptxCalories_Prediction_using_Linear_Regression.pptx
Calories_Prediction_using_Linear_Regression.pptx
TijiLMAHESHWARI
 
Template_A3nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
Template_A3nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnTemplate_A3nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
Template_A3nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
cegiver630
 
Deloitte Analytics - Applying Process Mining in an audit context
Deloitte Analytics - Applying Process Mining in an audit contextDeloitte Analytics - Applying Process Mining in an audit context
Deloitte Analytics - Applying Process Mining in an audit context
Process mining Evangelist
 
Ppt. Nikhil.pptxnshwuudgcudisisshvehsjks
Ppt. Nikhil.pptxnshwuudgcudisisshvehsjksPpt. Nikhil.pptxnshwuudgcudisisshvehsjks
Ppt. Nikhil.pptxnshwuudgcudisisshvehsjks
panchariyasahil
 
Medical Dataset including visualizations
Medical Dataset including visualizationsMedical Dataset including visualizations
Medical Dataset including visualizations
vishrut8750588758
 
Minions Want to eat presentacion muy linda
Minions Want to eat presentacion muy lindaMinions Want to eat presentacion muy linda
Minions Want to eat presentacion muy linda
CarlaAndradesSoler1
 
03 Daniel 2-notes.ppt seminario escatologia
03 Daniel 2-notes.ppt seminario escatologia03 Daniel 2-notes.ppt seminario escatologia
03 Daniel 2-notes.ppt seminario escatologia
Alexander Romero Arosquipa
 
Just-In-Timeasdfffffffghhhhhhhhhhj Systems.ppt
Just-In-Timeasdfffffffghhhhhhhhhhj Systems.pptJust-In-Timeasdfffffffghhhhhhhhhhj Systems.ppt
Just-In-Timeasdfffffffghhhhhhhhhhj Systems.ppt
ssuser5f8f49
 
Secure_File_Storage_Hybrid_Cryptography.pptx..
Secure_File_Storage_Hybrid_Cryptography.pptx..Secure_File_Storage_Hybrid_Cryptography.pptx..
Secure_File_Storage_Hybrid_Cryptography.pptx..
yuvarajreddy2002
 
Ch3MCT24.pptx measure of central tendency
Ch3MCT24.pptx measure of central tendencyCh3MCT24.pptx measure of central tendency
Ch3MCT24.pptx measure of central tendency
ayeleasefa2
 
Stack_and_Queue_Presentation_Final (1).pptx
Stack_and_Queue_Presentation_Final (1).pptxStack_and_Queue_Presentation_Final (1).pptx
Stack_and_Queue_Presentation_Final (1).pptx
binduraniha86
 
Digilocker under workingProcess Flow.pptx
Digilocker  under workingProcess Flow.pptxDigilocker  under workingProcess Flow.pptx
Digilocker under workingProcess Flow.pptx
satnamsadguru491
 
IAS-slides2-ia-aaaaaaaaaaain-business.pdf
IAS-slides2-ia-aaaaaaaaaaain-business.pdfIAS-slides2-ia-aaaaaaaaaaain-business.pdf
IAS-slides2-ia-aaaaaaaaaaain-business.pdf
mcgardenlevi9
 
chapter 4 Variability statistical research .pptx
chapter 4 Variability statistical research .pptxchapter 4 Variability statistical research .pptx
chapter 4 Variability statistical research .pptx
justinebandajbn
 
Conic Sectionfaggavahabaayhahahahahs.pptx
Conic Sectionfaggavahabaayhahahahahs.pptxConic Sectionfaggavahabaayhahahahahs.pptx
Conic Sectionfaggavahabaayhahahahahs.pptx
taiwanesechetan
 
Thingyan is now a global treasure! See how people around the world are search...
Thingyan is now a global treasure! See how people around the world are search...Thingyan is now a global treasure! See how people around the world are search...
Thingyan is now a global treasure! See how people around the world are search...
Pixellion
 
C++_OOPs_DSA1_Presentation_Template.pptx
C++_OOPs_DSA1_Presentation_Template.pptxC++_OOPs_DSA1_Presentation_Template.pptx
C++_OOPs_DSA1_Presentation_Template.pptx
aquibnoor22079
 
