27.

Principles of Inheritance &

Variation

27.1 Mendel’s Laws of Inheritance

1. How many true breeding pea plant varieties did
Mendel select as pairs, which were similar
except in one character with contrasting traits?
(a) 4 (b) 2
(c) 14 (d) 8 (NEET 2020)
2. Among the following characters, which one was
not considered by Mendel in his experiments on
pea?
(a) Trichomes-Glandular or non-glandular
(b) Seed-Green or yellow
(c) Pod-Inflated or constricted
(d) Stem-Tall or dwarf (NEET 2017)
3. Which one from those given below is the period
for Mendel’s hybridisation experiments?
(NEET 2017)
(a) 1840-1850 (b) 1857-1869
(c) 1870-1877 (d) 1856-1863
4. In his classic experiments on pea plants, Mendel
did not use …… (2015)
(a) seed shape (b) flower position
(c) seed colour (d) pod length.
5. How many pairs of contrasting characters in pea
plants were studied by Mendel in his
experiments? (2015 Cancelled)
(a) Eight (b) Seven
(c) Five (d) Six
6. Which one of the following traits of garden pea
studied by Mendel was a recessive feature?
(a) Axial flower position
(b) Green seed colour
(c) Green pod colour
(d) Round seed shape (2003)
7. The genes controlling the seven pea characters
studied by Mendel are now known to be located
on how many different chromosomes?
(a) Seven (b) Six
(c) Five (d) Four (2003)
8. According to Mendelism, which character shows
dominance?
(a) Terminal position of flower
(b) Green colour in seed coat
(c) Wrinkled seeds
(d) Green pod colour
(2000)
9. First geneticist / father of genetics was……
(a) De Vries (b) Mendel
(c) Darwin (d) Morgan. (1991)
10. Which contribute to the success of Mendel?
 (a) Qualitative analysis of data
(b) Observation of distinct inherited traits
(c) His knowledge of biology
(d) Consideration of one character at one time
(1988)
27.2 Inheritance of One Gene
11. Identify the wrong statement with reference to
the gene ‘I’ that controls ABO blood groups.
(a) The gene (I) has three alleles.
(b) A person will have only two of the three
alleles.
(c) When IA and IB are present together, they
express same type of sugar.
(d) Allele i does not produce any sugar.
(NEET 2020)
12. In Antirrhinum (Snapdragon), a red flower was
crossed with a white flower and in F1 generation
all pink flowers were obtained. When pink
flowers were selfed, the F2 generation showed
white, red and pink flowers. Choose the
incorrect statements from
the following.
(a) Law of segregation does not apply in this
experiment.
(b) This experiment does not follow the
Principle of Dominance.
(c) Pink colour in F1 is due to incomplete
dominance.
1 2 1
(d) Ratio of F2 is (red) : (pink) : (white).
4 4 4

