"The role of the nuclear factor TDP 43 in neurodegeneration" by Francisco E. Baralle

"The role of the nuclear factor TDP 43 in neurodegeneration" by Francisco E. Baralle

• 1.
  International Centre forGenetic Engineering and Biotechnology. Trieste (Italy) The role of the nuclear factor TDP 43 in neurodegeneration.
• 2.
  The cellular RNAworld:
• 3.
  Pre-mRNA splicing • Essentialstep in gene expression • >15% of human genetic diseases involve splicing errors • Important regulatory step in gene expression Alternative splicing AUG AUG UGA UGA
• 4.
  Basic elements involvedin the RNA splicing process 5’ splice site: recognized by U1snRNP 3’ splice site: a) 3’ junction (AG): recognized by U2AF35 b) Poly-pyrimidine tract (PPT): recognized by U2AF65 c) Branch Point (BP): recognized by the Branch-point Binding Protein AGguragu U1snRNP mBBP (SF1) ynyurac ( y)nnyag 5’ss BP PPT 3’ss 35 65 U2AF subunits U2snRNP
• 5.
  Exon 1 5’ pGU (Py)nA Branchsite AGp 3’ 5’-splice site 3’-splice site SF1 U2AF65 U2AF35 Regulatory Elements in pre-mRNA splicing Exon 2 Regulatory sequence Regulatory sequence U1 Enhancer Silencer
• 6.
  Exon 1 5’ pGU (Py)nA Branchsite AGp 3’ 5’-splice site 3’-splice site SF1 U2AF65 U2AF35 Regulatory Elements in pre-mRNA splicing Exon 2 Regulatory sequence Regulatory sequence U1 Enhancer Silencer
• 7.
  Over the years,a great number of Enhancer and Silencer factors have been identified: Enhancers Silencers SR protein family hnRNPs (such as A/B family, PTB, CELF protein family hnRNP H…etc). hnRNP L TDP-43 Tra2 YB-1 NOVA In many cases exclusion/inclusion may thus determined by the resulting balance of power
• 8.
  Splicing mutations canbe found in virtually any intron-containing gene. The frequency depends on overall length and individual susceptibilities
• 9.
  Classical and nonclassical CF
• 10.
  Five “neutral” substitutionsout of 19 induce exon skipping The probability of inducing exon skipping is about 26% In CFTR exon 12 synonymous sites are under selective pressure to maintain the exon inclusion The same sense mutations A49G, C40T and C52T are found in patients and cause CFTR exon 12 skipping. CERES 2
• 11.
  The coding sequencesof CFTR exon 9 overlap with splicing regulatory sequences.WTexon9 G424S D443Y I444S A455E V456F 9 + 9 - Q414X N418S Q452P percentofexon9inclusion exon 9 100 0 10 20 30 40 50 60 70 80 90 WT Q414X N418S G242S D443Y I444S Q452P A455E V456F
• 12.
  241 2 34 5 6a 6b 7 8 10 1112 14a14b 15 16 191817b17a 222120 23 TAGATG 13 mRNA CFTR Exons 9 Normal splicing Aberrant splicing CFTR protein MSD 1 MSD 2 NBD1 NBD2 Dominio R Plasmatic membrane NH2 COOH 8 9 10 8 10 8 9 10Pre-mRNA The degree of skipping of normal exon 9 is associated with the presence of polymorphic variants of the polypirimidine tract at the 3’ end of intron 8 (TG repeats from 9 to 13 and T9, T7, T5, T3) TTTTGATGTGTGTGTGTGTGTGTGTTTTTTTTTAACAG exon9 3’ss (TG)m Skipping of exon 9 is associated to monosymptomatic forms of CF (Congenital Bilateral Aplasia Vas Deferens, bronchiectasia, pancreatitis) and produce a non functional protein. (T)n
• 13.
  Clinical phenotype Normal Non-classical CF Cystic Fibrosis CFTR genotype T9 T7 T5 T5 T3 (TG)m(T)n 98 10 Inclusion Skipping This is one of the best clinical associations between a non coding genotype and a disease outcome: TG9 TG10 TG11 TG12 TG13 TTTTGATGTGTGTGTGTGTGTGTGTTTTTTTTTAACAG 3’ss TG T9 9 TTG 13 3 3’ss TTTTGATGTGTGTGTGTGTGTGTGTGTGTGTGTTTAACAG high inclusion low inclusion
• 14.