Molecular methods diagnostic and monitoring of infection - Repaired.pptx
Molecular methods diagnostic and monitoring of infection  -  Repaired.pptxMolecular methods diagnostic and monitoring of infection  -  Repaired.pptx
Molecular methods diagnostic and monitoring of infection - Repaired.pptx
7tzn7x5kky
 
183409-christina-rossetti.pdfdsfsdasggsag
183409-christina-rossetti.pdfdsfsdasggsag183409-christina-rossetti.pdfdsfsdasggsag
183409-christina-rossetti.pdfdsfsdasggsag
fardin123rahman07
 
Calories_Prediction_using_Linear_Regression.pptx
Calories_Prediction_using_Linear_Regression.pptxCalories_Prediction_using_Linear_Regression.pptx
Calories_Prediction_using_Linear_Regression.pptx
TijiLMAHESHWARI
 
Template_A3nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
Template_A3nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnTemplate_A3nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
Template_A3nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
cegiver630
 
Deloitte Analytics - Applying Process Mining in an audit context
Deloitte Analytics - Applying Process Mining in an audit contextDeloitte Analytics - Applying Process Mining in an audit context
Deloitte Analytics - Applying Process Mining in an audit context
Process mining Evangelist
 
Ppt. Nikhil.pptxnshwuudgcudisisshvehsjks
Ppt. Nikhil.pptxnshwuudgcudisisshvehsjksPpt. Nikhil.pptxnshwuudgcudisisshvehsjks
Ppt. Nikhil.pptxnshwuudgcudisisshvehsjks
panchariyasahil
 
Medical Dataset including visualizations
Medical Dataset including visualizationsMedical Dataset including visualizations
Medical Dataset including visualizations
vishrut8750588758
 
Minions Want to eat presentacion muy linda
Minions Want to eat presentacion muy lindaMinions Want to eat presentacion muy linda
Minions Want to eat presentacion muy linda
CarlaAndradesSoler1
 
Just-In-Timeasdfffffffghhhhhhhhhhj Systems.ppt
Just-In-Timeasdfffffffghhhhhhhhhhj Systems.pptJust-In-Timeasdfffffffghhhhhhhhhhj Systems.ppt
Just-In-Timeasdfffffffghhhhhhhhhhj Systems.ppt
ssuser5f8f49
 
Secure_File_Storage_Hybrid_Cryptography.pptx..
Secure_File_Storage_Hybrid_Cryptography.pptx..Secure_File_Storage_Hybrid_Cryptography.pptx..
Secure_File_Storage_Hybrid_Cryptography.pptx..
yuvarajreddy2002
 
Ch3MCT24.pptx measure of central tendency
Ch3MCT24.pptx measure of central tendencyCh3MCT24.pptx measure of central tendency
Ch3MCT24.pptx measure of central tendency
ayeleasefa2
 
Stack_and_Queue_Presentation_Final (1).pptx
Stack_and_Queue_Presentation_Final (1).pptxStack_and_Queue_Presentation_Final (1).pptx
Stack_and_Queue_Presentation_Final (1).pptx
binduraniha86
 
Digilocker under workingProcess Flow.pptx
Digilocker  under workingProcess Flow.pptxDigilocker  under workingProcess Flow.pptx
Digilocker under workingProcess Flow.pptx
satnamsadguru491
 
IAS-slides2-ia-aaaaaaaaaaain-business.pdf
IAS-slides2-ia-aaaaaaaaaaain-business.pdfIAS-slides2-ia-aaaaaaaaaaain-business.pdf
IAS-slides2-ia-aaaaaaaaaaain-business.pdf
mcgardenlevi9
 
chapter 4 Variability statistical research .pptx
chapter 4 Variability statistical research .pptxchapter 4 Variability statistical research .pptx
chapter 4 Variability statistical research .pptx
justinebandajbn
 