(NEET 2019)
13. The genotypes of a husband and wife are IAIB and
IAi. Among the blood types of their children, how
many different genotypes and phenotypes are
possible?
(a) 3 genotypes; 4 phenotypes
(b) 4 genotypes; 3 phenotypes
(c) 4 genotypes; 4 phenotypes
(d) 3 genotypes; 3 phenotypes (NEET 2017)
14. A tall true breeding garden pea plant is crossed
with a dwarf true breeding garden pea plant.
When the F1 plants were selfed the resulting
genotypes were in the ratio of……
(a) 3 : 1 : : Tall : Dwarf
(b) 3 : 1 : : Dwarf : Tall
(c) 1 : 2 : 1 : : Tall homozygous : Tall heter-
ozygous : Dwarf
(d) 1 : 2 : 1 : : Tall heterozygous : Tall homo-
zygous : Dwarf. (NEET-I 2016)
15. A gene showing co-dominance has……
(a) alleles that are recessive to each other
(b) both alleles independently expressed in the
heterozygote
(c) one allele dominant on the other
(d) alleles tightly linked on the same
chromosome. (2015)
16. Alleles are… (2015 Can celled)
(a) different molecular forms of a gene
(b) heterozygotes
(c) different phenotype
(d) true breeding homozygotes.
17. Multiple alleles are present.. (2015 Cancelled)
(a) at the same locus of the chromosome
(b) on non-sister chromatids
(c) on different chromosomes
(d) at different loci on the same chromosome.
18. A man with blood group ‘A’ marries a woman
with blood group ‘B’. What are all the possible
blood groups of their offspring?
(a) A, B, AB and O (b) O only
(c) A and B only (d) A, B and AB only
(2015 Cancelled)
19. If two persons with ‘AB’ blood group marry and
have sufficiently large number of children, these
children could be classified as ‘A’ blood group:
‘AB’ blood group : ‘B’ blood group in 1 : 2 : 1 ratio.
Modern technique of protein electrophoresis
reveals presence of both ‘A’ and ‘B’ type proteins
in ‘AB’ blood group individuals. This in an
example of……
(a) partial dominance
(b) complete dominance
(c) codominance
(d) incomplete dominance. (NEET 2013)
20. Which idea is depicted by a cross in which the F1
generation resembles both the parents?
(a) Inheritance of one gene
(b) Co-dominance
(c) Incomplete dominance
(d) Complete dominance (NEET 2013)
21. F2 generation in a Mendelian cross showed that
both genotypic and phenotypic ratios are same
as 1 : 2 : 1. It represents a case of……
(a) co-dominance
(b) dihybrid cross
(c) monohybrid cross with complete domI nance
(d) monohybrid cross with incomplete
dominance. (2012)
22. A test cross is carried out to……
(a) determine the genotype of a plant at F2
(b) predict whether two traits are linked
(c) assess the number of alleles of a gene
(d) determine whether two species or varieties
will breed successfully. (Mains 2012)
23. Test cross in plants or in Drosophila involves
crossing……
(a) between two genotypes with recessive trait
(b) between two F1 hybrids
 (c) the F1 hybrid with a double recessive
genotype
(d) between two genotypes with dominant trait.
(Mains 2011)
24. ABO blood groups in humans are controlled by
the gene I. It has three alleles - IA, IB and i. Since
there are three different alleles, six different
genotypes are possible. How many phenotypes
can occur?
(a) Three (b) One
(c) Four (d) Two (2010)
25. The genotype of a plant showing the dominant
phenotype can be determined by…
(a) test cross (b) dihybrid cross
(c) pedigree analysis (d) back cross. (2010)
26. Which one of the following cannot be explained
on the basis of Mendel’s law of dominance?
(a) The discrete unit controlling a particular
character is called a factor.
(b) Out of one pair of factors one is dominant,
and the other recessive.
(c) Alleles do not show any blending and both
the characters recover as such in F2 generation.
(d) Factors occur in pairs. (2010)
27. ABO blood grouping is controlled by gene I
which has three alleles and show co-dominance.
There are six genotypes. How many phenotypes
in all are possible?
(a) Six (b) Three
(c) Four (d) Five (Mains 2010)
28. A cross in which an organism showing a
dominant phenotype is crossed with the
recessive parent in order to know its genotype is
called… (Mains 2010)
(a) monohybrid cross (b) back cross
(c) test cross (d) dihybrid cross.
29. In Antirrhinum two plants with pink flowers
were hybridized. The F1 plants produced red,
pink and white flowers in the proportion of 1
red, 2 pink and 1 white. What could be the
genotype of the two plants used for
hybridisation? Red flower colour is determined
by RR and white by rr genes.
(a) rrrr (b) RR
(c) Rr (d) rr (Mains 2010)
30. In pea plants, yellow seeds are dominant to
green. If a heterozygous yellow seeded plant is
crossed with a green seeded plant, what ratio of
yellow and green seeded plants would you
expect in F1 generation?
(a) 9 : 1 (b) 1 : 3
(c) 3 : 1 (d) 50 : 50 (2007)
31. A common test to find the genotype of a hybrid
is by
(a) crossing of one F2 progeny with female
parent
 (b) studying the sexual behaviour of F1
progenies
(c) crossing of one F1 progeny with male parent
(d) crossing of one F2 progeny with male parent.
(2007)
32. Test cross involves……
(a) crossing between two genotypes with
dominant trait
(b) crossing between two genotypes with
recessive trait
(c) crossing between two F1 hybrids
(d) crossing the F1 hybrid with a double
recessive genotype. (2006)
33. Phenotype of an organism is the result of……
(a) genotype and environment interactions
(b) mutations and linkages
(c) cytoplasmic effects and nutrition
(d) environmental changes and sexual dim or
phism. (2006)
34. A gene is said to be dominant if……
(a) it expresses its effect only in homozygous
state
(b) it expresses its effect only in heterozygous
condition
(c) it expresses its effect both in homozygous
and heterozygous condition
(d) it never expresses its effect in any condition.
(2002)
35. When dominant and recessive alleles express
itself together it is called… (2001)
(a) co-dominance (b) dominance
(c) amphidominance (d) pseudodominance.
36.
progeny of ratio
(a) 2 : 1 (b) 1 : 2 : 1
(c) 1 : 1 (d) 1 : 2. (1999)
37. A child’s blood group is ‘O’. The parent’s blood
groups cannot be……
(a) A and B (b) A and A
(c) AB and O (d) B and O. (1994)
38. A child of O-group has B-group father. The
genotype of father will be……
(a) IOIO (b) IBIB
(c) IAIB (d) IBIO. (1992)
39. An allele is dominant if it is expressed in……
(a) both homozygous and heterozygous states
(b) second generation
(c) heterozygous combination