  Minigene system appliedto CFTR exon 9 splicing allowed us to replicate the effects of the UGmUn polymorphisms observed in patients.
• 15.
  The first welldocumented role of TDP-43 was the inhibition of CFTR exon 9 splicing and interactions with other hnRNPs.
• 16.
  TDP-43 cellular functionsare mediated by its binding to GU rich RNA sequences and its interactions with other hnRNPs. Its structure and biological properties are evolutionary conserved from Drosophila to Man
• 18.
  RNA binding isessential for TDP-43 function in splicing
• 19.
  Transgenic TDP 43expression in HEK 293 cell lines down regulates the endogenous gene:
• 20.
  Transgene TDP-43 expressionin stably transfected HEK293 cell lines cause reduction in endogenous TDP 43 gene expression: GAPDH Induced TG TDP-43 WT F147/149L 72h Induction 2 3 4 51 6 7 8 2.8 kb 2 3 4 51 6 7 coding sequence untranslated sequence TDPBR TDP-43 mRNA species in stably transfected HEK293 cell lines are downregulated following transgene TDP 43 cDNA induction: 2 3 4 5 6 pA4 pA1 TG-TDP43 TDP-43 RNA binding function is essential for self regulation
• 21.
  coding sequence untranslated sequence TDPBR x7 Tet 7 7 -+ endog. 2 3 4 51 6 7 8 int6 int7 Tet - + 7 7 a anchor TTTT 1 2 a-anchor endog. GFPfw-anchor tag 2.8 kb GFP reporter – +Tet – + DiGFP X7 7 8GFP X7-TDPBR 7 8GFP gt ag gt ag tag tag The TDPBR in the 3-UTR is needed for the regulatory feedback loop GFPfw-anchor 7 7
• 22.
  valuesnormalizedtoU6snRNA - Tet + Tet BrUTPnuclear Run-on X 1 X4i nt4 X6c p A 1 h2p A4 3’p A4 10000 0 20000 30000 40000 50000 X1 X4int4 2 3 4 51 6 7 h2pA4 3’pA4 X6c pA1 8 endog. coding sequence non-coding sequence TDPBR RNA polymerase II stalls in correspondence to the TDPBR region: Low TDP-43 concentrations (-Tet) High TDP-43 concentrations (+Tet) What events are associated with stalling? Tet - + - + N C 1 2 1 g 2 71 72 6 TDPBR AAAAAAA + Two events: intron 7 skipping and a pA switch from pA1 to pA2 TDPBR 6
• 23.
  X7-sup5’-3’ GFP GFP TDP-43 TDP-43 int7 Cytoplasm Nucleus Improved 3’ss-5ss Rapidnuclear degradation Reduced amounts of mRNA and protein produced GFP Cytoplasm Nucleus No degradation High amounts of mRNA and protein produced X7-in7 cDNA Intronless construct GFP int7 * * Int7 removal Nuclear retention GFP * * Unproductive spliceosomal complex Model of TDP-43 autoregulation: The splicing process in a 3’UTR may be recognized by the cell as anomalous and marked as an intron incompletely processed that must be degraded
• 24.
  Protein aggregation inneurodegenerative diseases A wide variety of neurodegenerative diseases are characterized by the accumulation of intracellular or extracellular protein aggregates. Ross C.& Poirier M., 2005 Huntington Parkinson Alzheimer
• 25.
  Progressive neurodegenerative disease,that affects motor neurons that provide voluntary movements and muscle power. When muscles no longer receive the messages from the motor neurons that they require to function, the muscles begin to atrophy (become smaller). Some numbers: The disease prevalence is ~5 people each 100,000. Most people develop ALS between 40 and 70 years old (average 55). Life expectancy of an ALS patient averages from 2 to 5 years from the time of the diagnosis. Amyotrophic Lateral Sclerosis
• 26.