"Petascale Genomics with Spark", Sean Owen,Director of Data Science at Cloudera

  • 1. 1© Cloudera, Inc. All rights reserved. The Redemptive Power of Hadoop Sean Owen | @sean_r_owen Scaling Up Genomics with Spark
  • 2. 2© Cloudera, Inc. All rights reserved. What is genomics?
  • 3. 3© Cloudera, Inc. All rights reserved. Organism Cell Genome
  • 4. 4© Cloudera, Inc. All rights reserved.
  • 5. 5© Cloudera, Inc. All rights reserved. Reference chromosome Location
  • 6. 6© Cloudera, Inc. All rights reserved. “… decoding the Book of Life”
  • 7. 7© Cloudera, Inc. All rights reserved.
  • 8. 8© Cloudera, Inc. All rights reserved.
  • 9. 9© Cloudera, Inc. All rights reserved.
  • 10. 10© Cloudera, Inc. All rights reserved.
  • 11. 11© Cloudera, Inc. All rights reserved.
  • 12. 12© Cloudera, Inc. All rights reserved.
  • 13. 13© Cloudera, Inc. All rights reserved. >read1 TTGGACATTTCGGGGTCTCAGATT >read2 AATGTTGTTAGAGATCCGGGATTT >read3 GGATTCCCCGCCGTTTGAGAGCCT >read4 AGGTTGGTACCGCGAAAAGCGCAT Bioinformatics!
  • 14. 14© Cloudera, Inc. All rights reserved. Alignment Dedup Recalibrate QC/Filter Variant Calling Variant Annotation Pipelines!
  • 15. 15© Cloudera, Inc. All rights reserved. C HPC (scheduler) POSIX filesystem Java HPC (Queue) POSIX filesystem C++ Single-node SQLite It’s file formats all the way down!
  • 16. 16© Cloudera, Inc. All rights reserved. ##fileformat=VCFv4.1 ##fileDate=20090805 ##source=myImputationProgramV3.1 ##reference=file:///seq/references/1000GenomesPilot-NCBI36.fasta ##contig=<ID=20,length=62435964,assembly=B36,md5=f126cdf8a6e0c7f379d618ff66beb2da,species="Homo sapiens",taxonomy=x> ##phasing=partial ##INFO=<ID=NS,Number=1,Type=Integer,Description="Number of Samples With Data"> ##INFO=<ID=DP,Number=1,Type=Integer,Description="Total Depth"> ##INFO=<ID=AF,Number=A,Type=Float,Description="Allele Frequency"> ##INFO=<ID=AA,Number=1,Type=String,Description="Ancestral Allele"> ##INFO=<ID=DB,Number=0,Type=Flag,Description="dbSNP membership, build 129"> ##INFO=<ID=H2,Number=0,Type=Flag,Description="HapMap2 membership"> ##FILTER=<ID=q10,Description="Quality below 10"> ##FILTER=<ID=s50,Description="Less than 50% of samples have data"> ##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype"> ##FORMAT=<ID=GQ,Number=1,Type=Integer,Description="Genotype Quality"> ##FORMAT=<ID=DP,Number=1,Type=Integer,Description="Read Depth"> ##FORMAT=<ID=HQ,Number=2,Type=Integer,Description="Haplotype Quality"> #CHROM POS ID REF ALT QUAL FILTER INFO FORMAT NA00001 NA00002 NA00003 20 14370 rs6054257 G A 29 PASS NS=3;DP=14;AF=0.5;DB;H2 GT:GQ:DP:HQ 0|0:48:1:51,51 1|0:48:8:51,51 1/1:43:5:.,. 20 17330 . T A 3 q10 NS=3;DP=11;AF=0.017 GT:GQ:DP:HQ 0|0:49:3:58,50 0|1:3:5:65,3 0/0:41:3 20 1110696 rs6040355 A G,T 67 PASS NS=2;DP=10;AF=0.333,0.667 GT:GQ:DP:HQ 1|2:21:6:23,27 2|1:2:0:18,2 2/2:35:4 20 1230237 . T . 47 PASS NS=3;DP=13;AA=T GT:GQ:DP:HQ 0|0:54:7:56,60 0|0:48:4:51,51 0/0:61:2 Compressed text files (non-splittable) Semi-structured Poorly specified Global sort order