(d) homozygous combination. (1992)
40. An organism with two identical alleles is……
(a) dominant (b) hybrid
(c) heterozygous (d)homozygous. (1992)
41. A man of A-blood group marries a woman of AB
blood group. Which type of progeny would
indicate that man is heterozygous A?
(a) AB (b) A
(c) O (d) B (1991)
42. Multiple alleles control inheritance of……
(a) phenylketonuria (b) colour blindness
(c) sickle cell anaemia
(d) blood groups. (1991)
43. The contrasting pairs of factors in Mendelian
crosses are called……
(a) multiple alleles (b) allelomorphs
(c) alloloci (d) paramorphs. (1991)
44. Mendel’s last law is……
(a) segregation (b) dominance
(c) independent assortment
(d) polygenic inheritance. (1991)
45. Blue eye colour is recessive to brown eye colour.
A brown eyed man whose mother was blue eyed
marries a blue-eyed woman. The children will
be……
(a) both blue eyed and brown eyed 1 : 1
(b) all brown eyed
(c) all blue eyed
(d) blue eyed and brown eyed 3 : 1. (1991)
46. RR (Red) Antirrhinum is crossed with white
(WW) one. Offspring RW are pink. This is an
example of……
(a) dominant-recessive
(b) incomplete dominance
(c) hybrid
(d) supplementary genes. (1991)
47. ABO blood group system is due to……
(a) multifactor inheritance
(b) incomplete dominance
(c) multiple allelism
(d) epistasis. (1990)
48. tt mates with Tt. What will be characteristic of
offspring? (1990)
(a) 75% recessive (b) 50% recessive
(c) 25% recessive (d) All dominant
49. Haploids are able to express both recessive and
dominant alleles/mutations because there
are……
(a) many alleles for each gene
(b) two alleles for each gene
(c) only one allele for each gene in the individual
(d) only one allele in a gene. (1988)
27.3 Inheritance of Two Genes
50. Experimental verification of the chromosomal
theory of inheritance was done by…..
 (a) Mendel (b) Sutton
(c) Boveri (d) Morgan.
(NEET 2020)
51. What map unit (centimorgan) is adopted in the
construction of genetic maps ?
(a) A unit of distance between genes on
chromosomes, representing 50% cross over.
(b) A unit of distance between two expressed
genes, representing 10% cross over.
(c) A unit of distance between two expressed
genes, representing 100% cross over.
(d) A unit of distance between genes on
chromosomes, representing 1% cross over.
(NEET 2019)
52. The frequency of recombination between gene
present on the same chromosome as a measure
of the distance between genes was explained
by… (NEET 2019)
(a) Sutton Boveri (b) T.H. Morgan
(c) Gregor J.Mendel (d) Alfred Sturtevant.
53. The mechanism that causes a gene to move from
one linkage group to another is called
(a) inversion (b) duplication
(c) translocation (d) crossing-over.
(NEET-II 2016)
54. In a test cross involving F1 dihybrid flies, more
parental-type offspring were produced than the
recombinant-type offspring. This indicates……
(a) the two genes are linked and present on the
same chromosome
(b) both of the characters are controlled by more
than one gene
(c) the two genes are located on two different
chromosomes
(d) chromosomes failed to separate during
meiosis. (NEET-I 2016)
55. The term “linkage” was coined by……
(a) G. Mendel (b) W. Sutton
(c) T.H. Morgan (d) T. Boveri. (2015)
56. The movement of a gene from one linkage group
to another is called… (2015 Cancelled)
(a) translocation (b) crossing over
(c) inversion (d) duplication.
57. Fruit colour in squash is an example of……
(a) recessive epistasis
(b) dominant epistasis
(c) complementary genes
(d) inhibitory genes. (2014)
58. Which of the following statements is not true of
two genes that show 50% recombination
frequency?
(a) The gene show independent assortment.
 (b) If the genes are present on the same
chromosome, they undergo more than one
cross-overs in every meiosis.
(c) The genes may be on different chromosomes.
(d) The genes are tightly linked. (NEET 2013)
59. When two unrelated individuals or lines are
crossed, the performance of F1 hybrid is often
superior to both its parents. This phenomenon
is called… (2011)
(a) heterosis (b) transformation
(c) splicing (d) metamorphosis.
60. Select the correct statement from the ones given
below with respect to dihybrid cross.
(a) Tightly linked genes on the same chrom-
osomes show higher recombinations.
(b) Genes far apart on the same chromosome
show very few recombinations.
(c) Genes loosely linked on the same
chromosome show similar recombinations.
(d) Tightly linked genes on the same chrom-
osome show very few recombinations. (2010)
61. A human male produces sperms with the
genotypes AB, Ab, aB and ab pertaining to two
diallelic characters in equal proportions. What is
the corresponding genotype of this person?...
(2007)
(a) AaBB (b) AABb
(c) AABB (d) AaBb
62. In Mendel’s experiments with garden pea, round
seed shape (RR) was dominant over wrinkled
seeds (rr), yellow cotyledon (YY) was dominant
over green cotyledon (yy). What are the
expected phenotypes in the F2 generation of the
cross RRYY × rryy?
(a) Round seeds with yellow cotyledons, and
wrinkled seeds with yellow cotyledons
(b) Only round seeds with green cotyledons
(c) Only wrinkled seeds with yellow cotyledons
(d) Only wrinkled seeds with green cotyledons
(2006)
63. In order to find out the different types of
gametes produced by a pea plant having the
genotype AaBb it should be crossed to a plant
with the genotype
(a) AABB (b) AaBb
(c) aabb (d) aaBB. (2005)
64. In a plant, red fruit (R) is dominant over yellow
fruit (r) and tallness (T) is dominant over
shortness (t). If a plant with RRTt genotype is
crossed with a plant that is rrtt,
(2004)
(a) 25% will be tall with red fruit
(b) 50% will be tall with red fruit
(c) 75% will be tall with red fruit
(d) all the offspring will be tall with red fruit.
65. Lack of independent assortment of two genes A
and B in fruit fly Drosophila is due to ……
(2004)
(a) repulsion (b) recombination
(c) linkage (d) crossing over.
66. Two crosses between the same pair of genotypes
or phenotypes in which the sources of the
gametes are reversed in one cross, is known as…
(2003)
(a) test cross (b) reciprocal cross
(c) dihybrid cross (d) reverse cross.
67. There are three genes a, b, c. Percentage of
crossing over between a and b is 20%, b and c is
28% and a and c is 8%. What is the sequence of
genes on chromosome? (2002)
(a) b, a, c (b) a, b, c
(c) a, c, b (d) None of these
68. Two non-allelic genes produces the new