  Pol II Transcriptional regulation miRNA processing pre-mRNA splicing Stressgranule formation AAAAAA m7G AAAAAA m7G Translation and protein homeostasis m7G Autoregulation AAAAAA m7G mRNA stability Nuclear/cytoplasmic shuttling mRNA transport TDP Binding region (TDPBR) Stress, oxidizing agents, ageing autophagy, ubiquitin-proteasome system (UPS) Normal degradation pathways Chromatin hnRNPs FUS/TLS P P P P P Ub Ub Ub P P Ub Ub P Aggregation TAR DNA Binding Protein (TDP 43) is a splicing factor that belongs to the hnRNP family and plays a role in many aspects of RNA metabolism. Its aggregation/dysfunction is central to ALS and FTLD pathogenesis Buratti and Baralle, 2012, TiBS 37: 237.
• 27.
  Ubiquitinated, misfolded andhyper phosphorylated TDP 43 was identified as the major component of the pathological inclusions found in the brain of FTLD and ALS patients Neumann et al., 2006 Science 314: 130-136
• 29.
  Deletion of theDrosophila homologue of human TDP-43 )TBPH) leads to a paralytic phenotype: But cannot get out of the pupal cage without external help, are deficient in locomotion and have a very short life span Flies apparently develop normally
• 30.
  W1118; TBPH/TBPHW1118; +/+control Deletion of TBPH does not affect the external morphology of mutant flies But flies develop locomotive effects W1118;TBPH+/+
• 31.
  Genetic Expression ofHuman TDP-43 in Motoneurons can rescue fly motility TBPH23/-; D42-G4/ UAS-hTDP-43 TBPH23/TBPH23 TBPH23/-; Elav-G4/ UAS-hTDP-43
• 32.
  TBPH LOF affectsSynaptic Growth and Bouton Shape W1118 TBPHΔ23 TBPHΔ142 W1118 TBPHΔ23 TBPHΔ142 siRNA Tg-hTDP43
• 33.
  Microtubule Organization TBPHΔ23/D23TBPHΔ142/Δ142 W1118Rescue anti-HRP anti-MAP-1Bmerge
• 34.
  Ubiquitinated, misfolded andhyper phosphorylated TDP 43 was identified as the major component of the pathological inclusions found in the brain of FTLD and ALS patients Neumann et al., 2006 Science 314: 130-136
• 35.
  Transcriptional regulation pre-mRNA splicing miRNA processing Autoregulation mRNA transport and stability Aggregation TAR DNABinding Protein (TDP 43) is a splicing factor that belongs to the hnRNP family and plays a role in many aspects of RNA metabolism. Its dysfunction is central to ALS and FTLD pathogenesis RRM1 RRM2 C-terminal tail NLS N C NES RRM domainsN-terminal tail Q/N 1 414342 366 TDP Binding region (TDPBR) AAAAAA m7G Translation
• 36.
  A peptide containingthe 321-366 region of TDP-43 can efficiently compete with hnRNP A2 for the binding to TDP-43 321AMMAAAQAALQSSWGMMGMLASQQNQSGPSGNNQNQGNMQREPNQA366 C-terminal tail of TDP-43 contains a Q/N domain that mediates its interaction with hnRNPs.
• 37.
   p342-366 p342AAAA p363AAAA p352AAAAA (UG)6 (UG)6 (UG)6 peptide THE Q/N RICHREGI0N IS ESSENTIAL A2 INTERACTION AND AGGREGATION
• 38.
  -- + p321-366 (2,5M) 510 20 GST-A2 288-341 (M)5 10- TDP-43 (1M)+ + + + + + + + - %ofsignalremained inthewells 4 5 62 31 7 8 0 20 40 60 80 100 120 1 + + + + + + + + GST-A2 288-341 (M) TDP-43 5 10 20 405 10 + p321-366 (2,5M) GST 288 341 GST- A2-(288-341) A2 Aggregate formation induced by the p321-366 peptide can be competed by addition of an excess amount of hnRNP A2 C-terminal sequence
• 39.
  0 10 20 30 40 50 60 70 1FLAG-TDP-43 + EGFP FLAG-TDP-43 + EGFP-12xQ/N IN S P %ofFLAG-TDP-43 -C -C 331-369 -C -C Tandemrepeats of the Q/N rich sequence induce in vitro and in vivo aggregation of TDP 43 IN S P IN S P FLAG-TDP-43 + EGFP-12xQ/N WB:anti-FLAGWB:anti-GFP FLAG-TDP-43 + EGFP 30 46 58 46 1 2 3 4 5 6 SDS 0,5% 0,25 uM + + + + + WB:anti-TDP-43 GST-TDP-43 EGFP-constructs 0,125 uM
• 40.