  • 17. 17© Cloudera, Inc. All rights reserved. /** * Main work method. Reads the BAM file once and collects sorted information about * the 5' ends of both ends of each read (or just one end in the case of pairs). * Then makes a pass through those determining duplicates before re-reading the * input file and writing it out with duplication flags set correctly. */ protected int doWork() { // build some data structures buildSortedReadEndLists(useBarcodes); generateDuplicateIndexes(useBarcodes); final SAMFileWriter out = new SAMFileWriterFactory().makeSAMOrBAMWriter(outputHeader, true, OUTPUT); final CloseableIterator<SAMRecord> iterator = headerAndIterator.iterator; while (iterator.hasNext()) { final SAMRecord rec = iterator.next(); if (!rec.isSecondaryOrSupplementary()) { if (recordInFileIndex == nextDuplicateIndex) { rec.setDuplicateReadFlag(true); // Now try and figure out the next duplicate index if (this.duplicateIndexes.hasNext()) { nextDuplicateIndex = this.duplicateIndexes.next(); } else { // Only happens once we've marked all the duplicates nextDuplicateIndex = -1; } } else { Method Code
  • 18. 18© Cloudera, Inc. All rights reserved. @Option(shortName = "MAX_FILE_HANDLES", doc = "Maximum number of file handles to keep open when spilling " + "read ends to disk. Set this number a little lower than the " + "per-process maximum number of file that may be open. This " + "number can be found by executing the 'ulimit -n' command on " + "a Unix system.") public int MAX_FILE_HANDLES_FOR_READ_ENDS_MAP = 8000; Dedup Method Code Platform
  • 19. 19© Cloudera, Inc. All rights reserved. Alignment Dedup Recalibrate QC/Filter Variant Calling Variant Annotation
  • 20. 20© Cloudera, Inc. All rights reserved. It’s pipelines all the way down! Alignment Dedup Recalibrate QC/Filter Variant Calling Variant Annotation Node 1 Alignment Dedup Recalibrate QC/Filter Variant Calling Variant Annotation Node 2 Alignment Dedup Recalibrate QC/Filter Variant Calling Variant Annotation Node 3
  • 21. 21© Cloudera, Inc. All rights reserved.
  • 22. 22© Cloudera, Inc. All rights reserved. Alignment Dedup Recalibrate QC/Filter Variant Calling Variant Annotation Alignment Dedup Recalibrate QC/Filter Alignment Dedup Recalibrate QC/Filter
  • 23. 23© Cloudera, Inc. All rights reserved. Node 1 Alignment Dedup Recalibrate QC/Filter Variant Calling Variant Annotation Node 2 Node 3 Alignment Dedup Recalibrate QC/Filter Alignment Dedup Recalibrate QC/Filter Node 4