phenotype when present together but fail to do
so independently then it is called……
(a) epistasis (b) polygene
(c) non complementary gene
(d) complementary gene. (2001)
69. A and B genes are linked. What shall be genotype
of progeny in a cross between AB/ab and ab/ab?
(2001)
(a) AAbb and aabb (b) AaBb and aabb
(c) AABB and aabb (d) None of these
70. Ratio of complementary genes is……
(a) 9 : 3 : 4 (b) 12 : 3 : 1
(c) 9 : 3 : 3 : 4 (d) 9 : 7. (2001)
71. Independent assortment of genes does not take
place when……
(a) genes are located on homologous
chromosomes
(b) genes are linked and located on same
chromosome
(c) genes are located on non-homogenous
chromosome
(d) all of these. (2001)
72. Due to the cross between TTRr ttrr the
resultant progenies show what percent of tall,
red flowered plants?
(a) 50% (b) 75%
(c) 25% (d) 100% (2000)
73. A gene pair hides the effect of another gene. The
phenomenon is called……
(a) dominance (b) segregation
(c) epistasis (d) mutation. (1999)
74. If Mendel had studied the seven traits using a
plant with 12 chromosomes instead of 14, in
what way would his interpretation have been
different ?
(a) He would not have discovered the law of
independent assortment.
 (b) He would have discovered sex linkage.
(c) He could have mapped the chromosome.
(d) He would have discovered blending or
incomplete dominance. (1998)
75. Crossing over in diploid organism is responsible
for……
(a) segregation of alleles
(b) recombination of linked alleles
(c) dominance of genes
(d) linkage between genes. (1998)
76. A fruit fly is heterozygous for sex-linked genes,
when mated with normal female fruit fly, the
males specific chromosome will enter egg cell in
the proportion……
(a) 3 : 1 (b) 7 : 1
(c) 1 : 1 (d) 2 : 1. (1997)
77. When two dominant independently assorting
genes react with each other, they are called…
(a) collaborative genes
(b) complementary genes
(c) duplicate genes
(d) supplementary genes. (1996)
78. When two genetic loci produce identical
phenotypes in cis and trans position, they are
considered to be……
(a) multiple alleles
(b) the parts of same gene
(c) pseudoalleles
(d) different genes. (1995)
79. The phenomenon, in which an allele of one gene
suppresses the activity of an allele of another
gene, is known as……
(a) epistasis (b) dominance
(c) suppression (d) inactivation. (1995)
80. Which of the following is suitable for
experiment on linkage? (1993)
(a) aaBB × aaBB (b) AABB × aabb
(c) AaBb × AaBb (d) AAbb × AaBB
81. Two dominant nonallelic genes are 50 map units
apart. The linkage is …… (1993)
(a) cis type (b) trans type
(c) complete (d) absent/incomplete.
82. Mendel studied inheritance of seven pairs of
traits in pea which can have 21 possible
combinations. If you are told that in one of these
combinations, independent assortment is not
observed in later studies, your reaction will
be……
(a) independent assortment principle may be
wrong
(b) Mendel might not have studied all the
combinations
(c) it is impossible
(d) later studies may be wrong. (1993)
83. In a cross between AABB . aabb, the ratio of F2
genotypes between AABB, AaBB, Aabb and aabb
would be
(a) 9 : 3 : 3 : 1 (b) 2 : 1 : 1 : 2
(c) 1 : 2 : 2 : 1 (d) 7 : 5 : 3 : 1. (1992)
84. Segregation of Mendelian factors (no linkage, no
crossing over) occurs during……
(a) anaphase I (b) anaphase II
(c) diplotene (d) metaphase I. (1992)
85. The allele which is unable to express its effect in
the presence of another is called……
(a) codominant (b) supplementary
(c) complementary (d) recessive. (1991)
86. Cross between AaBB and aaBB will form…
(a) 1AaBB : 1aaBB (b) all AaBB
(c) 3AaBB : 1aaBB (d) 1AaBB : 3aaBB.
(1990)
87. In a genetic cross having recessive epistasis, F2
phenotypic ratio would be…………
(a) 9 : 6 : 1 (b) 15 : 1
(c) 9 : 3 : 4 (d) 12 : 3 : 1. (1990)
88. Bateson used the terms coupling and repulsion
for linkage and crossing over. Name the correct
parental of coupling type alongwith its cross
over or repulsion.
(a) Coupling AABB, aabb; Repulsion AABB, aabb
(b) Coupling AAbb, aaBB; Repulsion AaBb, aabb
(c) Coupling aaBB, aabb; Repulsion AABB, aabb
(d) Coupling AABB, aabb; Repulsion AAbb, aaBB
(1990)
89. Segregation of Mendelian factor (Aa) occurs
during …… (1990)
(a) diplotene (b) anaphase I
(c) zygotene/pachytene (d) anaphase II.
90. Two linked genes a and b show 20%
recombination. the individuals of a dihybrid
cross between ++ / ++.ab/ab shall show
gametes…… (1989)
(a) ++ : 80 : : ab : 20
(b) ++ : 50 : : ab : 50
(c) ++ : 40 : : ab : 40 : : + a : 10 : : + b : 10
(d) ++ : 30 : : ab : 30 : : + a : 20 : : + b : 20.
27.4 Polygenic Inheritance
91. Which of the following characteristics represent
‘inheritance of blood groups’ in humans?
(NEET 2018)
(i) Dominance
(ii) Co-dominance
(iii) Multiple allele
(iv) Incomplete dominance
(v) Polygenic inheritance
(a) (ii), (iii) and (v) (b) (i), (ii) and (iii)
(c) (ii), (iv) and (v) (d) (i), (iii) and (v)
92. Inheritance of skin colour in humans is an
example of …
(2007)
(a) point mutation (b) polygenic inheritance
(c) codominance (d) chromosomal aberration.
93. How many different kinds of gametes will be
produced by a plant having the genotype
AABbCC?
(a) Two (b) Three
(c) Four (d) Nine (2006)
94. Which one of the following is an example of
polygenic inheritance?
(a) Skin colour in humans
(b) Flower colour in Mirabilis jalapa
(c) Production of male honeybee
(d) Pod shape in garden pea
(2006)
95. On selfing a plant of F1-generation with
genotype “AABbCC”, the genotypic ratio in F2-
generation will be……
(a) 3 : 1
(b) 1 : 1
(c) 9 : 3 : 3 : 1
(d) 27 : 9 : 9 : 9 : 3 : 3 : 3 : 1.
(2002)
96. In human beings, multiple genes are involved in
the inheritance of.. (1999)
(a) sickle-cell anaemia (b) skin colour
(c) colour blindness (d) phenylketonuria.
97. How many different types of genetically
different gametes will be produced by a
heterozygous plant having the genotype AABbCc
?
(a) Six (b) Nine
(c) Two (d) Four (1998)
98. The polygenic genes show……
(a) different karyotypes
(b) different genotypes
(c) different phenotypes
(d) none of these. (1996)
99. A polygenic inheritance in human beings is…….
(1993)
(a) skin colour (b) phenylketonuria
(c) colour blindness (d) sickle cell anaemia.
27.5 Pleiotropy
100. Match the terms in column I with their
description in column II and choose the correct
option. (NEET-I 2016)
Column I Column II