  FUS-V5 (anti-V5) FLAG-TIA-1 anti-FLAG EGFP-12xQ/N Merge FUS-V5 (anti-V5) FLAG-TIA-1 anti-FLAG EGFP-12xQ/N Merge EGFPEGFP-1xQ/NEGFP-4xQ/NEGFP-12xQ/N EGFP EndoTDP-43 (anti-TDP-43) DAPI Merge EGFP/anti-TDP-43 Enlarged image
• 41.
  FLAG-TDP-43 WT +GFP- 12xQ/N FLAG-TDP-43 321-366 + GFP-12xQ/N FLAG-TDP-43 F147,149/L + GFP- 12xQ/N anti-FLAGGFP-12xQ/NMERGE Enlargedimagefrom eachcondition * * * FLAG-TDP-43 321-366 + GFP-12xQ/N The Q/N rich TDP 43 region is essential for the recruitment of TDP 43 to the aggregates while the RNA binding function is not needed
• 42.
  +Tetracycline -Tetracycline TDP-12xQ/N TDP-43 Aggregate formation: Red- TDP-12xQ/N Green– (End. TDP-43) Yellow (merge) Blue (nuclei)
• 43.
  EGFP-12xQ/N Anti-TDP-43 Merge Anti-FlagAnti-TDP-43 MERGE anti-Flag/anti-TDP-43 Aggregation can be enhanced by linking 12xQ/N to TDP 43 itself
• 44.
  Tet + +-- variant 1 variant 2 47.5 α-POLDIP3 variant 1 variant 2 SPLICING CHANGES AFTER AGGREGATION ARE SIMILAR TO THOSE OBSERVED AFTER TDP 43 DEPLETION BY RNAi
• 45.
  Climbing Solubility IHC Movement IHC Adult fly 3rdinstar larvae Looking for a phenotype… Driver: Elav, nSyb, GMR, etc. Temperature: 25 or 29°C Growth cycle: Adult fly or 3rd instar larvae TDP-43 aggregation model in flies
• 46.
  Climbing during aging 29°C e la v /W 1 1 1 8 e la v /E G F P # 3 e la v /G F P 1 2 x # 3 0 20 4 0 6 0 8 0 1 0 0 2 9 C D 1 E L A V G e n o ty p e %Topclimbingflies e la v /W 1 1 1 8 e la v /E G F P # 3 e la v /G F P 1 2 x # 3 0 2 0 4 0 6 0 8 0 1 0 0 2 9 C D 7 E L A V G e n o ty p e %Topclimbingflies ** * e la v /W 1 1 1 8 e la v /E G F P # 3 e la v /G F P 1 2 x # 3 0 2 0 4 0 6 0 8 0 1 0 0 2 9 C D 1 4 E L A V G e n o ty p e %Topclimbingflies * **
• 47.
  CLIMBING ASSAY ELAV12XQ/N
• 48.
  Larval brain immunohistochemistry •Temperature: 25°C • Growth cycle: 3rd instar larvae • Antibodies: Anti ELAV (rat): 1:250 Anti TBPH (rabbit): 1:300 Anti GFP (mouse): 1:200
• 49.
  +/Elav; +/EGFP2 29°C Anti GFP AntiELAV Merge +/Elav; +/GFP12x 29°C Merge
• 50.
  Genetic interaction TBPHand GFP-12xQ/N
• 51.
  Genetic interaction TBPHand GFP-12xQ/N Larval eye disc IHC • Temperature: 25°C • Growth cycle: 3rd instar larvae • Antibodies: Anti ELAV (rat): 1:250 Anti Flag-TBPH (mouse): 1:200 Anti GFP (rabbit): 1:250
• 52.
  GMR/+; TB1/+ 25°C Anti ELAVAntiFlag-TB1 Merge
• 53.
  Merge Merge Anti ELAVAntiGFPAnti Flag-TB1 GMR/+; TB1;12X/+ 25°C
• 54.
  Finding drugs toclear TDP-43 aggregates One possible approach could be to enhance degradation of the aggregated protein. Endogenous TDP-43 Newly produced TDP-43 Will be less sequestered = “TDP-43 sink”
• 55.