  • 24. 24© Cloudera, Inc. All rights reserved. Node 1 Alignment Dedup QC/Filter Variant Calling Variant Annotation Node 2 Node 3 Alignment Dedup QC/Filter Alignment Dedup QC/Filter Node 4 Recalibrate
  • 25. 25© Cloudera, Inc. All rights reserved. Why Are We Still Defining File Formats By Hand? • Instead of defining custom file formats for each data type and access pattern… • Parquet creates a compressed format for each Avro-defined data model • Improvements over existing formats • ~20% for BAM • ~90% for VCF
  • 26. 26© Cloudera, Inc. All rights reserved. YARN-managed Hadoop cluster Spark executors 𝑗=1 𝑑 𝑖 𝑃(𝑏𝑖𝑗|𝑒𝑖𝑗, 𝑓𝑖) 𝑗=1 𝑑 𝑖 𝑃(𝑏𝑖𝑗|𝑒𝑖𝑗, 𝑓𝑖) 𝑗=1 𝑑 𝑖 𝑃(𝑏𝑖𝑗|𝑒𝑖𝑗, 𝑓𝑖)Partial sums 𝑖=1 𝑁 𝑗=1 𝑑 𝑖 𝑃(𝑏𝑖𝑗|𝑒𝑖𝑗, 𝑓𝑖) Driver Application code ContEst Algorithm
  • 27. 27© Cloudera, Inc. All rights reserved. Hadoop provides layered abstractions for data processing HDFS (scalable, distributed storage) YARN (resource management) MapReduce Impala (SQL) Solr (search) Spark ADAMquince guacamole … bdg-formats(Avro/Parquet)
  • 28. 28© Cloudera, Inc. All rights reserved. Executing query in Hadoop: interactive Spark shell (ADAM) def inDbSnp(g: Genotype): Boolean = true or false def isDeleterious(g: Genotype): Boolean = g.getPolyPhen val samples = sc.textFile("path/to/samples").map(parseJson(_)).collect() val dbsnp = sc.textFile("path/to/dbSNP").map(_.split(",")).collect() val dnaseRDD = sc.adamBEDFeatureLoad("path/to/dnase”) val genotypesRDD = sc.adamLoad("path/to/genotypes") val filteredRDD = genotypesRDD .filter(!inDbSnp(_)) .filter(isDeleterious(_)) .filter(isFramingham(_)) val joinedRDD = RegionJoin.partitionAndJoin(sc, filteredRDD, dnaseRDD) val maf = joinedRDD .keyBy(x => (x.getVariant, getPopulation(x))) .groupByKey() .map(computeMAF(_)) maf.saveAsNewAPIHadoopFile("path/to/output") apply predicates load data join data group-by aggregate (MAF) persist data
  • 29. 29© Cloudera, Inc. All rights reserved. • Hosted at Berkeley and the AMPLab • Apache 2 License • Contributors from both research and commercial organizations • Core spatial primitives, variant calling • Avro and Parquet for data models and file formats Spark + Genomics = ADAM
  • 30. 30© Cloudera, Inc. All rights reserved. Core Genomics Primitives: Spatial Join
  • 31. 31© Cloudera, Inc. All rights reserved. ADAM preliminary performance
  • 32. 32© Cloudera, Inc. All rights reserved.
  • 33. 33© Cloudera, Inc. All rights reserved. Acknowledgements UCBerkeley Matt Massie Frank Nothaft Michael Heuer Tamr Timothy Danford MSSM Jeff Hammerbacher Ryan Williams Cloudera Uri Laserson Tom White Sandy Ryza
  • 34. 34© Cloudera, Inc. All rights reserved. Thank you @sean_r_owen [email protected]