A. Dominance (i) Many genes

govern a single
character
 B. Co-dominance (ii) In a
heterozygous
organism only one
allele expresses
itself

C. Pleiotropy (iii) In a
heterozygous
organism both
alleles express
themselves fully

D. Polygenic (iv) A single gene

inheritance
influences many
characters

A B C D
(a) (iv) (i) (ii) (iii)
(b) (iv) (iii) (i) (ii)
(c) (ii) (i) (iv) (iii)
(d) (ii) (iii) (iv) (i)
101. A pleiotropic gene……
(a) controls a trait only in combination with
another gene
(b) controls multiple traits in an individual
(c) is expressed only in primitive plants
(d) is a gene evolved during Pliocene. (2015)
102. Which of the following is an example of
pleiotropy? (2002)
(a) Haemophilia (b) Thalassemia
(c) Sickle cell anaemia (d) Colour blindness
103. When a single gene influences more than one
trait it is called …… (1998)
(a) pseudodominance (b) pleiotropy
(c) epistasis (d) none of these.
27.6 Sex Determination
104. Select the incorrect statement…(NEET 2019)
(a) Human males have one of their sex-
chromosome much shorter than other.
(b) Male fruit fly is heterogametic.
(c) In male grasshoppers, 50% of sperms have
no sex-chromosome.
(d) In domesticated fowls, sex of progeny
depends on the type of sperm rather than egg.
105. Which of the following pairs is wrongly
matched?
(a) Starch synthesis in pea : Multiple alleles
(b) ABO blood grouping : Co-dominance
(c) XO type sex determination: Grasshopper
(d) T.H. Morgan : Linkage (NEET 2018)
106. Which one of the following conditions of the
zygotic cell would lead to the birth of a normal
human female child?... (Mains 2011)
(a) Two X chromosomes
 (b) Only one Y chromosome
(c) Only one X chromosome
(d) One X and one Y chromosome
107. In Drosophila, the sex is determined by….
(a) the ratio of number of X-chromosome to the
sets of autosomes
(b) X and Y chromosomes
(c) the ratio of pairs of X-chromosomes to the
pairs of autosomes
(d) whether the egg is fertilized or develops
parthenogenetically.
(2003)
108. Number of Barr bodies in XXXX female is..
(a) 1 (b) 2
(c) 3 (d) 4. (2001)
109. Male XX and female XY sometime occur due
to………… (2001)
(a) deletion
(b) transfer of segments in X and Y chromo-
some
(c) aneuploidy
(d) hormonal imbalance
110. Probability of four sons to a couple is……
(a) 1/4 (b) 1/8
(c) 1/16 (d) 1/32. (2001)
111. Genetic identity of a human male is determined
by……
(a) sex-chromosome (b) cell organelles
(c) autosome (d) nucleolus. (1997)
112. When an animal has both the characters of male
and female, it is called … (1996)
(a) super female (b) super male
(c) intersex (d) gynandromorph.
113. Mr. Kapoor has Bb autosomal gene pair and d
allele sex-linked. What shall be proportion of Bd
in sperms ?
(a) Zero (b) 1/2
(c) 1/4 (d) 1/8 (1993)
114. Sex is determined in human beings……
(a) by ovum
(b) at time of fertilisation
(c) 40 days after fertilisation
(d) seventh to eight week when genitals diffe-
rentiate in fetus. (1993)
115. A normal green male maize is crossed with
albino female. The progeny is albino because
……… (1989)
(a) trait for a albinism is dominant
(b) the albinos have biochemical to destroy
plastids derived from green male
(c) plastids are inherited from female parent
(d) green plastids of male must have mutated.
116. A family of five daughter only is expecting sixth
issue. The chance of its being a son is …
(a) zero (b) 25%
(c) 50% (d) 100%. (1988)
27.7 Mutation
117. One of the parents of a cross has a mutation in
its mitochondria. In that cross, that parent is
taken as a male. During segregation of F2
progenies that mutation is found in……
(a) one-third of the progenies
(b) none of the progenies
(c) all the progenies
(d) fifty percent of the progenies. (2004)
118. The most striking example of point mutation is
found in a disease called … (1995)
(a) Down’s syndrome (b) sickle cell anaemia
(c) thalassaemia (d) night blindness.
27.8 Genetic Disorders
119. Select the correct match. (NEET 2020)
(a) Haemophilia – Y linked
(b) Phenylketonuria – Autosomal dominant
trait
(c) Sickle cell anaemia – Autosomal recessive
trait, chromosome -11
(d) Thalassemia – X linked
120. What is the genetic disorder in which an
individual has an overall masculine
development, gynaecomastia and is sterile?
(a) Down’s syndrome
(b) Turner’s syndrome
(c) Klinefelter’s syndrome
(d) Edward syndrome (NEET 2019)
121. A woman has an X-linked condition on one of
her X chromosomes. This chromosome can be
inherited by
(a) only daughters (b) only sons
(c) only grandchildren
(d) both sons and daughters. (NEET 2018)
122. Thalassemia and sickle cell anaemia are caused
due to a problem in globin molecule synthesis.
Select the correct statement.
(a) Both are due to a quantitative defect in
globin chain synthesis.
(b) Thalassemia is due to less synthesis of globin
molecules.
(c) Sickle cell anaemia is due to a quantitative
problem of globin molecules.
(d) Both are due to a qualitative defect in globin
chain synthesis. (NEET 2017)
123. A disease caused by an autosomal primary non-
disjunction is……….
(a) Klinefelter’s syndrome
(b) Turner’s syndrome
 (c) Sickle cell anaemia
(d) Down’s syndrome. (NEET 2017)
124. If a colour-blind man marries a woman who is
homozygous for normal colour vision, the
probability of their son being colour-blind is….
(a) 0 (b) 0.5
(c) 0.75 (d) 1. (NEET-II 2016)
125. Pick out the correct statements.
(1) Haemophilia is a sex-linked recessive
disease.
(2) Down’s syndrome is due to aneuploidy.
(3) Phenylketonuria is an autosomal recessive
gene disorder.
(4) Sickle cell anaemia is an X-linked recessive
gene disorder.
(a) (1), (3) and (4) are correct.
(b) (1), (2) and (3) are correct.
(c) (1) and (4) are correct.
(d) (2) and (4) are correct. (NEET-I 2016)
126. Which of the following most appropriately
describes haemophilia? (NEET-I 2016)
(a) Chromosomal disorder
(b) Dominant gene disorder
(c) Recessive gene disorder
(d) X-linked recessive gene disorder
127. A colour blind man marries a woman with
normal sight who has no history of colour
blindness in her family. What is the probability
of their grandson being colour blind ?
(a) Nil (b) 0.25
(c) 0.5 (d) 1 (2015)
128. In the following human pedigree, the filled
symbols represent the affected individuals.
Identify the type of given pedigree.
(i)

(ii)

(iii)

(iv)