  Aggregates induced bytransient transfection of EGFP12Q/N display autophagosomal markers
• 56.
  Hek293 GFP-12xQ/N Tet induction for24 hrs Wash Compound treatment for 48 hrs Cell lysis SDS-PAGE with urea and DTT WB anti GFP Clearance assay using the cellular model of TDP-43 aggregation
• 57.
  EGFP 12Q/N aggregatesare partially resolved by poly anions effectors
• 58.
  C 40uM 100uM actin GFP-12xQ/N TDP-43aggregation model in cells C 0.1uM 1uM 10uM 20uM actin GFP-12xQ/N actin GFP-12xQ/N C 20uMC 0.1uM 1uM 10uM FDA approved drug 1 FDA approved drug 2 FDA approved drug 3
• 59.
  Possible disease connectionsfollowing alterations at the TDP-43 autoregulatory loop level
• 60.
  INTERNATIONAL CENTRE FORGENETIC ENGINEERING AND BIOTECHNOLOGY Trieste, Italy Emanuele Buratti Amit Bhardwaj Mauricio Budini Laura De Conti Valentina Romano Maureen Okuku Jeremias Herzog Fatemeh Mohagheghi Zainuddin Quadri Simona Langellotti Maurizio Romano Cristiana Stuani Chiara Chiavelli Frederick Allain Peter Lukavsky Zurich CH Ashish Dhir Nick Proudfoot Oxford UK Fabian Feiguin Lucia Cragnaz Raffaella Klima
• 61.
  IP HEK-TDP-12X-Q/N stablecell line (HSP70) Is there anything else in the aggregates?
• 62.
  Anti-TDP-43 (Flag-TDP-12xQ/N and endogenous TDP-43) Anti-HSP70MERGE anti-TDP-43/anti-HSP70 Anti-HSP70 83 Tet + + + + + + 83 47.5 Anti-TDP-43 Anti-TDP-43 Hsp 70 is present in the early stage aggregates
• 63.
  FLAG-TDP-43 EGFP-12xQ/N MergeHA-Ubiquitin FLAG-TDP-43EGFP-12xQ/N Mergep409/p410 AGGREGATES ARE UBIQUITINATED AND PHOSPHORYLATED AS IN THE PATIENT’S BRAIN INCLUSIONS
• 64.
  GFP reporter – +Tet coding sequence untranslatedsequence TDPBR endog. 2 3 4 51 6 7 8 int6 int7 DiGFP tag 2.8 kb A X7-Δin7cDNA 7GFP 7GFP 7GFP B X7 7 8GFP 8 8 X7-pA2 X7-2pA1 X7-TDPBR 7 8GFP gt ag 7GFP 8X7-gt-ag gt ag gt ag gt ag tag gt ag tag tag tag tag tag gt ag – + – + – + – + – + Flag-TDP-43 TDP-43 end. Tub. X7 X7- TDPBR X7- gt-ag X7 -pA2 X7 -Δin7 cDNA X7- 2pA1 1 2 3 4 5 6 7 8 9 10 11 1 2 C D 1 2 3 4 5 6 7 8 9 10 11 1 2 GFP/DiGFPnormalizeddata 1.0 0.8 0.6 0.4 0.2 0.0 Analysis of the relative importance for self regulation of pAs quality and splicing
• 65.
  - + X7 - + X7-pA2X7-2pA1 - +TetTet Tet 77 7 8´ 8´´7 Cryptic pASV40 7 7 87 1 2 1 3 4 6 1 X7 7 8GFP GFPfw A B C D E anchor TTTT 7 Autoregulation Yes Yes Yes X7 gt-ag 71 - +Tet No F 5 G - +Tet No X7 TDPBR - + X7-Δin7cDNA Tet 72 No 7 7 7 8 Autoregulation mRNA isoforms in self regulation
• 66.
  TDP-43 continuosly shuttling betweenthe nucleus and the Cytoplasm. Physiological conditions TDP-43 localization Pathological conditions Exported to the cytoplasm to form insoluble aggregates. GOF LOF
• 67.