Editor's Notes

  • #2: Before we dive in, let me ask a couple of questions: Biologists? Spark experts? There are always at least three different constituencies in the room: * biologists * programmers * someone thinking about how to build a business around this Gonna tell you a lot of lies today. Won’t satisfy everyone. Where I skip over the truth, maybe there will be at least a breadcrumb of truth left over. This will not be a very technical talk.
  • #3: What even is genomics? Who here has heard the terms ‘chromosome’ and ‘gene’ before, and could explain the difference? So before we dive into the main part of the talk, I’m going to spend a few minutes discussing some of the basic biological concepts.
  • #4: But each of those cells has, ideally, an identical genome. The genome is a collection of 23 linear molecules. These are called ‘polymers,’ they’re built (like Legos) out of a small number of repeated interlocking parts – these are the A, T, G, and C you’ve probably heard about. The content of the genome is determined by the linear order in which these letters are arranged. (Linear is important!)
  • #5: Without losing much, assume that our genomes are contained on just a single chromosome. Now, not only do all the cells in your body have identical genomes… [ADVANCE]
  • #6: We can define a concept of ‘location’ across chromosomes. This is possibly the most important concept in genome informatics, the idea that DNA defines a common linear coordinate system. This also means that we can talk about differences between individuals in terms of diffs to a common reference genome. But where does this reference genome come from?
  • #7: Here is Bill Clinton (and Craig Venter and Francis Collins), announcing in June of 2000 the “rough draft” of the Human Genome – this is the Human Genome Project. Took >10 years and $2 billion What did this actually do?
  • #8: Anyone recognize this? Genome analogy: a text file a part of the linear sequence of ACGTs. Difficult to understand.
  • #9: Mapmakers work to add ANNOTATIONS to the map.
  • #10: And often, it’s only the annotations that are interesting, so mapmakers focus on *annotation* of the maps themselves. The core technologies are 2D planar and spherical geometry, geometric operations composed out of latitudes and longitudes. What does the annotated map of the genome look like?
  • #12: Chromosome on top. Highlighted red portion is what we’re zoomed in on. See the scale: total of about 600,000 bases (ACGTs) arranged from left to right. Multiple annotation “tracks” are overlaid on the genome sequence, marking functional elements, positions of observed human differences, similarity to other animals. In part it’s the product of numerous additional large biology annotation projects (e.g., HapMap project, 1000 Genomes, ENCODE). Lot's of bioinformatics is computing these elements, or evaluating models on top of the elements. How are these annotations actually generated? Shift gears and talk about the technology.
  • #13: DNA SEQUENCING If satellites provide images of the world for cartography, sequences are the microscopes that give you “images” of the genome. Over past decade, massive EXPONENTIAL increase in throughput (much faster than Moore’s law)
  • #14: Bioinformatics is the computational process to reconstruct the genomic information. But… [ADVANCE]
  • #15: Pipelines, of course. Example pipeline: raw sequencing data => a single individual’s “diff” from the reference. How are these typically structured? Each step is typically written as a standalone program – passing files from stage to stage These are written as part of a globally-distrbuted research program, by researchers and grad students around the world, who have to assume the lowest common denominator: command line and filesystem What does one of these files look like?
  • #16: Bioinformaticians LOVE hand-coded file formats. But only store several fundamental data types. Strong assumptions in the formats. Inconsistent implementations in multiple languages. Doesn’t allow different storage backends. OK, we discussed what the data/files are like that are passed around. What about the computation itself?
  • #17: Imposes severe constraint: global sort invariant. => Many impls depend on this, even if it’s not necessary or conducive to distributed computing.
  • #18: But what if we jump into one of these functions. You’ll find a dependence on… [ADVANCE]
  • #19: Most bioinformatics tools make strong assumptions about their environments, and also the structure of the data (e.g., global sort), when it shouldn’t be necessary. Ok, but that’s not all… [ADVANCE]
  • #20: We’ve looked at the data and a bit of code for one of these tools. But this runs the pipeline on a single individual. But of course, it’s never one pipeline… [ADVANCE]
  • #21: Scale out! Typically managed with a pretty low-level job scheduler.
  • #22: SCALE! New levels of ambition for large biology projects. 100k genomes at Genomics England in collaboration with National Health Service. Raw data for a single individual can be in the hundreds of GB But even before we hit that huge scale (which is soon)…
  • #23: We don’t want to analyze each sample separately. We want to use ALL THE DATA we generate. Well, these pipelines often include lots of aggregation, perhaps we can just… [ADVANCE]
  • #24: Do the easy thing! Not ideal, especially as the amount of data goes up (data transfer), number of files increases (we saw file handles). May start hitting the cracks. But even worse… [ADVANCE]
  • #25: God help you if you want to jointly use all the data in earlier part of the pipeline. 2 Problems: Large scale Using all data simultaneously
  • #26: Things like global sort order are overly restrictive and leads to algos relying on it when it’s not necessary.
  • #27: Example of an algo. Bioinformatics loves evaluating probabilistic models on the chromosomes. We can easily extract parallelism at different parts of our pipelines. Use higher level distributed computing primitives and let the system figure out all the platform issues for you: storage, job scheduling, fault tolerance, shuffles.
  • #28: Cheap scalable STORAGE at bottom Resource management middle EXECUTION engines that can run your code on the cluster and provide parallelism Consistent SERIALIZATION framework Scientist should NOT WORRY about lower levels (coordination, file formats, storage details, fault tolerance)
  • #29: Another computation for a statistical aggregate on genome variant data. Details not important. Spark data flow: Distributed data load High level joins/spatial computations that are parallelized as necessary. But really nice thing is because our data is stored using the Avro data model… [ADVANCE]
  • #30: We’ve implemented this vision with Spark, starting from the Amplab (same people that gave you Spark) into a project called ADAM The reason this works is that Spark naturally handles pipelines, and automatically performs shuffles when appropriate, but also…
  • #31: In addition to some of the standard pipeline transformations, implemented the core spatial join operations (analogous to a geospatial library).
  • #32: Single-node performance improvements. Free scalability: fixed price, significant wall-clock improvements See most recent SIGMOD.
  • #33: Not to be outdone, Craig Venter proposes 1 million genomes at Human Longevity Inc.
  • #35: Cloudera is hiring. Including the data science team.