(a) Autosomal recessive

(b) X-linked dominant
(c) Autosomal dominant
(d) X-linked recessive (2015)
129. An abnormal human baby with ‘XXX’ sex
chromosomes was born due to…….
(a) fusion of two ova and one sperm
(b) fusion of two sperms and one ovum
(c) formation of abnormal sperms in the father
(d) formation of abnormal ova in the mother.
(2015 Cancelled)
130. A man whose father was colour blind marries a
woman who had a colour blind mother and
normal father. What percentage of male
children of this couple will be colour blind?
(a) 25% (b) 0%
(c) 50% (d) 75% (2014)
131. A human female with Turner’s syndrome…
(a) has 45 chromosomes with XO
(b) has one additional X chromosome
(c) exhibits male characters
(d) is able to produce children with normal
husband. (2014)
132. Select the incorrect statement with regard to
haemophilia.
(a) It is a dominant disease.
(b) A single protein involved in the clotting of
blood is affected.
(c) It is a sex-linked disease.
(d) It is a recessive disease. (NEET 2013)
133. If both parents are carriers for thalassaemia,
which is an autosomal recessive disorder, what
are the chances of pregnancy resulting in an
affected child?
(a) 25% (b) 100%
(c) No chance (d) 50% (NEET 2013)
134. Which one is the incorrect statement with
regard to the importance of pedigree analysis?
(a) It confirms that DNA is the carrier of genetic
information.
(b) It helps to understand whether the trait in
question is dominant or recessive.
(c) It confirms that the trait is linked to one of
the autosome.
(d) It helps to trace the inheritance of a specific
trait. (Karnataka NEET 2013)
135. Down’s syndrome in humans is due to…….
(a) three ‘X’ chromosomes
(b) three copies of chromosome 21
(c) monosomy
(d) two ‘Y’ chromosomes.
(Karnataka NEET 2013)
136. A normal-visioned man whose father was colour
blind, marries a woman whose father was also
colour-blind. They have their first child as a
daughter. What are the chances that this child
would be colour-blind?
(a) 100% (b) Zero percent
(c) 25% (d) 50% (2012)
137. Represented here is the inheritance pattern of a
certain type of trait in humans. Which one of the
following conditions could be an example of this
pattern? (Mains 2012)
 (a) Phenylketonuria (b) Sickle cell anaemia
(c) Haemophilia (d) Thalassemia
138. Which one of the following conditions correctly
describes the manner of determining the sex?
(a) Homozygous sex chromosomes (ZZ)
determine female sex in birds.
(b) XO type of sex chromosomes determine male
sex in grasshopper.
(c) XO condition in humans as found in Turner’s
syndrome, determines female sex.
(d) Homozygous sex chromosomes (XX) produce
male in Drosophila. (2011)
139. Which one of the following symbols and its
representation, used in human pedigree analysis
is correct ? (2010)

140. Study the pedigree chart of a certain family

given below and select the correct conclusion
which can be drawn for the character.

(a) The female parent is heterozygous.

(b) The parents could not have had a normal
daughter for this character.
(c) The trait under study could not be colour
blindness.
(d) The male parent is homozygous dominant.
(Mains 2010)
141. Select the incorrect statement from the
following.
(a) Galactosemia is an inborn error of
metabolism.
(b) Small population size results in random
genetic drift in a population.
(c) Baldness is a sex-limited trait.
(d) Linkage is an exception to the principle of
independent assortment in heredity.
(2009)
142. Sickle-cell anaemia is…….
(a)caused by substitution of valine by glutamic
acid in the beta globin chain of haemoglobin
(b) caused by a change in a single base pair of
DNA
 (c) characterized by elongated sickle like RBCs
with a nucleus
(d) an autosomal linked dominant trait. (2009)
143. Study the pedigree chart given below. What does
it show?
(a)Inheritance of a condition like phenylke-
tonuria as an autosomal recessive trait.
(b) The pedigree chart is wrong as this is not
possible.
(c) Inheritance of a recessive sex-linked disease
like haemophilia.
(d) Inheritance of a sex-linked inborn error of
metabolism like phenylketonuria. (2009)