  Climbing during aging 25°C e la v /W 1 1 1 8 E la v /e g fp 2 E la v /1 2 X 3 0 20 4 0 6 0 8 0 1 0 0 g e n o ty p e %Topclimbingflies 2 5 C D 1 E L A V e la v /W 1 1 1 8 E la v /e g fp 2 E la v /1 2 X 3 0 2 0 4 0 6 0 8 0 1 0 0 2 5 C D 7 E L A V g e n o ty p e %Topclimbingflies * * e la v /W 1 1 1 8 E la v /e g fp 2 E la v /1 2 X 3 0 2 0 4 0 6 0 8 0 1 0 0 g e n o ty p e %Topclimbingflies 2 5 C D 1 4 E L A V *** ** e la v /W 1 1 1 8 E la v /e g fp 2 E la v /1 2 X 3 -2 0 0 2 0 4 0 6 0 8 0 1 0 0 g e n o ty p e %Topclimbingflies 2 5 C D 2 1 E L A V **** ****
• 68.
  Buratti and Baralle,2012, TiBS 37: 237. TAR DNA Binding Protein (TDP 43) is a splicing factor that belongs to the hnRNP family and plays a role in many aspects of RNA metabolism. Its aggregation/dysfunction is central to ALS and FTLD pathogenesis
• 69.
  RRM1 linker C-terminus N-terminus RRM2 P187 L188 Q184 K102 N259 C244 M132 I253 Q134 I249 L139 E200 R151 D247 S254 Interactions between theTDP-43 RRMs
• 70.
  RRM1 RRM2GUA5 D105 F149 S254 GUGUGAAUGAAU K145 R197 linker GUA5 interactsat the interface of both RRMs
• 71.
  RRM1 RRM2 GUA1 N179 W113 D174 GUA3 URA2R171 URA4 L177 K176 F147 I107 GUGUGAAUGAAU linker Specific interactions onRRM1
• 72.
  RRM1 RRM2 E261 URA8 GUA9 N259 S258 F229 F194 K192 K263 F231 F221 GUGUGAAUGAAU Specific interactions onRRM2
• 73.
  Functional studies onthe CFTR exon 9 splicing model of relevant TDP 43 amino acid variants + + + + + + + + + + Add back of si-resistant TDP-43 wt and mutants (X>A) + + GUA5 GUA1 GUA3 siRNA Ex 9+ Ex 9- URA4 URA8 GUA9 + + + + + + Single mutants + + + + + + + + + Double mutants Add back of si-resistant TDP-43 wt and mutants (X>A) Strong impairement of splicing inhibition ability Moderate impairement of splicing inhibition ability No/Weak impairement of splicing inhibition ability siRNA Ex 9+ Ex 9- WT F4 L M132 I249 R151 D247 D174 R171 K176 N179 K192 E261 D105 S254 WT F4L D105 F149 K181 R197 S254 H256 W113 R171 D174 K176 N179 F194 S258 K192 E261 K263
• 74.
  TDPBR 7 87 6 6 AAAAAAA 6 Low TDP-43concentrations High TDP-43 concentrations Efficient TDP-43 production coding sequence non-coding sequence AAAAAAA TDPBR Reduced TDP-43 production AAAAAAA + AAAAAAA Model of TDP-43 autoregulation:
• 75.
  A B 7GFP 7GFP 28S 18S Two identical mRNAsending in pA2 have different cellular distribution if they are generated from splicing or from direct transcription of an intronless gene
• 76.
  X7 7 8GFP X7-sup5’-3’7 8GFP gt ag gt ag A C Fig.4 gacg/gtgggtgt gCAg/gtAAgtgt tctttgttttgcag/ccctgaa tTtttTttttgcag/Gcctgaa - +Tet X7- sup5’-3’ 28S 18S 7GFP 7GFP B D WMM=6.61 WMM=13.07 NNSp=0.86 NNSp=1.00 X7- sup5’-3’ +CHX F GFP reporter DiGFP Tub. Flag-TDP-43 TDP-43 end. X7X7- sup5’- 3’ E - + - +Tet - + 7 Improved splice sites drive splicing Independently of TDP 43 levels but the mRNA produced is inefficient in protein production.
• 77.
  GFP Anti-digox-rhod merge Fig.5 X7 X7-Δin7cDNA X7-sup5’-3’ A B C TO-PRO3 9μ m 9μ m 9μ m 9μ m 9μm 9μm 9μm 9μm 9μ m 9μ m 9μ m 9μ m