144. Which one of the following conditions in

humans is correctly matched with its
chromosomal abnormality / linkage?
(a) Erythroblastosis fetalis - X-linked
(b) Down’s syndrome - 44 autosomes + XO
(c) Klinefelter’s syndrome - 44 autosomes + XXY
(d) Colour blindness - Y-linked (2008)
145. Both sickle cell anaemia and Huntington’s
chorea are……
(a) virus-related diseases
(b) bacteria-related diseases
(c) congenital disorders
(d) pollutant-induced disorders. (2006)
146. If a colour blind woman marries a normal
visioned man, their sons will be……
(a) all colour blind
(b) all normal visioned
(c) one-half colour blind and one-half normal
(d) three-fourths colour blind and one-fourth
normal. (2006)
147. Cri-du-chat syndrome in humans is caused by
the……
(a) trisomy of 21st chromosome
(b) fertilisation of an XX egg by a normal Y-
bearing sperm
(c) loss of half of the short arm of
chromosome 5.
(d) loss of half of the long arm of chro- mosome
5. (2006)
148. Sickle cell anaemia has not been eliminated from
the African population because (2006)
(a) it is controlled by dominant genes
(b) it is controlled by recessive genes
(c) it is not a fatal disease
(d) it provides immunity against malaria.
149. A man and a woman, who do not show any
apparent signs of a certain inherited disease,
have seven children (2 daughters and 5 sons).
Three of the sons suffer from the given disease
but none of the daughters affected. Which of the
following mode of inheritance do you suggest for
this disease?
(a) Sex-linked dominant
(b) Sex-linked recessive
(c) Sex-limited recessive
(d) Autosomal dominant (2005)
150. A woman with 47 chromosomes due to three
copies of chromosome 21 is characterised by..
(a) superfemaleness
(b) triploidy
(c) Turner’s syndrome
(d) Down’s syndrome. (2005)
151. Haemophilia is more commonly seen in human
males than in human females because..
(a) a greater proportion of girls die in infancy
(b) this disease is due to a Y-linked recessive
mutation
(c) this disease is due to an X-linked recessive
mutation
(d) this disease is due to an X-linked dominant
mutation. (2005)
152. Which of the following is not a hereditary
disease?
(a) Cystic fibrosis (b) Thalassaemia
(c) Haemophilia (d)Cretinism (2005)
153. A woman with normal vision, but whose father
was colour blind, marries a colour blind man.
Suppose that the fourth child of this couple
was a boy. This boy…….
(a) may be colour blind or may be of normal
vision
(b) must be colour blind
(c) must have normal colour vision
(d) will be partially colour blind since he is
heterozygous for the colour blind mutant allele.
(2005)
154. A male human is heterozygous for autosomal
genes A and B and is also hemizygous for
haemophilic gene h. What proportion of his
sperms will be abh?
(a) 1/8 (b) 1/32
(c) 1/16 (d) 1/4 (2004)
155. A normal woman, whose father was colour-blind
is married to a normal man. The sons would be…
(2004)
(a) 75% colour-blind (b) 50% colour-blind
(c) all normal (d) all colour-blind.
156. The recessive genes located on X-chromosome
humans are always…..
 (a) lethal
(b) sub-lethal
(c) expressed in males
(d) expressed in females. (2004)
157. Pattern baldness, moustaches and beard in
human males are examples of
(a) sex linked traits
(b) sex limited traits
(c) sex influenced traits
(d) sex determining traits. (2003)
158. Which one of the following conditions though
harmful in itself, is also potential saviour from a
mosquito borne infectious disease ?
(2003)
(a) Thalassaemia (b) Sickle cell anaemia
(c) Pernicious anaemia (d) Leukaemia
159. Down’s syndrome is caused by an extra copy of
chromosome number 21. What percentage of
offspring produced by an affected mother and a
normal father would be affected by this
disorder?
(a) 100 % (b) 75 %
(c) 50 % (d) 25 % (2003)
160. Christmas disease is another name for (2003)
(a) haemophilia B (b) hepatitis B
(c) Down’s syndrome (d) sleeping sickness.
161. A diseased man marries a normal woman. They
get three daughters and five sons. All the
daughters were diseased and sons were normal.
The gene of this disease is……
(a) sex linked dominant
(b) sex linked recessive
(c) sex limited character
(d) autosomal dominant. (2002)
162. Which of the following is a correct match?
(a) Down’s syndrome - 21st chromosome
(b) Sickle cell anaemia - X-chromosome
(c) Haemophilia - Y-chromosome
(d) Parkinson’s disease - X and Y chromo-some
(2002)
163. Sickle cell anaemia induce to……
(a) change of amino acid in a-chain of
haemoglobin
(b) change of amino acid in b-chain of
haemoglobin
(c) change of amino acid in both a and b chains
of haemoglobin
(d) change of amino acid either a or b chains of
haemoglobin. (2001)
164. Mongolian Idiocy due to trisomy in 21st
chromosome is called
(a) Down’s syndrome
(b) Turner’s syndrome
 (c) Klinefelter’s syndrome
(d) Triple X syndrome. (2000)
165. In Drosophila, the XXY condition leads to
femaleness whereas in human beings the same
condition leads to Klinefelter’s syndrome in
male. It proves
(a) in human beings Y chromosome is active in
sex determination
(b) Y chromosome is active in sex determination
in both human beings and Drosophila
(c) in Drosophila Y chromosome decides
femaleness
(d) Y chromosome of man have genes for
syndrome. (2000)
166. A marriage between normal visioned man and
colour blind woman will produce offspring
(a) colour blind sons and 50% carrier daughter
(b) 50% colour blind sons and 50% carrier
daughter
(c) normal males and carrier daughters
(d) colour blind sons and carrier daughters.
(1999)
167. Haemophilic man marries a normal woman.
Their offspring will be…….. (1999)
(a) all haemophilic
(b) all boys haemophilic
(c) all girls haemophilic
(d) all normal.
168. A woman with two genes for haemophilia and
one gene for colour blindness on one of the ‘X’
chromosomes marries a normal man. How will
the progeny be? … (1998)
(a) 50% haemophilic colour-blind sons and 50%
normal sons.
(b) 50% haemophilic daughters (carrier) and
50% colour blind daughters (carrier).
(c) All sons and daughters haemophilic and
colour blind.
(d) Haemophilic and colour-blind daughters.
169. Mental retardation in man, associated with sex
chromosomal abnormality is usually due to……
(a) moderate increase in Y complement
(b) large increase in Y complement
(c) reduction in X complement
(d) increase in X complement. (1998)
170. Albinism is known to be due to an autosomal
recessive mutation. The first child of a couple
with normal skin pigmentation was an albino.
What is the probability that their second child
will also be an albino?
(a) 50% (b) 75%
(c) 100% (d) 25% (1998)
171. A person with the sex chromosomes XXY suffers
from (1997)
 (a) gynandromorphism
(b) Klinefelter’s syndrome
(c) Down’s syndrome
(d) Turner’s syndrome.
172. In which of the following diseases, the man has
an extra X-chromosome?
(a) Turner’s syndrome
(b) Klinefelter’s syndrome
(c) Down’s syndrome
(d) Haemophilia (1996)
173. A person whose father is colour blind marries a
lady whose mother is daughter of a colour blind
man. Their children will be……
(a) all sons colour blind
(b) some sons normal and some colour blind
(c) all colour blind
(d) all daughters normal. (1996)
174. A genetically diseased father (male) marries
with a normal female and gives birth to 3 carrier
girls and 5 normal sons. It may be which type of
genetic disease?
(a) Sex-influenced disease
(b) Blood group inheritance disease
(c) Sex-linked disease
(d) Sex-recessive disease (1996)
175. An abnormal human male phenotype involving
an extra X-chromosome (XXY) is a case of……
(a) Edward’s syndrome
(b) Klinefelter’s syndrome
(c) intersex
(d) Down’s syndrome. (1995)
176. The genes, which remain confined to differential
region of Y-chromosome, are……
(a) autosomal genes
(b) holandric genes
(c) completely sex-linked genes
(d) mutant genes. (1994)
177. Albinism is a congenital disorder resulting from
the lack of which enzyme?
(a) Tyrosinase (b) Xanthine oxidase
(c) Catalase (d) Fructokinase (1994)
178. The colour blindness is more likely to occur in
males than in females because……
(a) the Y-chromosome of males have the genes
for distinguishing colours
(b) genes for characters are located on the sex
chromosomes
(c) the trait is dominant in males and recessive
in females
(d) none of these. (1994)
179. Of both normal parents, the chances of a male
child becoming colour blind are……
(a) none
 (b) possible only when all the four grand parents
had normal vision
(c) possible only when father’s mother was
colour blind
(d) possible only when mother’s father was
colour blind. (1993)
180. Of a normal couple, half the sons are
haemophiliac while half the daughters are
carriers. The gene is located on…. (1993)
(a) X-chromosome of father
(b) Y-chromosome of father
(c) one X-chromosome of mother
(d) both the X-chromosomes of mother.
181. A colour blind mother and normal father would
have……
(a) colour blind sons and normal/carrier
daughters
(b) colour blind sons and daughters
(c) all colour blind
(d) all normal. (1992)
182. Down’s syndrome is due to……
(a) crossing over (b) linkage
(c) sex-linked inheritance
(d) non-disjunction of chromosomes. (1992)
183. In human beings 45 chromosomes/single X/XO
abnormality causes……
(a) Down’s syndrome
(b) Kinefelter’s syndrome
(c) Turner’s syndrome
(d) Edward’s syndrome. (1992)
184. A colour blind girl is rare because she will be
born only when……
(a) her mother and maternal grand father were
colour blind
(b) her father and maternal grand father were
colour blind
(c) her mother is colour blind and father has
normal vision
(d) parents have normal vision but grand
parents were colour blind. (1991)
185. In Down’s syndrome of a male child, the sex
complement is……
(a) XO (b) XY
(c) XX (d) XXY. (1990)
186. Haemophilia is more common in males because
it is a … (1990)
(a) recessive character carried by Y chro-
mosome
(b) dominant character carried by Y-
chromosome
(c) dominant trait carried by X-chromosome
(d) recessive trait carried by X-chromosome.
187. Which one is a hereditary disease? (1990)
 (a) Cataract (b) Leprosy
(c) Blindness (d) Phenylketonuria
188. Both husband and wife have normal vision
though their fathers were colour blind. The
probability of their daughter becoming colour
blind is……
(a) 0% (b) 25%
(c) 50% (d) 75%. (1990)
189. The production of gametes by the parents,
formation of zygote, the F1 and F2 plants, can be
understood from a diagram called ……
(NEET-2021)
(a) Bullet square (b) Punch square
(c) Punnett square (d) Net square
190. Now-a-days, it is possible to detect the mutated
gene causing cancer by allowing. radioactive
probe to hybridise its complimentary DNA in a
clone of cells, followed by its detection using
autoradiography because (NEET-2021)
(a) mutated gene partially appears on a
photographic film
(b) mutated gene completely and clearly appears
on a photographic film
(c) mutated gene does not appear on a
photographic film as the probe has no
complementarity with it
(d) mutated gene does not appear on
photographic film as the probe has
complementarity with it
191. In a cross between a mala and female, both
heterozygous for sickle-cell anaemia gene, what
percentage of the progeny will be diseased ?
(NEET-2021)
(a) 50 % (b) 75 %
(c) 25 % (d) 100 %
192. Xo type sex determination can be found in :
(NEET-2022)
(a) Drosophila (b) Birds
(c) Grasshoppers (d) Monkeys
193. Given below are two statements:
(NEET-2022)
Statement I : Mendel studied seven pairs of
contrasting traits in pea plants and proposed the
Laws of Inheritance
Statement II : Seven characters examined by
Mendel in his experiment on pea plants were
seed shape and colour, flower colour, pod shape
and colour, flower position and stem height
………
In the light of the above statements, choose the
correct answer from the options given below :
(a) Both Statement I and Statement II are
correct
(b) Both Statement I and Statement II are
incorrect
(c) Statement I is correct but Statement II is
incorrect
 (d) Statement I is incorrect but Statement II is
correct
194. Given below are two statements: one is labelled
as Assertion (A) and the other is labelled as
Reason (R).
Assertion(A): Mendel's law of Independent
assortment does not hold good for the genes that
are located closely on the same chromosome.
Reason (R): Closely located genes assort
independently. In the light of the above.
statements, choose the correct answer from the
options given below:
(a) Both (A) and (R) are correct and (R) is the
correct explanation of (A)
(b) Both (A) and (R) are correct but (R) is not
the correct explanation of (A)
(c) (A) is correct but (R) is not correct
(d) (A) is not correct but (R) is correct
195. Which of the following occurs due to
thepresence of autosome linked dominant trait?
(NEET-2022)
(a) Sickle cell anaemia
(b) Myotonic dystrophy
(c) Haemophilia
(d) Thalessemia
196. The recombination frequency between the genes
a & c is 5%, b & c is 15%, b & d is 9%, a & b is
20%, c & d is 24% and a & d is 29%. What will
be the sequence of these genes on a linear
chromosome? (NEET-2022)
(a) a, d, b, c (b) d, b, a, c
(c) a, b, c, d (d) a, c, b, d
197. If a colour blind female marries a man whose
mother was also colour blind, what are the
chances of her progeny having colour……
(a) 25% (b) 50%
(c) 75% (d) 100% [NEET-2022]
198. The phenomenon of pleiotropism refers to…
[NEET-2023]
(a) presence of two alleless, each of the two
genes controlling a single trait.
(b) a single gene affecting multiple phenotypic
expression.
(c) more than two genes affecting a single
character.
(d) presence of several alleles of a single gene
controlling a single crossover.
199. Frequency of recombination between gene pairs
on same chromosome as a measure of the
distance between genes to map their position on
chromosome, was used for the first time by……
[NEET-2023]
(a) Sutton and Boveri (b) Alfred Sturtevant
(c) Henking (d)Thomas Hunt Morgan
200. Unequivocal proof that DNA is the genetic
material was first proposed by... [NEET-2023]
(a) Alfred Hershey and Martha Chase
(b) Avery, Macleoid and McCarthy
 (c) Wilkins and Franklin
(d) Frederick Griffith
201. Which of the following statements are correct
about Klinefelter's Syndrome? [NEET-2023]
A. This disorder was first described by Langdon
Down (1866).
B. Such an individual has overall masculine
development. However, the feminine
development is also expressed.
C. The affected individual is short statured.
D.Physical, psychomotor and mental
development is retarded.
E. Such individuals are sterile.
Choose the correct answer from the options
given below:
(a) C and D only (b)B and E only
(c) A and E only (d)A and B only
202. Broad palm with single palm crease is visible in
a person suffering from- [NEET-2023]
(a) Turner's syndrome
(b) Klinefelter’s syndrome
(c) Thalassemia (d) Down's syndrome
203. Which one of the following symbols represents
mating between relatives in human pedigree
analysis?
(1) (2)

(3) (4)
[NEET-2023]
204. Which one of the following is the sequenate on
corresponding coding strand, if the sequence on
mRNA formed follows?
[NEET-2023]
5’AUCGAUCGAUCGAUCGAUGG AUCG AUCG 3'?
(1) 3' UAGCUAGCUAGCUAGCUA
GCUAGCUAGC 5'
(2) 5' ATCGATCGATCGATCGATCG
ATCGATCG 3'
(3) 3' ATCGATCGATCGATCGATG
ATCGATCG 5'
(4) 5' UAGCUAGCUAGCUAGCUA GCUAGC
UAGC 3'